CN114957454A

CN114957454A - Nano antibody and fusion protein for resisting CSFV E2 protein, and preparation method and application thereof

Info

Publication number: CN114957454A
Application number: CN202210577795.7A
Authority: CN
Inventors: 曹志; 单虎; 秦志华; 尹德华
Original assignee: Qingdao Agricultural University
Current assignee: Xinguang Ruihe (Qingdao) Biotechnology Co.,Ltd.; Qingdao Agricultural University
Priority date: 2022-05-25
Filing date: 2022-05-25
Publication date: 2022-08-30
Anticipated expiration: 2042-05-25
Also published as: CN114957454B

Abstract

The invention provides a nano antibody and a fusion protein for resisting CSFV E2 protein, and a preparation method and application thereof, relating to the technical field of biology. The amino acid sequence of the nano antibody is shown as SEQ ID NO. 1. The invention constructs a fusion protein by using the nano antibody CSFV-E2-Nb1 and a marker locus, and constructs a blocking method ELISA detection kit for detecting the CSFV antibody in porcine serum by using the fusion protein as a primary antibody. By utilizing the detection kit, the detection method is simple to operate, and the detection kit provides a key material for subsequently applying the nano antibody and the fusion protein to CSFV antibody detection, can simplify the production process, reduce the production cost, and has good market transformation prospect.

Description

Nano antibody and fusion protein for resisting CSFV E2 protein, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a nano antibody and a fusion protein for resisting CSFV E2 protein, and a preparation method and application thereof.

Background

Classical Swine Fever (CSF) is a highly contagious and highly lethal infectious disease of swine caused by Classical Swine Fever Virus (CSFV). Although some developed countries in Europe and America declare that the swine fever is already eliminated through strict purification measures, the swine fever in some developing countries such as east Asia and southeast Asia is still an important infectious disease of the swine industry, and different methods for eliminating the swine fever are searched in all countries. With the long-term control of the lapinized low virulent vaccine of swine fever in China, the swine fever is mainly recessive infection in China at present, but the occurrence of the swine fever is reported sometimes.

Since the first African Swine Fever (ASF) was diagnosed in Shenyang on 3/8.2018, ASF has been developed in several provinces of China. Clinical symptoms and pathological changes of CSF and ASF are very similar and interfere with each other's diagnosis. According to the Brazil prevention and control experience, the ASF prevention and control are made to be beneficial to the purification of CSF, and the CSF immunization and prevention and control are made to be beneficial to the diagnosis and prevention and control of the ASF. In addition, the importance of CSF control and purification is further highlighted in the context of the current absence of effective vaccines and therapeutic measures for ASF. The accurate and rapid identification and diagnosis method capable of distinguishing wild virus infection and vaccine immunity is applied, and purification of CSF in a large-scale pig farm is realized gradually by means of positive pig elimination and the like.

In the 90's of the 20 th century, C.Hamers-Casterman et al found that in animals of the family Camelidae (e.g., llamas, dromedary, etc.) there was an antibody, called a heavy chain antibody, which naturally lacks the light chain and CH1 regions. The single domain antibody produced by cloning its heavy chain variable region is called VHH (variable domain of heavy chain of heavy chain antibody), has small molecular weight, only about 15kDa, and is therefore called nano antibody. This is currently the smallest functional antibody fragment that can independently recognize an antigen. Compared with the complex structure of traditional antibodies, VHH has better utilization advantages due to its small size and simple structure. However, no relevant research report is found about the application of the nano antibody in the CSF diagnostic method at present, and no commercial product exists.

Disclosure of Invention

In view of the above, the invention aims to provide a nano antibody and a fusion protein for resisting CSFV E2 protein, and a preparation method and application thereof, the nano antibody and the fusion protein have good detection specificity for CSFV E2 protein, can be used for producing a detection kit, simplify the production process, reduce the production cost, and have good market transformation prospects.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a nano antibody CSFV-E2-Nb1 for resisting CSFV E2 protein, wherein the amino acid sequence of the nano antibody CSFV-E2-Nb1 is shown in SEQ ID NO. 1.

The invention also provides a nucleic acid molecule for coding the nano antibody CSFV-E2-Nb1, and the nucleotide sequence is shown as SEQ ID NO. 2.

The invention also provides a fusion protein containing the nano antibody CSFV-E2-Nb1 and a marker locus.

Preferably, the marker site comprises the biotinylated marker site Avitag.

The invention also provides a recombinant plasmid for expressing the fusion protein, and a basic vector of the recombinant plasmid comprises a prokaryotic expression vector.

The invention also provides a preparation method of the fusion protein, which comprises the following steps: and transferring the recombinant plasmid into a competent cell, carrying out induction expression by using IPTG (isopropyl-beta-thiogalactoside), collecting the inclusion body protein, and carrying out marking on the marking site after purification.

The invention also provides application of the nano antibody CSFV-E2-Nb1, the fusion protein or the recombinant plasmid in preparing a reagent for detecting the CSFV antibody in porcine serum.

The invention also provides a blocking method ELISA detection kit for detecting the CSFV antibody in the pig serum, which comprises the following steps: CSFV E2 recombinant protein and the fusion protein.

Preferably, the kit further comprises an enzyme-labeled secondary antibody and a TMB developing solution.

Preferably, the working solution concentration of the CSFV E2 recombinant protein is 0.5 mug/mL;

the dilution ratio of the fusion protein is 1: 8000.

Has the beneficial effects that: the invention provides a nano antibody CSFV-E2-Nb1 for resisting CSFV E2 protein and discloses an amino acid sequence of the nano antibody. The invention constructs a fusion protein by using the nano antibody CSFV-E2-Nb1 and a marker locus, and constructs a blocking method ELISA detection kit for detecting the CSFV antibody in porcine serum by using the fusion protein as a primary antibody. By utilizing the detection kit, the detection method is simple to operate, and the detection kit provides a key material for subsequently applying the nano antibody and the fusion protein to CSFV antibody detection, can simplify the production process, reduce the production cost, and has good market transformation prospect. The embodiment proves that the detection kit has high detection sensitivity and good specificity, can obviously improve the detection sensitivity of CSF, and can realize the purification of CSF in China as soon as possible by matching with a classical swine fever E2 subunit vaccine.

Drawings

FIG. 1 shows the first amplification of VHH, recovering 700bp fragments;

FIG. 2 shows the first VHH amplification, recovering 700bp fragments;

FIG. 3 shows the VHH amplification for the second time, and the fragment at 400bp is recovered as a nanobody fragment;

FIG. 4 shows the collection of an initial library of nanobodies after transformation;

FIG. 5 is a graph showing the positive rate after transformation, which is about 90%;

FIG. 6 shows that the enrichment degree after the third round of panning reaches 1.3X 10 during solid-phase panning ³ The screening condition is met;

FIG. 7 shows that after rough expression, positive clones were verified by ELISA, and ten clones with good specificity were selected for sequencing;

FIG. 8 is an SDS-PAGE image of the supernatant after plasmid synthesis and expression from the sequencing results, wherein 9 lanes represent the concentrations and times of IPTG induction, respectively: 0.5mM +2h, 1mM +2h, 1.5mM +2h, 0.5mM +4h, 1mM +4h, 1.5mM +4h, 0.5mM +6h, 1mM +6h and ninu 1.5mM +6 h;

FIG. 9 shows the SDS-PAGE results of the disrupted supernatant after the resuspension of the collected cells, the lane information being as in FIG. 8;

FIG. 10 shows the result of SDS-PAGE for verifying whether the expression of the inclusion body is performed, and 9 lanes represent: supernatant of 0.5Mm +4h, precipitation of 0.5mM +4h, supernatant of 1mM +4h, precipitation of 1mM +4h, supernatant of 1.5mM +4h, precipitation of 1mM +6h, precipitation of eight negative supernatants and precipitation of nine negative precipitates;

FIG. 11 shows the results of the conditions changed to induce soluble expression SDS-PAGE, and 9 lanes represent: supernatant at 37 ℃ +0.1mM +6h, precipitation at 37 ℃ +0.1mM +6h, supernatant at 37 ℃ +0.3mM +6h, precipitation at 37 ℃ +0.3mM +6h, supernatant at 28 ℃ +0.1mM +6h, precipitation at 28 ℃ +0.1mM +4h, supernatant at 28 ℃ +0.3mM +6h, precipitation at 28 ℃ +0.3mM +6h and precipitation at nine negative precipitates;

FIG. 12 shows SDS-PAGE results after purification of inclusion body proteins, wherein 9 lanes represent: firstly, eluting 1mL, secondly, eluting 2mL, thirdly, eluting 3mL, fourthly, eluting 4mL, fifthly, eluting 5mL, sixthly, draining, seventhly, washing 10mL for the first time, eighthly, washing 10mL for the second time and nineth, washing 10mL for the third time;

FIG. 13 shows SDS-PAGE results after renaturation of proteins by dialysis, and 9 lanes represent: the dilution times are original times, 1/2, 1/8, 1/16, 1/32, 1/64, 1/128, 1/256 and 1/512

FIG. 14 is the specific effect of the renatured nanobody verified after biotinylation;

FIG. 15 shows the best concentration of coated CSFV E2 protein and the best dilution of biotinylated nano-antibody, which is determined as the best concentration of coated 0.5 μ g/mL, and the best dilution of biotinylated nano-antibody is 1: 8000;

FIG. 16 shows the determination of the optimal dilution of serum at 1: 20;

FIG. 17 shows that the sensitivity of the kit is significantly higher than that of the commercial kit;

FIG. 18 is a graph demonstrating the specificity of the established detection method CSFV ELISA, indicating that it is highly specific.

Detailed Description

The nano antibody CSFV-E2-Nb1 comprises 123 amino acids in total, belongs to IgG heavy chain variable region, can exist in vitro stably and independently, and consists of 4 conserved sequences and 3 complementary-determining regions (CDR), wherein the CDR3 comprises 17 amino acid residues.

The invention also provides a preparation method of the nano antibody CSFV-E2-Nb1, which preferably comprises the following steps:

(1) constructing a phage display library of the E2 protein specific nano antibody, immunizing CSFV E2 protein in an alpaca body for multiple times, separating lymphocytes after reaching the target antibody titer, extracting total RNA, specifically amplifying a VHH fragment, connecting the fragment with a carrier after double enzyme digestion, and electrically transferring the fragment into TG 1;

(2) e2 protein specificity nanometer antibody panning, through the function of helper phage, enlarge the library capacity of the library, apply ELISA principle to pan specificity nanometer antibody, after three times of panning, carry on the crude expression of the nanometer antibody, verify the positive clone through ELISA and carry on the sequence analysis sequence, get the gene sequence of the specificity nanometer antibody.

The marker site of the present invention preferably comprises a biotinylated marker site Avitag. In the present invention, the structure of the fusion protein is preferably CSFV-E2-Nb1-Avitag from N-terminus to C-terminus.

The prokaryotic expression vector of the invention preferably comprises a pET-32a vector. The structure of the recombinant plasmid of the inventionThe method preferably comprises the following steps: connecting the gene sequence shown in SEQ ID NO.2 with a pET-32a vector and Avitag to form a pET-32a-Nb1-Avitag recombinant plasmid, wherein the restriction enzyme sites are as follows: (EcoRI/XhoI), the recombinant plasmid is directly synthesized by a biological company in the example, the synthesized sequence comprises an EcoRI enzyme cutting site + an Nb1 sequence + an Avitag short peptide sequence + an XhoI enzyme cutting site, and the optimized sequence is shown as SEQ ID NO. 3:

wherein the underlined sequence is an optimized Nb1 sequence, and the marked blackened sequence is an optimized Avitag short peptide sequence. The present invention is preferably based on an amplification method, in which the sequence of Avitag short peptide is ligated according to the sequence of CSFV-E2-Nb1, and the Avitag short peptide is used for biotin labeling.

In the amplification process, the Nb positive plasmid is preferably used as a template, a nano antibody CSFV-E2-Nb1-Avitag gene is amplified by PCR, a target band at a position of 400bp is cut and recovered by nucleic acid electrophoresis identification, and the DNA concentration is measured for subsequent tests. In the present invention, it is preferable that pET-32a and CSFV-E2-Nb1-Avitag are subjected to the same double digestion as described above, and CSFV-E2-Nb1-Avitag after the digestion is ligated to pET-32a vector using T4 ligase.

The positive cells successfully transferred are subjected to IPTG induction, wherein competent cells preferably comprise BL21(DE3), and the final induction concentration of IPTG is preferably 0.3mM and the induction time is preferably 6h when the IPTG induction is performed.

The present invention collects inclusion body protein after the induction expression, preferably including: firstly, breaking the induced thallus, verifying protein by SDS-PAGE, purifying the expressed protein by using a Ni column to obtain a purified inclusion body, dialyzing by using dialysate with gradient urea content, and renaturing the purified protein so as to facilitate biotinylation marking. The invention preferably carries out biotinylation labeling on the purified CSFV-E2-Nb1-Avitag, and verifies the biotinylation labeling effect by ELISA.

The reagent of the present invention preferably comprises a blocking ELISA detection reagent.

The invention also provides a blocking method ELISA detection kit for detecting the CSFV antibody in the pig serum, which comprises the following steps: CSFV E2 recombinant protein and the fusion protein. The kit preferably further comprises an enzyme-labeled secondary antibody (HRP-labeled Streptavidin) and a TMB color development solution. In the invention, the concentration of the working solution of the CSFV E2 recombinant protein is preferably 0.5 mug/mL; the dilution ratio of the fusion protein is preferably 1: 8000.

The invention also provides a method for detecting CSFV in serum by blocking ELISA, which preferably comprises the following steps:

(1) coating the CSFV E2 recombinant protein diluted to 0.5 mu g/mL on an enzyme label plate, sealing and washing, and adding the serum to be detected for incubation;

(2) after washing, adding the fusion protein diluted and expressed by 1:8000, incubating, after washing, adding an enzyme-labeled secondary antibody, and incubating;

(3) washing, adding TMB, incubating for 15min, adding stop solution, and developing. By OD ₄₅₀ And (4) judging the blocking rate according to the numerical value.

The present invention provides a nanobody against CSFV E2 protein, a fusion protein, and methods for preparing and using the same, which are described in detail below with reference to the examples, but should not be construed as limiting the scope of the present invention.

The experimental methods in the following examples, in which specific conditions are not specified, are generally performed according to conventional conditions, such as "molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions provided by the manufacturer.

Example 1

Screening of CSFV E2 protein specific nano antibody

1.1 alpaca immunization

2.5mL of CSFV E2 recombinant protein (GenBank: AY775178.2), 1mg/mL each time was emulsified with an equal volume of 201 adjuvant, and an adult male alpaca was immunized, and thereafter, immunized every two weeks for 5 times in the same manner, and blood was collected one week after the last immunization for the subsequent experiments.

Serum is collected one week after the last immunization, the titer of CSFV E2 antibody in alpaca serum is detected by ELISA method, and the serum before immunization is used as negative control.

1.2 construction of VHH phage antibody libraries

1.2.1 isolation of peripheral blood lymphocytes and extraction of RNA

One week after the last immunization, 20mL of anticoagulated blood was collected with a disposable blood collection tube (containing an anticoagulant), diluted with 1640 medium, and separated using an alpaca peripheral blood lymphocyte separation kit. Counting the separated cells by using a blood cell counting plate, and directly extracting RNA by using a cell total RNA extraction kit.

1.2.2 amplification of VHH Gene fragments

First, first strand cDNA was synthesized using reverse transcriptase with RNA as a template, and then VHH gene was amplified using nested PCR. PCR primers were designed based on the reference and the alpaca VHH upstream and downstream sequences.

First round PCR amplification. Performing a first round of PCR amplification by using the cDNA as a template and the sequence of a conserved region of the IgG by using a primer F1(SEQ ID NO.4): GTCCTGGCTGCTCTTCTACAAGG; r1(SEQ ID NO.5) GGTACGTGCTGTTGAACTGTTCC, program: reaction procedure: 10sec at 98 ℃; 5sec at 55 ℃; 68 ℃ for 10 sec; and 30 cycles. The PCR products of the target size were recovered and the procedure is detailed in Table 1. As a result, as shown in FIGS. 1 and 2, the 700bp fragment was recovered;

second round PCR amplification. Using the first round PCR recovery product as a template, amplifying a VHH gene fragment with a VHH conserved region sequence using primer F2(SEQ ID No. 6): CAGGTGCAGCTGCAGGAGTCTGGGGGAGR, respectively; r2(SEQ ID NO. 7): CTAGTGCGGCCGCTGAGGAGACGGTGACCTGGGT, procedure: reaction procedure: 10sec at 98 ℃; 5sec at 55 ℃; 68 ℃ for 10 sec; and 30 cycles. And recovering PCR products, determining the concentration of the recovered products for the next step of experiment, recovering fragments at 400bp as nano antibody fragments, and the procedure is detailed in Table 2.

1.2.3 construction of VHH phage display vectors

Cloning the VHH gene fragment into the pCANTAB5E phage display vector through Pst I and Not I cleavage sites: the method is characterized in that a pCANTAB5E phage display vector and VHH are subjected to double enzyme digestion, a PCR product recovery kit is used for recovering an enzyme digestion product according to the operation steps of a specification, and the concentration is measured for subsequent experiments. The VHH fragment and the phage display carrier were ligated with T4 DNA ligase using a PCR product recovery kit according to the protocol to purify the ligation product, which was eluted with sterile ultra pure water and the concentration was determined for subsequent experiments.

1.2.4 ligation product transformation of TG1 competent cells and harvesting of phage antibody libraries

Competent cells were electroporated using an Eppendorf electroporator with parameters set at 2.5kV for 5 ms. Immediately after the shock, the electric shock cup is taken out, 4mL of SOC culture medium preheated at 37 ℃ is added, the cells are resuspended and transferred to a sterile 50mL centrifuge tube, and the operation is repeated to complete the conversion of the residual electric shock.

After incubation of the transformation product. 100 μ L of the culture was left for library identification, and all remaining cultures were spread evenly on LB/AMP-GLU plates and incubated at 37 ℃ for 10 h. Collecting thallus Porphyrae with cell scraper, adding 1/3 volume of 50% glycerol, mixing, and storing at-80 deg.C. As shown in FIG. 4, the transformation effect was good, and the single colonies were uniform and spread over the plate.

1.2.5 library capacity and diversity determination

(1) Taking 100 μ L of the culture of the previous step, diluting with 10-fold gradient, and taking the dilution degree of 10 ^-2 、10 ^-3 、10 ^-4 100. mu.L of each of the samples was plated on LB/AMP-GLU plates, cultured at 37 ℃ for 8 hours, and colonies on the plates were counted to count the number of transformants.

20 positive clones were randomly selected and inoculated into 1mL of medium for bacterial fluid identification, transformants were identified using primers F3(SEQ ID NO.8, 5 'AATACGCAAACCGCCTCTCC 3', located about 335bp upstream of the pCANTAB5E vector polyclonal cleavage site) and R2, and the positive cloning efficiency was about 90% as shown in FIG. 5. Clones which are identified as positive by PCR of the bacterial liquid are handed over to Shanghai bioengineering technology, Inc. for sequencing. And comparing the sequencing result with MegAlign software to identify the diversity of the library.

Example 2 panning of CSFV E2-specific Nanobodies

2.1 rescue of VHH phage antibody library

Amplifying the constructed phage display library, and under the action of helper phage, amplifying a large number of successfully transformed plasmids to obtain phagemids with target plasmids. Inoculating the phage into the culture medium, culturing for a period of time, centrifuging, taking the culture medium supernatant, precipitating with a PEG/NaCl solution, centrifuging, collecting the precipitate, and resuspending the precipitate with PBS to obtain the phagemid.

2.2 determination of recombinant phage titer

20 mu L of rescued phage solution is diluted by culture medium with 10 times of gradient, and the dilution degree is 10 ^-8 、10 ^-9 、10 ^-10 100. mu.L of the sample of (4) was added to 100. mu.L of TG1 cells in a several growth phases, mixed well, and left to stand at 37 ℃ for 15 min.

TG1 cells infected with phage at different dilutions were spread evenly on LB/AMP-GLU plates and cultured at 37 ℃ for 12h, respectively. Colonies on the plate were counted and recombinant phage titers were calculated.

2.3 panning of CSFV E2-specific recombinant phages

Screening specific phagemids by using an ELISA method, adsorbing the specific phagemids on CFSV E2 protein so as not to be washed away, eluting the specific phagemids, and performing propagation. The method mainly comprises the following steps: coating CSFV E2 protein on the bottom of an ELISA plate, correspondingly using PBS as a control, washing the uncoated protein after coating overnight at 4 ℃, adding 1% BSA for blocking, washing off the blocking solution after blocking, respectively adding the rescued library, and washing off the phagemid which is not specifically bound after incubation. And eluting with triethylamine, eluting the phagemid, performing infection propagation and determining titer. At least threePerforming round elutriation, when the titer of the positive hole is more than 1 × 10 than that of the negative hole ³ The panning was considered complete and the results are shown in figure 6, which reached 1.3 x 10 after the third panning ³ The screening condition is satisfied.

2.4 Induction expression of recombinant Nanobody and acquisition of crude extract

The third round of elutriation was performed to determine titer plates, and 48 single colonies were picked in 48 well plates containing 100. mu.L of medium, when grown to OD ₆₀₀ When the amount is about 0.7, the cells are inoculated into a 24-well plate containing 1mL of the culture medium, and the cells are propagated while the OD is adjusted to ₆₀₀ When the concentration reached 0.7, IPTG was added for induction, and the cells were cultured for 10 hours. The cultures were collected into 1.5mL centrifuge tubes and freeze-thawed three times in a-80 ℃ freezer. Centrifuging and collecting the supernatant, namely the crude extract of the soluble recombinant nano antibody.

2.5 ELISA detection of soluble recombinant Nanobodies

In order to verify whether the roughly expressed nano antibody has specificity, an ELISA method is used for detection. Coating the protein on the bottom of an ELISA plate, coating negative PBS, coating a group of unrelated proteins PRRSV GP3 protein (GenBank: JQ627636.1) in parallel, sealing by using 1% BSA, adding a crude extracted nano antibody into each hole, washing away unbound protein after incubation, adding a primary antibody, washing away unbound primary antibody after incubation, adding an enzyme-labeled secondary antibody, washing away unbound enzyme-labeled secondary antibody after incubation, adding a TMB (tetramethylammonium bromide) developing solution, adding a stop solution after incubation, and measuring OD (optical density) by using an ELISA reader ₄₅₀ Numerical values.

2.6 sequencing analysis of specific Nanobodies

Clones positive for ELISA were selected, submitted to the company for sequencing, and the sequencing results were aligned using MegAlign software (FIG. 7).

Example 3 expression, purification and biotinylation of Nanobodies

3.1 construction of prokaryotic expression vector pET-32a-Nb1-Avitag

3.1.1 expression and solubility identification of Nanobody Nb1-Avitag fusion protein

pET-32a-Nb1-Avitag recombinant plasmid, in which the target gene (abbreviated as Nb1-Avitag) was synthesized by Bio Inc

(1) Induced expression of nano antibody Nb1-Avitag fusion protein

Transforming the obtained recombinant plasmid into competent cells BL21(DE3), performing PCR identification of bacteria liquid of positive clone, inoculating the positive clone to culture medium, and waiting for bacteria liquid OD ₆₀₀ After reaching about 0.7, IPTG was added to the cells at different concentrations for induction (FIG. 8). The induced bacterial liquid was collected and centrifuged, and after centrifugation, the pellet was resuspended in PBS and then sonicated, and after sonication, centrifugation was performed again, and the supernatant was stored separately, and the pellet was resuspended in 1ml PBS (fig. 9). Then, SDS-PAGE analysis of the expression induced by the Nb1-Avitag fusion protein and solubility analysis of the Nb1-Avitag recombinant protein were performed.

FIG. 8 shows SDS-PAGE results of the supernatant of the selected optimal expression time and IPTG final concentration showing no protein expression in the supernatant; FIG. 9 shows that the supernatant contains no target protein as a result of SDS-PAGE of the supernatant after cell disruption; FIG. 10 shows SDS-PAGE of the disrupted cell pellet showing the target protein in the disrupted pellet, indicating that the expression of the fusion protein is inclusion body expression. FIG. 11 shows SDS-PAGE of optimal expression temperature, time and final concentration of IPTG as inducer showing that the expression level is highest at 37 ℃ and 0.3mM final concentration of IPTG after 6h induction.

3.1.2 purification of Nb1-Avitag recombinant protein

SDS-PAGE analysis shows that the inclusion body is expressed, so an inclusion body purification method is applied for purification.

(1) Equilibration of the Ni-NTA column. 5mL of Ni Resin was added to the empty column, and after treating the column, the sample to be purified was added at 4 ℃ overnight.

(2) And collecting the flow-through liquid, eluting the hybrid protein by using the prepared Buffer A, collecting the liquid, eluting the target protein by using 1mL of Buffer B for 5 times, and treating the column after elution for the next use.

(3) Each 100. mu.L of the collected liquid samples was subjected to SDS-PAGE analysis to determine the purification effect.

As a result, as shown in FIG. 12, after purification, the hetero-protein was substantially removed, and the target protein was eluted at 3 mL.

3.1.3 renaturation of Nb1-Avitag

The target protein buffer solution for denaturation and purification contains 8M urea, so that the urea concentration in the buffer solution needs to be gradually reduced to realize renaturation of the target protein for denaturation and purification so as to meet the requirements of subsequent experiments.

The ready-to-use 3.5kDa dialysis bag was thoroughly rinsed with ultrapure water.

Dialysis buffer (ph8.2) formulation: tris 100mM, NaCl 100mM, EDTA-2 Na 5mM, Glycine 0.5%, glycerol 20%, oxidized glutathione 0.5mM, reduced glutathione 5mM and Urea (6M, 4M, 2M, 0M).

Adding the denatured and purified recombinant protein into a dialysis bag, starting dialysis from 6M urea dialysate at 4 ℃, replacing the dialysate every 12h, finally dialyzing in 0M urea dialysate, and dialyzing in PBS twice.

As shown in FIG. 13, the size and purity of the protein were not affected after renaturation of the protein by dialysis.

Biotinylation of the 2Nb1-Avitag fusion protein

25 μ L of biotinylation system: 10 × Biotin Ligase Buffer A (2.5 μ L, final concentration 1X), 10 × Biotin Ligase Buffer B (2.5 μ L, final concentration 1X), Biotin Ligase (0.17 μ L, final concentration 6.4 ng/. mu.L), post-dialysis Nb1-Avitag (1nmol, final concentration 40 μ M), and the balance ddH ₂ O。

And (3) incubating at 30 ℃ for 60min and collecting samples.

3.2.1 validation of the biotinylated labelling Effect Using ELISA method

The effect of biotinylation labeling is verified by using an ELISA method, and CSFV E2 and unrelated proteins PRRSV GP3 and GP4 are respectively coated on an ELISA plate. Washing off protein which is not adsorbed on the ELISA plate, adding 1% BSA (bovine serum albumin) for sealing, washing off a sealing solution after incubation, adding a biotinylated nano antibody after dilution by a multiple ratio, washing off unbound protein after incubation, adding an enzyme-labeled secondary antibody, washing off unbound enzyme-labeled secondary antibody after incubation, adding a TMB (tetramethylbenzidine) color developing solution, adding a stop solution after incubation, and measuring OD (optical density) of each hole by an ELISA (enzyme-labeled analyzer) ₄₅₀ 。

As shown in FIG. 14, after labeling with biotin, the labeled product was still positive when diluted to 1:16000, indicating that the biotinylation effect was good.

Example 4 establishment of blocking ELISA method for detecting E2 protein antibody in pig serum based on biotinylated Nanobody

4.1 search for optimal protein coating concentration and Nano antibody dilution concentration by using chessboard method

And (3) searching the optimal protein coating amount and the nano-antibody dilution by using a chessboard method, diluting the CSFV E2 protein to 0, 0.25, 0.5, 1, 1.5, 2, 2.5 and 4 mu g/mL during coating, and performing seven concentration gradients to respectively perform 7 repeated coatings on the ELISA plate. Washing off unadsorbed protein, blocking with 1% BSA, washing off blocking solution after incubation, diluting biotinylated nano-antibody according to the ratio of 1:500, 1:1000, 1:2000, 1:4000, 1:8000 and 1:10000 respectively, and then adding into corresponding holes respectively. Washing away unbound substances after incubation, adding enzyme-labeled secondary antibody, washing away unbound enzyme-labeled secondary antibody after incubation, adding TMB for color development, adding stop solution after incubation, and determining OD of each well by using an enzyme-labeling instrument ₄₅₀ 。

As shown in FIG. 15, the optimal coating concentration was determined to be 0.5. mu.g/mL, and the optimal dilution of biotinylated nanobody was 1: 8000.

4.2 best Dilute of serum

The E2 protein was coated on ELISA plates using the determined optimal antigen coating concentration. Unadsorbed protein was washed off, blocked and added: different dilutions of 4 CSF-positive sera and 4 negative sera were incubated after Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Porcine Circovirus (PCV), Porcine Pseudorabies virus (PRV), Porcine Parvovirus (PPV)). And diluting the biotinylated nano antibody according to the optimal dilution of the nano antibody determined in the previous step, and incubating and washing. Adding a TMB substrate color development solution, adding a stop solution after incubation, and reading.

As a result, as shown in FIG. 16, the optimal dilution of serum was determined to be 1: 20.

4.3 determination of the cut-off value for the blocking ELISA method

Known negative sera were selected to determine the Cut-off value of the blocking ELISA. According to the best reaction previously foundThe conditions were carried out, and the blocking rate (PI value) of the test negative serum was calculated. The calculation method comprises the following steps: the blocking rate (PI%) (1-P/N) × 100%, P being the OD of the test serum ₄₅₀ Value, N is OD of negative control serum ₄₅₀ The value is obtained. Cut-off value PI mean +3 × variance (SD).

4.4 evaluation of sensitivity

And selecting known positive pig serum to detect by an established ELISA method. Diluting the determined positive serum by different times, respectively detecting by using an established ELISA method and a commercial kit until the positive serum reaction result is negative, carrying out statistical analysis on the result, and evaluating the sensitivity of the established method.

The results are shown in fig. 17, and compared with the commercial kit, the sensitivity is significantly higher than that of the commercial kit.

4.5 evaluation of specificity

And selecting known negative pig serum to detect by an established ELISA method. And detecting positive control serum of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Porcine Circovirus (PCV), porcine pseudorabies virus (PRV) and Porcine Parvovirus (PPV) stored in a laboratory, performing statistical analysis on the result, and evaluating the specificity of the established method.

As a result, as shown in FIG. 18, the CSFV ELISA detection method was established to have high specificity.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Sequence listing

<110> Qingdao agricultural university

<120> anti-CSFV E2 protein nano antibody, fusion protein, preparation method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 123

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Gly Val Asp Tyr

20 25 30

Tyr Ile Gly Trp Phe Arg Gln Val Pro Gly Lys Glu Arg Glu Gly Val

35 40 45

Ser Tyr Ile Ser Ser Ser Asn Gly Ser Thr Tyr Tyr Thr Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Asn Asp Ile Ala Lys Asn Thr Ala Thr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Pro Gly Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Ala Asp Pro Ala Pro Leu Asp Ser Asn Ser Trp Tyr Ser Leu Tyr

100 105 110

Trp Gly His Gly Thr Gln Val Thr Val Ser Ser

115 120

<210> 2

<211> 369

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caggttcagc tgcaggaaag cggtggtggt ctggttcagg cgggtggtag cctgcgtctg 60

tcttgcgcgg cgagcggttt caccggtgtt gattactaca tcggttggtt ccgtcaggtt 120

ccgggtaaag aacgtgaagg tgttagctac atcagcagca gcaacggtag cacctattac 180

accgatagcg ttaaaggtcg tttcaccatc agcaacgata tcgcgaaaaa caccgcgacc 240

ctgcagatga acagcctgcg tccgggtgat accgcgatct actactgcgc ggcggatccg 300

gcgccgctgg atagcaacag ctggtacagc ctgtactggg gtcatggtac ccaggttacc 360

gtttctagc 369

<210> 3

<211> 426

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaattccagg ttcagctgca ggaaagcggt ggtggtctgg ttcaggcggg tggtagcctg 60

cgtctgtctt gcgcggcgag cggtttcacc ggtgttgatt actacatcgg ttggttccgt 120

caggttccgg gtaaagaacg tgaaggtgtt agctacatca gcagcagcaa cggtagcacc 180

tattacaccg atagcgttaa aggtcgtttc accatcagca acgatatcgc gaaaaacacc 240

gcgaccctgc agatgaacag cctgcgtccg ggtgataccg cgatctacta ctgcgcggcg 300

gatccggcgc cgctggatag caacagctgg tacagcctgt actggggtca tggtacccag 360

gttaccgttt ctagcggtct gaacgatatc ttcgaagcgc agaaaatcga atggcatgaa 420

ctcgag 426

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcctggctg ctcttctaca agg 23

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtacgtgct gttgaactgt tcc 23

<210> 6

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caggtgcagc tgcaggagtc tgggggagr 29

<210> 7

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctagtgcggc cgctgaggag acggtgacct gggt 34

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aatacgcaaa ccgcctctcc 20

Claims

1. A nano antibody CSFV-E2-Nb1 for resisting CSFV E2 protein is characterized in that the amino acid sequence of the nano antibody CSFV-E2-Nb1 is shown as SEQ ID NO. 1.

2. A nucleic acid molecule encoding the nanobody CSFV-E2-Nb1 of claim 1, characterized in that the nucleotide sequence is represented by SEQ ID No. 2.

3. A fusion protein comprising the nanobody CSFV-E2-Nb1 of claim 1 and a labeling site.

4. The fusion protein of claim 3, wherein the tag site comprises a biotinylated tag site, Avitag.

5. A recombinant plasmid expressing the fusion protein of claim 3 or 4, wherein the basic vector of the recombinant plasmid comprises a prokaryotic expression vector.

6. A method for preparing the fusion protein of claim 3 or 4, comprising the steps of: transferring the recombinant plasmid of claim 5 into a competent cell, performing induction expression by using IPTG, collecting the inclusion body protein, and labeling the labeling site after purification.

7. Use of the nanobody CSFV-E2-Nb1 of claim 1, the fusion protein of claim 3 or 4, or the recombinant plasmid of claim 5 for the preparation of a reagent for detecting CSFV antibodies in porcine serum.

8. A blocking method ELISA detection kit for detecting CSFV antibody in pig serum is characterized by comprising: a CSFV E2 recombinant protein and a fusion protein according to claim 3 or 4.

9. The blocking method ELISA detection kit of claim 8, further comprising an enzyme-labeled secondary antibody and TMB color development solution.

10. The blocking method ELISA detection kit of claim 8 or 9, wherein the working solution concentration of the CSFV E2 recombinant protein is 0.5 μ g/mL;

the dilution ratio of the fusion protein is 1: 8000.