CN114524869A

CN114524869A - Toxoplasma gondii microglin MIC17a and application thereof

Info

Publication number: CN114524869A
Application number: CN202210088491.4A
Authority: CN
Inventors: 申邦; 陈金玲; 周艳琴; 方瑞; 赵俊龙; 贺兰; 胡敏; 范柏林; 李亚琼; 曹卉; 薛丽兰; 殷小艳
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-01-25
Filing date: 2022-01-25
Publication date: 2022-05-24
Anticipated expiration: 2042-01-25
Also published as: CN114524869B

Abstract

The invention discloses a toxoplasma gondii microwlin MIC17a and application thereof, wherein the amino acid sequence of the toxoplasma gondii microwlin MIC17a is shown in SEQ ID No. 1; the nucleotide sequence of the gene MIC17a for encoding the toxoplasma gondii microwlin is shown in SEQ ID No. 2. The indirect enzyme-linked immunoassay kit prepared from the protein has the characteristics of high sensitivity, strong specificity, good accuracy and the like in the detection of the feline toxoplasmosis.

Description

Toxoplasma gondii microglin MIC17a and application thereof

Technical Field

The invention relates to the field of toxoplasmosis detection, and in particular relates to toxoplasma gondii microwire protein MIC17a and application thereof.

Background

Toxoplasma is a parasitic protozoa which is widely distributed in the world and which causes diseases in humans and various animals. It is estimated that approximately 1/3 people worldwide infect Toxoplasma gondii. Pregnant women or pregnant animals are infected with toxoplasma, and fetal malformation, abortion, stillbirth, weak fetus and the like can occur. Toxoplasma gondii also causes eye diseases, heart diseases, neurological symptoms, malnutrition and immunity degradation of the body, and the like. Cats are the terminal host of toxoplasma, and after infection, oocysts are excreted, and develop into infectious oocysts in the environment for 2-7 days, which is the main transmission pathway of toxoplasma. Modern people raise cats more and more as pets, so that the probability of people infecting toxoplasma is increased. In addition, the data show that the average infection rate of the sheep flock is about 10%, the infection rate of the pigs is the highest and is generally more than 20%, and some farms are even as high as 100%. There are studies showing that the rate of toxoplasma infection in farm animals is related to the number of cats in the surrounding area. Therefore, the establishment of a feline toxoplasmosis detection method has great significance.

The existing detection methods for feline toxoplasmosis at home and abroad comprise three methods, namely etiology detection, molecular biology detection and serology method:

1. the etiology detection is to detect oocysts from cat excrement, the method is accurate and reliable, but is time-consuming and labor-consuming, has low detection rate and is not suitable for large-scale detection, and the method also has higher biosafety risk due to the zoonosis characteristics of toxoplasma and high infectivity of the oocysts.

2. The molecular biological method mainly detects the specific nucleic acid segment of toxoplasma in the pathological material, and is an important means for diagnosing the toxoplasmosis in the laboratory. However, since the pathogens in blood and body fluid samples are very small and the handling of fecal samples has a high risk of biosafety, this method is not very practical for the in vivo detection of cats in clinics and the like.

3. The serological method is to detect toxoplasma antibody or antigen by immunological reaction, and is mainly divided into LAT (latex agglutination test), IHA (indirect hemagglutination test), IFA (indirect immunofluorescence test), ELISA (enzyme-linked immunosorbent assay) and the like. Among them, the ELISA method has strong sensitivity, high specificity, easy realization of automatic operation, rapidness, simplicity, convenience, no special requirements for operators, capability of processing a large number of samples in a short time, and suitability for on-site investigation and popularization, thus receiving wide attention. However, because the gene expression of Toxoplasma gondii infected different animals (especially the terminal host cat and various intermediate hosts) is different, the selection of the diagnostic antigen is very critical to the accuracy of the detection. Some diagnostic methods and kits reported and used at present mostly use SAG1 and the like as antigens highly expressed in the tachyzoite stage (the toxoplasma in the form of an intermediate host), while cats are terminal hosts of toxoplasma, and the gene expression after infection is quite different from that of human, pig, sheep and other intermediate hosts, so that the selection of SAG1 and the like as antigens highly expressed in the tachyzoite stage as diagnostic antigens of toxoplasmosis of cats is not necessarily ideal. The present invention solves this technical problem.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a toxoplasma gondii microwin MIC17a and application thereof, wherein the toxoplasma gondii microwin MIC17a is a protein with high expression in the merozoite period of the toxoplasma gondii in the sexual reproduction stage, and the sexual reproduction stage of the toxoplasma gondii is only carried out in a cat body, so that the protein MIC17a has good specificity and is suitable for diagnosing toxoplasmosis of the cat; the kit for preparing the indirect enzyme-linked immunity for detecting the feline Toxoplasma gondii IgG antibody by using the protein MIC17a has the characteristics of strong specificity, high sensitivity and good accuracy.

In order to achieve the purpose, the toxoplasma gondii microwlin MIC17a is designed, and the amino acid sequence of the toxoplasma gondii microwin MIC17 is shown as SEQ ID No. 1.

The nucleotide sequence of the gene MIC17a for encoding toxoplasma gondii microwire protein MIC17a is shown in SEQ ID No. 2.

The invention also provides application of the toxoplasma gondii microwlin MIC17a in cat toxoplasmosis immunodetection.

The invention also provides application of the toxoplasma gondii microwlin MIC17a in preparation of an indirect enzyme-linked immunosorbent kit for detecting the specific IgG antibody of the cat toxoplasma gondii.

The invention also provides an indirect enzyme-linked immunoassay kit for detecting the specific IgG antibody of the cat toxoplasma, which comprises an ELISA plate coated with the toxoplasma gondii microwire protein MIC17a, a concentrated washing solution, a positive control, a negative control, a diluent, a concentrated ELISA antibody, a developing solution and a stop solution.

Further, in the kit, the formula of each component is as follows:

the positive control is positive serum of the cat toxoplasma gondii,

the negative control is feline toxoplasma negative serum,

the concentrated enzyme-labeled antibody is HRP goat anti-cat IgG;

concentrating the washing solution: adding 0.5mL of Tween-20 into 1000mL of PBS buffer solution, uniformly mixing, and storing at 4 ℃;

sealing liquid: 0.1g bovine serum albumin was dissolved in 100mL of the washing solution;

diluting liquid: 0.1g bovine serum albumin was dissolved in 100mL of the washing solution;

substrate buffer: 24.3mL of 0.1mol/L citric acid, 25.7mL of 0.2mol/L sodium dihydrogen phosphate, and the use of ddH₂And O is metered to 50 mL.

Color development liquid: TMB mother liquor and substrate buffer solution are mixed according to the proportion of 1:19, 0.2 mu L of 30% hydrogen peroxide is added into each milliliter of substrate color developing solution, the solution is used as it is when necessary, and the light is avoided in the preparation process.

Stopping liquid: 625 μ L of 40% hydrofluoric acid in 100mL ddH₂And (4) in O.

The invention also provides a method for detecting the cat toxoplasma gondii specific IgG antibody by using the kit, which comprises the following steps:

1) adding 98 mu L of diluent into a plurality of holes of an enzyme label plate, and then respectively adding 2 mu L of samples to be detected, positive control and negative control into corresponding holes; incubation;

2) discarding the liquid in the hole, adding 300 mu L of washing liquid to wash the plate, and repeating the steps for multiple times;

3) adding 100 mu L of enzyme-labeled antibody into the hole, and incubating;

4) discarding the liquid in the hole, adding 300 mu L of washing liquid to wash the plate, and repeating the steps for multiple times;

5) adding 100 mu L of color development solution into the hole, and incubating; add 50. mu.L stop solution to the well to stop the reaction;

6) the absorbance was read and recorded at a wavelength of 630nm,

if the OD of the sample S to be measured_{630 value}OD of negative control N_{630 value}The result is judged to be positive if the value is more than or equal to 2.55; otherwise, the result is negative.

The invention has the beneficial effects that:

1. the kit has high sensitivity: the result shows that the sensitivity of the detection method of the MIC17a-iELISA kit disclosed by the invention is more than 1:200, meeting the requirement of field detection.

2. The kit has good specificity: the detection method of the kit does not have cross reaction with feline panleukopenia, feline coccidiosis and the like.

3. The kit is quick, simple and convenient: the automatic operation is easy to realize, no special requirement is required for operators, and a large amount of samples can be processed in a short time.

4. The kit has simple detection results: the positive/negative of the cat Toxoplasma gondii can be qualitatively judged according to the reading size (ratio).

Drawings

FIG. 1 shows the result of PCR amplification of the Toxoplasma gondii MIC17a coding sequence,

in the figure: lane M, DNA molecular mass standard; 1: amplification product of MIC17a coding sequence.

FIG. 2 shows the result of PCR amplification of pET28a,

in the figure: lane M, DNA molecular mass standard; 1pET28a vector amplification product.

FIG. 3 shows the result of identifying recombinant plasmid pET28a-MIC17a,

in the figure: lane M protein standards; 1, pET28a-MIC17a plasmid restriction enzyme product.

FIG. 4 is a result of SDS-PAGE analysis of an expression product of pET28a-MIC17a,

in the figure: lane M: protein molecular mass standard; 1: non-induced His-MIC17 a; 2: His-MIC17a was induced.

FIG. 5 shows the result of SDS-PAGE purification of the expression product of pET28a-MIC17a,

in the figure: lane M: protein molecular mass standard; 1: His-MIC17a was purified.

Detailed Description

The present invention is described in further detail below with reference to specific examples so as to be understood by those skilled in the art.

Example 1 preparation of microwlin MIC17a

Extracting Total RNA of toxoplasma tachyzoite, obtaining cDNA by using a reverse transcription kit of Takara company, designing related primers according to a required target fragment, amplifying the target fragment by a PCR method, connecting an MIC17a-CDS fragment to a pET28a vector by a homologous recombination method, transferring the constructed pET28a-MIC17a plasmid into escherichia coli BL21(DE3) for expression after PCR identification and sequencing verification, and specifically comprising the following steps:

obtaining fragments of MIC17 mesh

(1) Extraction of Toxoplasma tachyzoite Total RNA

Centrifuging the collected worm bodies, removing the supernatant, adding 1mL of Trizol for heavy suspension and precipitation, repeatedly blowing, uniformly mixing, transferring the sample into a 1.5mL centrifuge tube without RNase, violently shaking and vortexing for 3min to fully crack the worm bodies, and standing at room temperature for 10 min; adding chloroform into 200 mu L of chloroform/mL of Trizol, oscillating for 15sec with force, and standing for 2-3 min at room temperature; centrifuging at 12000rpm for 15min at 4 deg.C; carefully sucking the upper aqueous phase, placing the upper aqueous phase in a new 1.5mL RNase-free centrifuge tube, adding isopropanol with the same volume, fully and uniformly mixing, and placing the mixture at room temperature for precipitation for 10 min; centrifuging at 12000rpm for 10min at 4 deg.C, discarding supernatant, and precipitating RNA at the bottom of the tube in the form of white precipitate; adding 1mL of 75% ethanol prepared by DEPC water, turning over a centrifugal tube, and washing and precipitating; centrifuging at 4 deg.C and 7500rpm for 5min, discarding supernatant, and air drying in a super clean bench; adding 30 mu L of RNase-free DEPC water, and dissolving RNA precipitate; the extracted Total RNA was characterized for quality by 1.5% agarose gel electrophoresis and Total RNA concentration and purity was determined by UV spectrophotometer.

(2) Preparation of Toxoplasma cDNA

Mu.g of Total RNA was used to obtain cDNA using Takara reverse transcription kit, and the following reagents were added in order:

step 1: removal of gDNA:

reacting in a PCR instrument at 42 ℃ for 2min and at room temperature for 30min, and cooling on ice;

step 2: reverse transcription into cDNA:

the reaction was carried out in a PCR apparatus at 37 ℃ for 60min, 85 ℃ for 5sec, and the product was stored at-20 ℃.

2. Construction of recombinant plasmid pET28a-MIC17a

(1) Based on the sequence of the commercial PET28a plasmid and the nucleotide sequence of the gene MIC17a as shown in SEQ ID No.2, a primer pair was designed using clonmanager software: MIC17 a-F: AGCAAATGGGTCGCGGATCCGGGCTCCGGAGACAGCTAGTC, MIC17 a-R: TCCTTTCGGGCTTTGTTTTAGCATGTGATATCGCCTGCTT, respectively;

using cDNA obtained by reverse transcription as a template for amplifying a target gene coding sequence, and carrying out PCR amplification to obtain a target fragment containing a restriction enzyme site; the target fragment contains a gene MIC17a shown as SEQ ID No.2, which codes toxoplasma gondii microwire protein MIC17a, and the amino acid sequence of the target fragment is shown as SEQ ID No. 1.

(2) Amplification of the PET28a vector fragment

The upstream primer PET28a-F and the downstream primer PET28a-R of the amplified PET28a vector were designed using clonmanager software according to the sequence of the commercial PET28a plasmid. Using the PET28a plasmid as a template, a 5369bp band was obtained by PCR amplification, which was consistent with the expected result, see FIG. 2, and the fragment was recovered using a gel recovery kit.

The PCR reaction system is as follows:

the PCR reaction conditions were as follows:

(3) recovery of target fragments

Performing operation according to the instruction of the Omiga DNA agarose gel recovery kit, cutting and recovering the target fragment with a single band, and putting the target fragment into a 1.5mL centrifuge tube; adding the sol solution with the same volume, performing water bath at 60 deg.C for 10min, and mixing the gel by reversing the centrifuge tube every 2min to melt the gel completely; cooling the melted gel liquid to room temperature, adding the gel liquid into a DNA recovery column, and standing for 1min at room temperature; centrifuging at 10000 Xg for 1min at room temperature, and discarding the effluent in the collecting pipe; adding 300 mu L binding buffer into the recovery column, centrifuging at room temperature of 13000 Xg for 1min, and discarding the effluent in the collection tube; adding 700 μ L of SPW wash buffer into the recovery column, standing at room temperature for 1min, centrifuging at 13000 Xg at room temperature for 1min, and discarding the effluent from the collection tube. Centrifuging 13000 Xg of empty recovery column for 2min, discarding the residual effluent liquid in the collection tube, placing the recovery column into a new 1.5mL centrifuge tube, and drying at room temperature to volatilize the residual ethanol; adding 10-30 mu L of preheated sterile water with the temperature of 65 ℃ to the intermediate film of the recovery column, standing for 2min at room temperature, centrifuging for 2min at the room temperature of 13000g, and collecting effluent liquid to respectively obtain an MIC17a-CDS fragment and a PET28a vector fragment; storing at-20 deg.C.

(4) Construction of pET28a-MIC17a plasmid

The MIC17a-CDS fragment and the PET28a vector fragment are connected by using a homologous recombination method, after connection, a connection product is transferred into Escherichia coli competent cells DH5 alpha by using a heat shock method, a transformation product is smeared on an LB plate with kanamycin resistance and is inversely grown overnight, a single colony is picked up and is identified by PCR, and the result is consistent with the expectation and is shown in a figure 3. And (5) extracting plasmids after amplification culture, and performing sequencing verification. Comparing the sequencing result with CDS of MIC17a gene in the database, wherein the two can be completely matched without occurrence of frameshift or mutant base, and the result proves that the construction of the recombinant expression plasmid PET28a-MIC17a is successful;

a. homologous recombination construction plasmid

The operation is carried out according to the instruction of the Novowed multi-fragment cloning kit, and the system configuration in the instruction book is as follows:

mixing the above liquids, reacting in PCR instrument at 37 deg.C for 30min, and performing ice bath for 5min for transformation.

The optimum amount of each fragment was [0.02 Xthe number of base pairs of the fragment ] ng (0.03 pmol).

b. Ligation product conversion

Taking chemically competent cells of Escherichia coli preserved at-80 ℃, and thawing on ice; adding the ligation product (or plasmid), mixing, and standing on ice for 30 min; heating in 42 deg.C water bath for 95sec, rapidly taking out, and ice-cooling for 2 min;

adding 400 μ L LB liquid culture medium without antibiotics, resuscitating at 37 deg.C and 180rpm for 60 min; coating 300 mu L of the mixture on a corresponding LB plate, and inversely culturing the mixture at 37 ℃ for 10-12 h.

3. Expression and purification of microlin MIC17a

The prokaryotic expression plasmid PET28a-MIC17a successfully constructed is transformed into an escherichia coli expression competent strain BL21(DE3), the transformed bacterial liquid is coated on an LB plate with kanamycin resistance, cultured overnight at 37 ℃, single colony is picked up, expanded and cultured, induction expression is carried out by IPTG with the final concentration of 1.0mM under the conditions that the culture temperature is 37 ℃, the shaking speed is 180rpm and the induction time is 4 hours, and an uninduced control group is arranged. The bacterial solutions of the induced group and the non-induced group after the induction expression were pooled, the supernatant was discarded, and SDS-PAGE analysis was performed after sample treatment (the pellet was resuspended in 40. mu.L of PBS, added with 50. mu.L of loading buffer and 10. mu.L of DTT, and boiled in boiling water for 10min), and the results are shown in FIG. 4. As a result, a thicker protein band at 35.3kDa was found in the induced group compared with the non-induced group, indicating that the recombinant plasmid PET28a-MIC17a was successfully expressed in the competent strain BL21(DE 3). The PET28a-MIC17a expression strain was cultured and induced under the same conditions as described above, and then subjected to pressure disruption (4 ℃ at 1000bar for 3 times), centrifuged at 12000rpm for 10min to separate the supernatant and inclusion bodies, and the supernatant and inclusion bodies were sampled and processed, followed by SDS-PAGE analysis, and the results are shown in FIG. 4. The results of this analysis indicated that the vast majority of PET28a-MIC17a was expressed in inclusion bodies.

Carrying out amplification culture on the PET28a-MIC17a expression strain, adding an Inducer (IPTG) with the final concentration of 1.0mM for induction at 37 ℃ for 4h, centrifugally collecting thalli, crushing the thalli by using a pressure crusher, centrifugally taking inclusion bodies at 4 ℃, washing precipitates for 2-3 times by using PBS (phosphate buffer solution), adding 19.7ml of BufferA,19.7 mu L of DTT and 0.3ml of 20% SKL storage solution into the precipitates, violently shaking to slowly dissolve the BufferA, and standing at room temperature for 30in-1h (or overnight at 4 ℃). The supernatant was collected by centrifugation at 12000r at 4 ℃. 210 μ L of 20% PEG4000 was added to a final concentration of 0.2%, and 420 μ L of 50mm oxidized glutathione was added to a final concentration of 1 mm. Adding 420 μ L100 mm reduced glutathione to final concentration of 2mm, and standing for 30min-2h (or overnight at 4 deg.C). Dialyze against 3L PBS for 72h, and magnetically stir at 4 ℃. (after every 6h, every 12h after 24 h) after dialysis, the supernatant was filtered with a 0.45um filter, then bound to his-labeled affinity column for 1h, and the proteins were eluted from low to high with different concentrations of imidazole, and the eluted proteins were analyzed by SDS-PAGE, the results are shown in FIG. 5. And dialyzing and concentrating the protein with better purity, and determining the protein concentration by using a Byunnan BCA protein concentration determination kit to obtain the protein MIC17 a.

Example 2 establishment of detection conditions for an indirect enzyme-linked immunosorbent kit for detecting feline Toxoplasma gondii-specific IgG antibodies:

1. determination of antigen coating concentration and serum dilution fold:

respectively adding MIC17a proteinThe plate was coated with 6 wells per concentration by dilution in a gradient of 8. mu.g/mL, 4. mu.g/mL, 2. mu.g/mL, 1. mu.g/mL, 0.5. mu.g/mL, 0.25. mu.g/mL. The negative and positive control sera were diluted with 1:25, 1:50, 1:100, 1:200, 1:400, 1:800 incubation solutions, respectively, and added to one row of 6 wells per dilution. The OD was measured by ELISA in accordance with the conventional procedure₆₃₀Comparing the P/N values corresponding to the antigens, and selecting the antigen coating concentration and the serum dilution multiple corresponding to the position with the maximum P/N value of the optimal antigen as the optimal conditions;

the results show that the optimal antigen coating concentration is 1 mug/mL, and the optimal serum dilution factor is 1: 50.

2. Optimization of optimal blocking concentration and optimal blocking time:

and (3) optimizing the blocking concentration and the blocking time according to the optimal conditions of the optimized antigen coating concentration and serum dilution factor. Fixing other test conditions, blocking with 0.05%, 0.1%, 0.5%, 1%, 2% BSA (bovine serum albumin) for 20min, 30min, 45min, 60min, 75min, performing ELISA routine procedure, reading with microplate reader, plotting line graph, and comparing OD₆₃₀The size of the P/N (positive serum/negative serum) value is determined, and the blocking concentration and blocking time corresponding to the position with the maximum P/N value are selected as the optimal conditions.

The results show that the optimal blocking concentration is 0.1% BSA and the optimal blocking time is 45 min.

3. Optimization of optimal action time of serum:

fixing other test conditions according to the determined conditions, adding serum, acting for 20min, 30min, 45min, 60min and 75min, respectively, performing ELISA conventional steps, and selecting serum acting time according to P/N value.

The results show that the optimal serological time is 60 min.

4. Optimization of optimal action concentration and time of the secondary antibody:

according to the determined conditions, fixing other test conditions, and respectively carrying out enzyme-labeled secondary antibodies according to the ratio of 1:500, 1:1000, 1:2000 and 1: 3000. diluting at the ratio of 1:4000, 1:5000 and 1:6000, performing ELISA conventional steps, and selecting the concentration of the secondary antibody according to the P/N value. Similarly, fixing other test conditions, adding the enzyme-labeled secondary antibody, acting for 20min, 30min, 45min, 60min and 75min respectively, operating according to the conventional steps of ELISA, and selecting the acting time of the secondary antibody according to the P/N value.

The results show that the optimal secondary antibody acting concentration is 1:3000, and the optimal secondary antibody acting time is 60 min.

5. Optimization of optimal action time of the substrate fixes other test conditions, the substrate is acted for 5min, 10min, 15min and 20min respectively, the operation is carried out according to the conventional steps of ELISA, and the action time of the substrate is selected according to the P/N value.

The results show that the optimal substrate action time is 45 min.

Example 3 an indirect enzyme-linked immunosorbent assay kit for detecting a feline Toxoplasma gondii-specific IgG antibody and a detection method thereof were obtained based on the above conditions:

1. the indirect enzyme-linked immune kit comprises: an elisa plate coated with toxoplasma gondii microwin MIC17a prepared in example 1, a concentrated washing solution (20 ×), a positive control (cat toxoplasma gondii positive serum), a negative control (cat toxoplasma gondii negative serum), a diluent, a concentrated enzyme-labeled antibody (HRP goat anti-cat IgG) (10 ×), a developing solution and a stop solution; wherein,

wash solution (PBST): adding 0.5mL of Tween-20 into 1000mL of PBS buffer solution, uniformly mixing, and storing at 4 ℃;

sealing liquid: 0.1g Bovine Serum Albumin (BSA) was dissolved in 100mL of the washing solution;

diluting liquid: 0.1g Bovine Serum Albumin (BSA) was dissolved in 100mL of the washing solution;

substrate buffer (citric acid buffer at pH 5.0): 24.3mL of 0.1mol/L citric acid, 25.7mL of 0.2mol/L sodium dihydrogen phosphate (NaH2PO4), and a volume of 50mL of ddH 2O.

Color development liquid: mixing TMB mother liquor and substrate buffer solution at a ratio of 1:19, and adding 0.2 μ L of 30% hydrogen peroxide (H) into each ml of substrate color developing solution₂O₂) It must be prepared immediately before use, and should be protected from light during preparation.

Stop solution (0.25% HF solution): 625 μ L of 40% hydrofluoric acid in 100mL ddH₂And (4) in O.

The above kit uses PBS buffer, coating solution, substrate buffer and TMB mother solution as conventional solvents, and the conditions used in this example are as follows:

PBS buffer (pH 7.4): 8.0g NaCl, 0.201g KCl, 3.63g Na₂HPO₄·12H₂O，0.24g KH₂PO₄Dissolved in 1000mLddH 2O;

substrate buffer (pH 5.0): 36.89g Na₂HPO₄·12H₂O and 10.19g citric acid in 500mL ddH₂O；

0.2% TMB mother liquor: 0.2g TMB (3,3,5, 5-tetramethylbenzidine) was dissolved in 100mL absolute ethanol, requiring a glass rod to stir rapidly during the dissolution process.

2. Determination of critical value of the indirect enzyme linked immunosorbent assay kit

Detecting 22 cat serum samples which are detected as cat toxoplasma IgG antibody negative by MAT, simultaneously setting standard positive control and negative control, and repeatedly detecting OD for multiple times₆₃₀The critical value decision criteria for the final determination of the method are as follows:

the method for calculating the Cut-off value comprises the following steps: mean (X) +3 Standard Deviation (SD)

And (3) judging the positive and negative boundary:

the S/N is more than or equal to 2.5, and the sample can be judged to be positive; otherwise, the result is negative.

The results are shown in Table 1.

TABLE 1 determination of critical points

The detailed operation steps are as follows:

the MIC17a protein was diluted with carbonate coating buffer (pH 9.6) to a final concentration of 1. mu.g/mL, coated on an enzyme plate, and incubated overnight at 4 ℃. Each well was washed 3 times with 200ul PBS-T (0.01mol/L PBS, 0.05% Tween-20, pH 7.4) wash buffer and blocked with 0.1% BSA (bovine serum albumin) formulated for 45min at 37 ℃. The cat sera were diluted 1:50 with 0.1% BSA and 100uL added per well in 3 replicates per sample and incubated for 1h at 37 ℃. Then, PBS-T (0.01mol/L PBS, 0.0)5% Tween-20, pH 7.4) washing buffer 3 times, HRP-labeled rabbit anti-sheep IgG diluted 1:3000 was added at 100ul per well and incubated at 37 ℃ for 1 h. 100uL of a color developing solution (substrate buffer solution: TMB stock solution: 1:19, 0.2uL/mL 30% hydrogen peroxide) was added to each well, and color development was carried out at 37 ℃ for 10min in the absence of light. Finally, adding 50 uL0.25% hydrofluoric acid into each hole to stop the reaction, and reading at the wavelength of 630 nm; if sample S (sample OD)_{630 value}) /N (negative serum OD)_{630 value}) The result is judged to be positive if the value is more than or equal to 2.55; otherwise, the result is negative.

3. The detection method of the indirect enzyme linked immunosorbent assay kit comprises the following steps:

(1) adding 98 mu L of diluent into a plurality of holes on an enzyme label plate, and then respectively adding 2 mu L of samples to be detected, positive control and negative control into corresponding holes; incubation at 37 ℃ for 1h

(2) Discard the well, add 300. mu.L of wash solution (1X) to wash the plate 3 times for 3min each time; and the plate washing interval is required to avoid drying the micropores;

(3) diluting the concentrated enzyme-labeled antibody (10X) by 10 times to obtain an enzyme-labeled antibody (1X) by using a diluent;

(4) add 100. mu.L of enzyme-labeled antibody (1X) to each well; incubating at 37 ℃ for 1 h;

(5) the well was discarded and the plate was washed 3 times for 3min with 300. mu.L of wash solution (1X).

And the plate washing interval is required to avoid drying the micropores;

(6) adding 100 μ L of color development solution into each well, and incubating at 37 deg.C for 15 min; stop the reaction by adding 50. mu.L of stop solution to each well;

(7) reading and recording absorbance at a wavelength of 630 nm; if the sample S to be tested (sample OD)_{630 value}) Negative control N (negative serum OD)_{630 value}) The result is judged to be positive if the value is more than or equal to 2.55; otherwise, the result is negative.

Example 4 sensitivity test and specificity test of Indirect enzyme-linked immunosorbent kit for detecting feline Toxoplasma gondii-specific IgG antibody

The procedure of example 3 was followed for 1: 25. 1:50, 1: 100. diluting at 1:200, 1:400, 1:800 and 1:1600 for detection, and setting positive, negative and blank controls. The results are shown in Table 2. The results show that the sensitivity of the MIC17a-iELISA diagnostic method established by the invention is more than 1: 200. the established method is used for detecting the feline coccidiosis positive serum and the feline plague positive serum. The results are shown in Table 3. The result shows that the method has good specificity and does not have cross reaction with the feline panpest and the feline coccidium.

TABLE 2 results of sensitivity test

Dilution factor	1:25	1:50	1:100	1:200	1:400	1:800	1:1600
								Serum 1	0.957	0.704	0.531	0.401	0.284	0.141	0.089
Serum 2	0.805	0.679	0.433	0.268	0.185	0.125	0.078
								Serum 3	0.775	0.594	0.465	0.244	0.172	0.12	0.086
Serum 4	0.715	0.56	0.443	0.314	0.169	0.102	0.081

TABLE 3 results of specificity test

Categories	Cat plague	Cat coccidiosis
			OD₆₃₀Value of	0.168	0.16
Presence or absence of cross reaction	Is free of	Is free of

EXAMPLE 5 detection of clinical samples

The indirect enzyme-linked immunosorbent kit is used for detecting 106 clinical cat blood samples collected in a pet hospital, and the toxoplasma antibody positive rate in the samples is found to be 25.47% (27/106), which shows that the kit can effectively detect toxoplasma antibody in the serum of the sick cat.

Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive changes from the embodiments, and all of the embodiments belong to the protection scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> toxoplasma gondii microwire protein MIC17a and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 351

<212> PRT

<213> Toxoplasma gondii

<400> 1

Met Asp Ala Leu Lys Thr Val Phe Asn Arg Arg Ile Ala Leu Pro Val

1 5 10 15

Val Val Ala Ala Ala Leu Leu His Asn Ser Ala Glu Ala Leu Gln Ser

20 25 30

Pro Gly Leu Arg Arg Gln Leu Val Asn Ser His Ser Phe Ala Glu Val

35 40 45

Glu Thr Thr Gly Tyr Ser Cys Phe Glu Lys Gly Lys Glu Tyr Val Gly

50 55 60

Phe Ser Leu Thr Glu Phe Ala Lys Val Gly Asp Ala Ala Leu Cys Gln

65 70 75 80

Gln Arg Cys Asn Gln His Pro Gln Cys Gly Phe Phe Thr Phe Tyr Ser

85 90 95

Asn Glu Asn Arg Cys Val Leu Gln Ser Arg Lys Pro Ser Gln Glu Asn

100 105 110

Asn Asn Ala Asn Ala Val Ser Gly Pro Lys Arg Cys Pro Leu Cys Leu

115 120 125

Val Asp Asn Tyr Asp Phe Arg Gly Glu Thr Asn Met His Lys Ser Gly

130 135 140

Ala Pro Gly Leu Asn Thr Leu Leu Ala Cys Gln Gln Gly Cys Ala Ala

145 150 155 160

Glu Pro Lys Cys Lys Ala Phe Leu Phe Glu Lys Arg Pro Arg Thr Cys

165 170 175

His Phe Lys Thr Ser Asp Asn Tyr Leu Lys Ser Phe His Pro Asp Thr

180 185 190

Ser Tyr Ile Ala Gly Pro Lys Thr Cys Thr Asp Glu His Trp Cys Ile

195 200 205

Met Lys Asp Ile Gly Tyr Lys Gly Thr Asp Ser Lys Ala Thr Lys Ala

210 215 220

Asn Ser Ala Ala Glu Cys Gln Gln Met Cys Leu Asn Asp Glu Arg Cys

225 230 235 240

Asp Phe Phe Thr Trp Gln Gln Ala Gly Lys His Cys Trp Phe Lys Ala

245 250 255

Gly Ala Ser Thr Ala Ser Thr Lys Tyr Asn Arg Ala Gly Asp Tyr Ser

260 265 270

Ala Pro Lys His Cys Gly Leu Pro Thr Thr Cys Val Lys Glu Arg Thr

275 280 285

Lys Tyr Ala Gly Glu Thr Val Ala Thr Phe Pro Lys Ser Glu Val Gly

290 295 300

Thr Phe Glu Ser Cys Gln Met Lys Cys Trp Lys Thr Ser Lys Cys Val

305 310 315 320

Phe Met His Phe Asn Asn Asp Gly Cys Thr Leu Ser Gly Ile Asn Ala

325 330 335

Thr Ala Gln Thr Asp Ala Asn Ser Lys Ala Gly Asp Ile Thr Cys

340 345 350

<210> 2

<211> 954

<212> DNA

<213> Toxoplasma gondii

<400> 2

gggctccgga gacagctagt caacgcccac tctttcgctg aggtggagac gacaggatat 60

agctgctttg aaaaaggcaa ggagtacgtt ggtttcagcc tgactgagtt ccccaaagtg 120

agcgatgttg ctttgtgcca gcagaggtgc aatcaacacc cgcagtgtgg cttcttcaca 180

ttctattcca atgagaaccg atgcgtgctc cagtcccgca agccttctca ggagaagaac 240

aatgccaatg ccgtttctgg cccgaaacgg tgcccgcttt gcctcgttga taactatgat 300

ttcagaggcg agacaaacat gcatcaaaaa ggtgctcccg gtctcaatac actcctggcg 360

tgtcaacagg gatgtgcagc ggagcccaaa tgcaaggcct tcctcttcga gaagggtccc 420

cgcacgtgcc acttcaagac aagtgataac tatttgaaat cgttccatcc ggatacttca 480

tacatcgcag gtccgaaaac gtgtacggat gaacactggt gcatcatgaa ggatattggc 540

tacaagggca aagactcgaa gtcaacaaaa gcaaactcag cggcagagtg ccagcagatg 600

tgcctcaacg atgagaggtg tgactttttc acgtggcaac aggcgggcaa gcattgttgg 660

tttaaggctg gggcgtccac tgcctcaaca aaatacaatc gggctggcga ctattctgcc 720

ccaaaacact gcggcctgcc gaccacatgt gtcaaggagc ggaccaagta cgcgggcgaa 780

accgttgcga cgttccccaa gagcgaggtg gggaccttcg agtcctgcca aatgaagtgc 840

tggaagacca gcaagtgtgt gtttatgcac ttcaacaatg atggctgcac gctctctggg 900

gtcaatgcaa ccgctcaaac tgatgcgaac tccaaagcag gcgatatcac atgc 954

<210> 3

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agcaaatggg tcgcggatcc gggctccgga gacagctagt c 41

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcctttcggg ctttgtttta gcatgtgata tcgcctgctt 40

Claims

1. A toxoplasma gondii microwlin MIC17a has an amino acid sequence shown in SEQ ID No. 1.

2. The gene MIC17a encoding toxoplasma gondii MIC17a of claim 1, the nucleotide sequence of which is shown in SEQ ID No. 2.

3. The use of the toxoplasma gondii microwlin MIC17a of claim 1 in immunodetection of feline toxoplasmosis.

4. The use of the toxoplasma gondii microwlin MIC17a of claim 1 in the preparation of an indirect enzyme-linked immunosorbent assay kit for detecting a feline toxoplasma gondii-specific IgG antibody.

5. An indirect enzyme-linked immunoassay kit for detecting a feline Toxoplasma gondii specific IgG antibody is characterized in that: the kit comprises an ELISA plate coated with toxoplasma gondii microwlin MIC17a of claim 1, a concentrated washing solution, a positive control, a negative control, a diluent, a concentrated enzyme-labeled antibody, a developing solution and a stop solution.

6. The indirect enzyme-linked immunoassay kit of claim 5, wherein: in the kit, the formula of each component is as follows:

the positive control is positive serum of the cat toxoplasma gondii,

the negative control is feline toxoplasma negative serum,

the concentrated enzyme-labeled antibody is HRP goat anti-cat IgG;

substrate buffer: 24.3mL of 0.1mol/L citric acid, 25.7mL of 0.2mol/L sodium dihydrogen phosphate, and ddH₂O is added to the volume of 50 mL;

color development liquid: mixing TMB mother liquor and substrate buffer solution according to the proportion of 1:19, and adding 0.2 mu L of 30% hydrogen peroxide into each ml of substrate color development solution;

stopping liquid: 625 μ L of 40% hydrofluoric acid in 100mL ddH₂And (4) in O.

7. A method for detecting a feline Toxoplasma gondii-specific IgG antibody using the kit of claim 5, comprising: the method comprises the following steps:

1) adding 98 mu L of diluent into a plurality of holes of an ELISA reaction plate, and then respectively adding 2 mu L of samples to be detected, positive control and negative control into corresponding holes;

according to the volume ratio of 1:50, adding a sample to be tested and a diluent, and incubating;

3) adding 100 mu L of enzyme-labeled antibody into the hole, and incubating;

6) reading and recording the light absorption value at the wavelength of 630nm if the OD of the sample to be measured_{630 value}Negative control OD_{630 value}The result is judged to be positive if the value is more than or equal to 2.55; otherwise, the result is negative.