CN111944044A

CN111944044A - Nanometer antibody for resisting ASFV-p30 protein, and preparation method and application thereof

Info

Publication number: CN111944044A
Application number: CN202010883659.1A
Authority: CN
Inventors: 赵钦; 赵加凯; 孙亚妮; 周恩民
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2020-08-28
Filing date: 2020-08-28
Publication date: 2020-11-17

Abstract

The invention provides a 2-strain ASFV-p30 protein-resistant nano antibody, a preparation method and application thereof, an expression preparation method of the nano antibody and HRP fusion protein, and application of the nano antibody and HRP fusion protein in detection of an anti-ASFV antibody in pig serum, belonging to the technical field of biology. The anti-ASFV-p 30 protein nano antibody and the HRP fusion protein are applied to establishment of ELISA for detecting the anti-ASFV antibody in pig serum, the established method is simple to operate, the time consumption for detecting samples is short, and an enzyme-labeled secondary antibody is not required. Provides a key material for the development of a commercial ELISA kit for the subsequent application of the two strains of nano antibodies to ASFV antibody detection.

Description

Nanometer antibody for resisting ASFV-p30 protein, and preparation method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an ASFV-p30 protein-resistant nano antibody and a preparation method and application thereof.

Background

African Swine Fever (ASF) is an acute, highly contagious and febrile infectious disease of pigs caused by African Swine Fever Virus (ASFV), and is susceptible to domestic and wild pigs of various breeds and ages. Once the death rate of the pigs is 100 percent, the pigs are a class of animal epidemic situations which are mainly prevented in China and are also animal epidemic diseases which are legally reported by the world animal health Organization (OIE). The disease is characterized by short disease onset time, wherein the mortality rate of the most acute and acute infection cases is up to 100 percent, and the clinical symptoms are fever, rapid heartbeat and pulse, dyspnea, cyanosis of skin, cough of some pigs, secretion of eyes and nose and obvious bleeding of multiple mucous membranes.

ASFV is the only member of African swine fever virus family, is a double-stranded DNA virus with a genome size of about 170-193kb, contains 167 open reading frames of 150-200 proteins. At present, 50 virus-encoded proteins have known functions, most of which are virus structural proteins, and more than half of the ASFV-encoded proteins have unknown functions. Among them, p30 is one of the important structural proteins of ASFV.

Nanobodies (Nb) are single domain antibodies produced in camelids with a deleted light chain and containing only the variable domain of the heavy chain antibody (VHH). Nanobodies tend to recognize conformational epitopes of antigens, have high specificity, and usually recognize concave epitopes. Meanwhile, the compound has the characteristics of small molecular weight, strong stability, high affinity, good solubility, easy expression, low immunogenicity, strong penetrability and the like. Based on the above advantages, the nanobody has been widely used in the fields of immunological detection and scientific research. For example, research reports have reported that the nano-antibody is applied to the research and development of diagnostic techniques for animal diseases such as chicken newcastle disease, swine influenza, porcine parvovirus disease and the like, and compared with the traditional monoclonal antibody, the nano-antibody has the advantages of low production cost, simplicity in operation and the like. Therefore, the technology for establishing the detection of the animal epidemic disease by using the nano antibody has good market application prospect.

So far, no specific vaccine aiming at ASFV is available for prevention, and no specific medicine for resisting virus is available, and the technical means for preventing and controlling the disease mainly depends on the early-stage etiological detection of infected pigs and eliminates the disease. The current ASF diagnosis and population screening method is mainly fluorescence quantitative PCR. However, the detection method has the disadvantages of complicated operation steps, expensive instruments and equipment, high detection cost, easy generation of false positive and difficult clinical popularization and use. Enzyme-linked immunosorbent assay (ELISA) has the advantages of simple operation, high sensitivity, strong specificity, capability of quantitative determination and the like. At present, a plurality of ELISA methods for detecting African swine fever antibodies exist in the market, but the methods mainly rely on traditional monoclonal antibodies and need to use secondary antibodies, so that the production cost of a commercial kit is high. Based on the advantages of small molecular weight and easy genetic engineering modification of the nano antibody, the nano antibody and enzyme or fluorescent protein can be subjected to fusion expression, so that the nano antibody can be directly used in immunological detection without antibody marking and using a second antibody, the production process is simplified, and the production cost is greatly reduced. Therefore, the method has a very wide application prospect when the nano antibodies of different ASFV antigen proteins are screened and prepared and used as materials for immunological detection.

Disclosure of Invention

The invention aims to provide a nano antibody for resisting ASFV-p30 protein and a preparation method thereof, so as to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a nano antibody for resisting ASFV-p30 protein, which is named as ASFV-p30-Nb12, and the amino acid sequence of the nano antibody ASFV-p30-Nb12 is shown as SEQ ID No. 1.

The invention also provides a nano antibody for resisting ASFV-p30 protein, which is named as ASFV-p30-Nb37, and the amino acid sequence of the nano antibody ASFV-p30-Nb37 is shown as SEQ ID No. 2.

The invention also provides a preparation method of the nano antibody for resisting ASFV-p30 protein, which comprises the following steps:

(1) emulsifying ASFV-p30 protein with adjuvant, injecting Bactrian camel, and injecting five times continuously, each time at 2 weeks interval;

(2) collecting peripheral blood to separate lymphocytes after 7 days of last injection immunization, and constructing a phage display library of anti-ASFV-p 30 protein;

(3) and (3) eliminating the unbound phage by using a phage display technology, and screening and sequencing to obtain two different nano antibodies specifically bound to the phage.

Preferably, the adjuvant is specifically: the first time complete Freund's adjuvant is used, and the last four times incomplete Freund's adjuvant is used.

The invention also provides a nucleotide molecule for coding the ASFV-p30-Nb12 nano antibody amino acid sequence, and the nucleotide sequence is shown as SEQ ID No. 3.

The invention also provides a nucleotide molecule for coding the ASFV-p30-Nb37 nano antibody amino acid sequence, and the nucleotide sequence is shown as SEQ ID No. 4.

The application also provides a fusion protein of the ASFV-p30-Nb12 nano antibody and the HRP, and the fusion protein is formed by connecting the nano antibody ASFV-p30-Nb12 and the HRP in series.

The application also provides a fusion protein of the ASFV-p30-Nb37 nano antibody and the HRP, and the fusion protein is formed by connecting the nano antibody ASFV-p30-Nb37 and the HRP in series.

The invention also provides a preparation method of the nano antibody and HRP fusion protein, which comprises the following steps:

(1) construction of recombinant eukaryotic expression vectors: connecting the gene sequence of the coding nano antibody ASFV-p30-Nb12 or ASFV-p30-Nb37 to a pEGFP-N1-HRP vector by double enzyme digestion to obtain a positive plasmid;

(2) and (3) transforming the positive plasmid in the step (1) into a host cell, and inducing and expressing the nano antibody and the HRP fusion protein.

Preferably, the double-enzyme-digested enzyme is Pst I and Not I.

Preferably, the host cell is a HEK293T cell.

Preferably, the induction expression time is 72 h.

The invention also provides application of the fusion protein in preparation of a product for detecting anti-ASFV antibody in pig serum.

The invention also provides an application method of the fusion protein in preparing a product for detecting anti-ASFV antibody in pig serum, which comprises the following steps:

(1) coating ASFV-p30 protein on an ELISA plate to obtain the ELISA plate coated with the ASFV-p30 protein;

(2) mixing the nano antibody and the HRP fusion protein with pig serum to obtain a mixture;

(3) adding the mixture obtained in the step (2) to the ELISA plate coated with the ASFV-p30 protein obtained in the step (1) for incubation, and adding a color development solution for reaction in a dark place after incubation;

(4) adding 3M concentrated sulfuric acid to terminate the reaction in the step (3);

(5) and (3) color observation: the porcine serum contains an anti-ASFV-P30 antibody, and the ELISA plate has no color change, namely is colorless; if the anti-ASFV-P30 antibody is not present in the serum, the microplate becomes yellow.

Preferably, the incubation temperature is 37 ℃ and the incubation time is 1 h.

Preferably, the color developing solution is a TMB color developing solution.

The invention discloses the following technical effects:

the invention provides a 2-strain ASFV-p30 protein-resistant nano antibody, a preparation method and application thereof, an expression preparation method of the nano antibody and HRP fusion protein, and application of the nano antibody and HRP fusion protein in detection of an anti-ASFV antibody in pig serum. The anti-ASFV-p 30 protein nano antibody and the HRP fusion protein are applied to establishment of ELISA for detecting the anti-ASFV antibody in pig serum, the established method is simple to operate, the time consumption for detecting samples is short, and an enzyme-labeled secondary antibody is not required. Provides a key material for the development of a commercial ELISA kit for the subsequent application of the two strains of nano antibodies to ASFV antibody detection.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without inventive exercise.

FIG. 1 shows PCR amplification of a gene encoding ASFV-p30 protein; wherein M is Maker; 1,2 are amplified target fragments;

FIG. 2 shows the results of double enzyme digestion of the gene of ASFV-p30 protein and pET-21b empty vector, wherein M is Maker, 1 is the result of double enzyme digestion of the gene of p30 protein, and 2 is the result of double enzyme digestion of the empty vector of pET-21 b;

FIG. 3 shows PCR identification of pET-21b-ASFV-p30 positive monoclonal by bacterial liquid, wherein M is marker, and 1-10 are positive clones;

FIG. 4 is an SDS-PAGE analysis of the recombinant protein ASFV-p30 after prokaryotic expression, wherein M is Maker, 1 is inclusion body, and 2 is post-sonication supernatant;

FIG. 5 is an SDS-PAGE analysis of the purified recombinant protein ASFV-p30 after prokaryotic expression, wherein 1 is the effluent of incubation of the recombinant protein with a nickel column, and 2-3 are the eluted hetero proteins; 4-10 is protein purified by nickel column affinity chromatography;

FIG. 6 shows the separation of lymphocytes from the peripheral blood of an immunized camel by Ficoll lymphocyte separation medium;

FIG. 7 is a diagram of agarose gel electrophoresis detection analysis of a first round of PCR amplified VHH gene product, where M is Maker and 1-2 are amplification products;

FIG. 8 is an agarose gel electrophoresis assay for the detection and analysis of VHH gene products from the second round of nested PCR amplification;

FIG. 9 shows the VHH gene inserted into the phage library constructed by PCR amplification of agarose gel electrophoresis analysis bacterial liquid;

FIG. 10 is a diagram of indirect ELISA method for detecting the reactivity of the crude extract of recombinant nanobody with ASFV-p30 protein;

FIG. 11 shows the result of agarose gel electrophoresis analysis of the double cleavage products of the recombinant plasmid pMECS-ASFV-p30-Nbs and the recombinant vector pEGFP-N1-HRP containing the gene sequence of the nanobody, wherein 1 to 5 are pMECS-ASFV-p30-Nb12, 6 to 10 are pMECS-ASFV-p30-Nb37, and 11 is pEGFP-N1-HRP;

FIG. 12 shows the expression of ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein in 293T cells by immunofluorescence analysis after the constructed nanobody recombinant expression plasmid is transfected into 293T cells, wherein A is ASFV-p30-Nb12-HRP, and B is ASFV-p30-Nb 37-HRP;

FIG. 13 shows the ELISA analysis of the binding between ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein secreted and expressed in 293T cell culture supernatant and two strains of nanobodies (1: 10, 1:100, 1:1000, 1: 10000) and ASFV-p30 protein after gradient dilution.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in further detail below.

The experimental methods in the following examples, in which specific conditions are not specified, are generally performed according to conventional conditions, such as "molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or the conditions provided by the manufacturer.

Example 1 construction of prokaryotic expression vector of ASFV-p30 protein, and expression and purification thereof

1.1 construction of prokaryotic expression vector of African swine fever virus p30 protein

According to the gene sequence of p30 protein encoded by the Chinese African swine fever isolate in GenBank, (GenBank accession number: MK128995), the gene sequence was synthesized by Jinwei corporation, and a recombinant cloning plasmid pUC-56-p30 was constructed. Designing a specific primer according to a coding gene sequence:

ASFV-p30-F1：CCCGGATCCATGGATTCTGAATTTTTT, wherein a protective base (CCC) and a cleavage site BamH I (GGATCC) are introduced; ASFV-p 30-R1: CCCCTCGAGTTATTTTTTTTTTAAAAGTT, in which a protecting base (CCC) and a cleavage site Xho I (CTCGAG) are introduced.

The above recombinant cloned plasmid was used as a template for PCR amplification, and the amplification system is shown in Table 1.

TABLE 1 PCR translation System for amplifying p30 Gene sequence Using pUC-56-p30 plasmid as template

The reaction condition is pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 90s for 30 cycles; after completion of the cycle the extension was continued for 7min at 72 ℃. The PCR product was subjected to agarose gel electrophoresis to obtain a fragment of the expected size of 600bp (FIG. 1). Then the commercial vector pET-21b and the recovered product are simultaneously used with Quickcut^TMBamH I (1010A, TaKaRa) and Quickcut^TMXho I (1093A, TaKaRa) was subjected to double digestion, and the reaction system was as shown in the following Table (Table 2).

TABLE 2 double digestion System for the commercial vector pET-21b and the amplified PCR product

The results of electrophoresis on 1% agarose gel showed that the restriction fragments of about 600bp and 5600bp, respectively, were obtained, and the results are shown in FIG. 2.

The cleaved fragments were ligated using T4 ligase (16 ℃ overnight). The attachment system is shown in table 3 below.

TABLE 3 commercial vector and PCR amplification product ligation System

The ligation products are transformed into Trans (5 alpha) competent cells, after the cells are cultured in an incubator at 37 ℃ for 12h, single colonies are picked up and inoculated into 10mL of LB liquid culture medium, after shaking culture in a shaker at 37 ℃ for 12h, after PCR identification of bacterial liquid, 10 positive colonies are shown as positive results, and as shown in figure 3, the positive bacterial liquid is sequenced, and the positive plasmid is named as pET-21b-ASFV-p 30.

The LB liquid medium is: 10g of tryptone, 5g of yeast extract, 10g of NaCl and 1000mL of deionized water are supplemented.

1.2 prokaryotic expression of African swine fever virus p30 protein

Transforming the recombinant positive plasmid pET-21b-ASFV-p30 prepared in 1.1 into competent cells of Escherichia coli expression host bacteria Transetta (DE3), coating the competent cells on a plate, and culturing overnight at 37 ℃; the next day, selecting a monoclonal colony to be inoculated in an LB liquid culture medium, and carrying out shaking table overnight culture at 37 ℃; then inoculating the overnight culture liquid into a fresh LB liquid culture medium containing ampicillin until the bacterial liquid OD₆₀₀After reaching the value of 0.6-0.8, IPTG was added to the medium at a final concentration of 0.5mM, and the expression was induced at 37 ℃ for 6 hours. And (3) subpackaging the bacteria liquid after induction expression in a 50mL centrifuge tube, centrifuging at 8000r/min for 5min, collecting precipitates, resuspending the bacteria with PBS, performing ultrasonic lysis by using an ultrasonic instrument under the conditions of 20kHz frequency, 35W power, 3s working time, 3s stopping, 30min ultrasonic time and 12000g for 30min, finally taking the supernatant and the precipitates, performing polyacrylamide gel electrophoresis (SDS-PAGE) to analyze the expression condition of the protein, and expressing the ASFV-p30 recombinant protein in the precipitates in an inclusion body form, wherein the result is shown in figure 4.

1.3 purification of the p30 recombinant protein of African Swine fever Virus (ASFV-p30)

The precipitate obtained in 1.2 was mixed with lysine Buffer (containing 8M Urea, 100mM NaH)₂PO₄100mM Tris-HCl, pH 8.0) was incubated overnight, and the supernatant was centrifuged. An appropriate amount of Ni Resin (affinity chromatography medium) was loaded on a column, and then ASFV-p30 protein was added to the column and incubated at 4 ℃ for 4 hours. The hetero-protein was eluted with low density imidazole (10mM) followed by the protein of interest with high density imidazole (250 mM). Collecting the eluted hybrid protein and the target protein to perform SDS-PAGE, and the result shows that the protein is purified by nickel column affinity chromatographyThe ASFV-p30 protein was successfully purified, and the results are shown in FIG. 5.

Example 2 screening and preparation of anti-ASF Virus p30 protein Nanobody

2.1 protein emulsification and animal immunization

After 1mL of purified ASFV-p30 protein (1.2mg/mL) is emulsified with complete Freund's adjuvant with the same volume, Alalashan humpback is immunized subcutaneously at the neck for the 1 st immunization, the incomplete Freund's adjuvant is used for the last 4 times of emulsification, and camel peripheral anticoagulation is adopted 7 days after the last immunization.

2.2 construction and panning of VHH phage antibody libraries

2.2.1 isolation of peripheral blood lymphocytes

After the peripheral anticoagulation of 200mL camel is aseptically collected, the camel is diluted by using equal volume of RPMI1640(01-100-1ACS, BI) culture solution. The collected peripheral blood lymphocytes were then separated using Ficoll-Paque PLUS lymphocyte isolate (Greiner bio-one). The centrifuged red blood cells are located at the bottom of the lymphocyte separation tube, the centrifuged plasma is located at the uppermost layer, and a layer of milky white substance, namely lymphocytes, is annularly arranged between the plasma and the white transparent lymphocyte separation liquid, as shown in fig. 6. Aspirating the annular opalescent material with a pipette and counting the isolated lymphocytes with a hemocytometer at 1X 10⁷Subpackaging each cell/branch, centrifuging, removing supernatant, directly using cell precipitate for RNA extraction, and storing the rest at-80 ℃.

2.2.2 amplification of the VHH Gene fragment in peripheral blood lymphocytes

According to

Total lymphocyte RNA (RNA of more than 200 bp) was extracted using Plus Mini RNA extraction kit (QIAGEN). By using

III reverse transcriptase first strand cDNA was synthesized using RNA as template and then VHH gene was amplified using nested PCR. First, an RNA/primer mixture was prepared, as shown in Table 4:

TABLE 4 RNA reverse transcription System

After incubating the RNA/primer at 65 ℃ for 5min, it was immediately placed in an ice-water bath for 1 min. Subsequently, a cDNA synthesis mixture was prepared, the system of which is shown in Table 5:

TABLE 5 cDNA Synthesis mixture System

The cDNA synthesis mixture (10. mu.L) was added to the RNA/primer mixture, mixed well, incubated at 50 ℃ for 50min and at 85 ℃ for 5min, and the reaction was stopped.

The VHH gene was amplified by nested PCR using the reverse transcribed cDNA as template, and the primer sequences used were as shown in Table 6 below:

TABLE 6 primer sequences for nested PCR amplification of VHH genes

First, the first round of PCR amplification was performed using primers CALL001 and CALL002, and the reaction system is shown in table 7:

TABLE 7 first round PCR amplification reaction System

The reaction condition is pre-denaturation at 94 ℃ for 5 min; 28 cycles of 94 ℃ for 30s,55 ℃ for 30s,72 ℃ for 45 s; extension at 72 ℃ for 7 min.

The PCR products were identified by 1.2% agarose gel electrophoresis, and the results were shown in FIG. 7, with one band at each of the 700bp and 900bp positions as expected. The 700bp PCR product was recovered using the EasyPure Quick Gel Extraction Kit according to the instructions. Subsequently, the recovered product was used as a template, and the second PCR amplification was performed using the above VHH-FOR and VHH-REV primers, and the reaction system is shown in Table 8. .

TABLE 8 second round PCR amplification reaction System

The reaction condition is pre-denaturation at 94 ℃ for 5 min; 94 ℃ for 30s,55 ℃ for 30s,72 ℃ for 30s,18 cycles; extension at 72 ℃ for 5 min.

The PCR product was subjected to 1.5% agarose gel electrophoresis to show that the desired band (about 400 bp) was obtained by amplification, and the results are shown in FIG. 8. And recovering a PCR product, namely the VHH gene by using a Kit EasyPure Quick Gel Extraction Kit.

2.2.3 construction of VHH phage display vectors

The recovered product is subjected to double enzyme digestion by Pst I and Not I, and then is connected into a commercial pMECS phage display vector, and the specific enzyme digestion system is shown in the following table (Table 9, Table 10):

TABLE 9 pMECS double enzyme digestion System

TABLE 10 VHH Dual enzyme cleavage System

The digestion conditions were 37 ℃ for 16 h. The digestion product was recovered using the EasyPure Quick Gel Extraction Kit.

The recovered product was ligated into the phage display vector pMECS using T4 DNA ligase at 16 ℃ for 16h, as shown in Table 11:

TABLE 11 ligation System of the cleavage products with the vector pMECS

2.2.4 preparation of competent cells of Escherichia coli TG1

Coli TG1 was cultured to OD_600nmAfter 0.4-0.6, it was rapidly cooled, centrifuged, and washed repeatedly three times with pre-cooled 10% glycerol. Finally, TG1 competent cells were resuspended in 10% glycerol.

2.2.5 ligation product transformation of TG1 competent cells and harvesting of phage antibody libraries

The ligation product was added to the E.coli TG1 competent cells prepared in 2.2.4, gently mixed and added to an electroporation cuvette, and the competent cells were electroporated with an Eppendorf electroporator with the parameters set at 1.8kV, 25. mu.F, 200. omega., 1 mm. SOC medium was added to resuspend the cells immediately after electrotransformation was complete. Shaking and culturing at 37 ℃ for 1h at 120r/min, coating on an LB/AMP-GLU plate, culturing at 37 ℃ for 6-8h, collecting lawn by using a cell scraper, and adding 50% glycerol with the volume of 1/3 to obtain the prepared phage library.

2.2.6 determination of phage library diversity and library size.

Diluting the electrotransformation product by 10 times to 10^-5Then spread on LB/AMP-GLU plates, cultured at 37 ℃ for 12 hours, and the number of transformants was counted to finally obtain a library volume of 4.5X 10⁸The phage library of (1). 48 monoclonals are randomly picked, PCR identification is carried out by using the VHH-FOR and VHH-REV primers shown in the table 6, positive clones are identified by agarose gel electrophoresis, the target size is about 400bp, and the result is shown in figure 9.

2.3 screening of specific Nanobody against ASFV-p30 protein

2.3.1 rescue of phage library

The obtained phage display vector library was inoculated into 2 XYT/AMPGLU medium at 37 ℃ for 200r/min, after culturing to logarithmic phase, M13KO7 helper phage was added, and left to stand at 37 ℃ for 30 min.

After the culture, 2800g centrifugation for 10min, abandon the supernatant, the precipitated thalli with 200mL2 XYT/AMP-KAN medium heavy suspension, 37 degrees 200r/min culture for 12 h. After centrifugation at 3800g and 4 ℃ for 30min, the supernatant was collected and 1/5 volumes of precooled PEG/NaCl solution were added. 3800g was centrifuged at 4 ℃ for 30min, and 1mL of PBS was added to resuspend the phage pellet and allow it to dissolve well.

Meanwhile, the phage solution is diluted by 10 times of gradient, and then the dilution degree is 10^-2、10^-4、10^-6、10^-8、10^-10The sample was added with TG1 cells in the logarithmic growth phase, and left standing at 37 ℃ for 15 min. Spread on LB/AMP-GLU plates, cultured at 37 ℃ for 8 hours, and the titer of the recombinant phage was calculated to be 6.5X 10¹²PFU/mL。

2.3.2 panning of anti-ASFV-p 30 protein-specific recombinant phage

The purified recombinant protein ASFV-p30 was coated in ELISA plates, PBS was used as control. And (3) adding the prepared phage solution into an ELISA plate, incubating at room temperature for 1h, and discarding a phage sample. Then, freshly prepared 0.1M triethylamine was added to each well, left to stand at room temperature for 10min, and the eluate was rapidly neutralized with an equal volume of 1M Tris-HCl (pH 7.4).

Collecting eluate, impregnating 4mL of TG1 cells in logarithmic phase, standing at 37 deg.C for 30min, adding 2 XYT/AMP-GLU culture medium, and culturing at 37 deg.C for 200r/min to OD₆₀₀To 0.6-0.8. The above-mentioned operation 2.3.1 was repeated to rescue the phage library. After obtaining the rescued phage library, the second and third rounds of panning were performed using the same method as described above, and the results of each round by measuring the phage titer showed that the phage library was enriched, and the results are shown in table 12.

TABLE 12 enrichment of H9N2-NP protein-specific phages during the screening procedure

2.4 Induction expression of recombinant Nanobodies and obtaining of crude extracts

Randomly selecting 96 single colonies from the plate eluted in the third round, sequentially marking # 1-96, inoculating to a 96-well plate, adding LB/AMP-GLU culture medium into each well, and culturing at 37 ℃ for 8h at 200 r/min.

Each clone was aspirated into 1. mu.L of culture medium, inoculated into 1mL of TB medium, cultured in 24-well plates, cultured at 37 ℃ at 200r/min until logarithmic phase, and then expression was induced by adding 10mM IPTG per well. And after centrifugal precipitation of the expressed bacteria, repeatedly freezing and thawing for 3 times, centrifuging for 15min at 3500g4 ℃, and collecting supernatant to obtain the crude soluble recombinant nano antibody extract.

2.5 Indirect ELISA for detecting the reaction of the crude extract of the recombinant nano antibody and the ASFV-p30 protein

The purified ASFV-p30 recombinant protein was coated on ELISA plates, and PBS control was performed. Taking the crude extract of the soluble recombinant nano antibody, diluting the crude extract by using 2.5 percent of skimmed milk powder as a confining liquid at a ratio of 1:1, adding the diluted product into an enzyme label plate, and incubating the enzyme label plate for 1 hour at room temperature. After washing the ELISA plate with PBS' T, the mouse anti-HA-tag antibody (1:500 dilution, 20. mu.L, Beijing Quanjin Biotechnology Co., Ltd.) diluted with blocking solution 1:2000 was added and incubated at room temperature for 1 h. Then, HRP-labeled goat-anti-mouse secondary antibody (1:2000 dilution, 10. mu.L, Beijing Quanjin Biotech Co., Ltd.) was added and incubated at room temperature for 1 h. Adding TMB color development substrate, developing at room temperature in dark place for 30min, terminating the reaction with 3M concentrated sulfuric acid, and reading OD by using an automatic microplate reader_450nmThe value of (c). The results show that 88 crude extracts can be specifically combined with ASFV-p30 protein, and the results are shown in figure 10. Sequencing the positive strains, and displaying that 2 strains of nano antibodies against ASFV p30 protein are successfully screened and obtained, and the nano antibodies are named as ASFV-p30-Nb12 and ASFV-p30-Nb 37.

Example 3 expression and preparation method of two strains of anti-ASFV-p 30 protein nanobody and HRP fusion protein

3.1 construction of ASFV-p30-Nbs-HRP recombinant eukaryotic expression vector

After the modified fusion protein of the nano antibody-HRP based eukaryotic expression vector pEGFP-N1-HRP is subjected to double enzyme digestion by Pst I and Not I, the VHH gene obtained in 2.22 is connected to pEGFP-N1-HRP vector to obtain pEGFP-ASFV-p30-Nb12 and pEGFP-ASFV-p30-Nb37 positive plasmids, the positive plasmids are subjected to bacterial liquid PCR and sequencing identification, and the PCR result of the bacterial liquid is shown in figure 11.

3.2 expression and preparation of ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion proteins

Will constructSuccessful pEGFP-ASFV-p30-Nb12 and pEGFP-ASFV-p30-Nb37 positive plasmids and Opti-

Medium and Lipo8000^TMThe transfection reagent is mixed evenly and added into 293T cells in good state, and placed at 37 ℃ in CO₂Culturing in an incubator.

And (3) selecting a part of transfected 293T cells when the cells are transfected for 48h, and detecting whether the recombinant fusion protein is expressed in the 293T cells by using immunofluorescence of goat anti-His monoclonal antibody (1:500 dilution, 10 mu L, Beijing holotype gold biotechnology, Co., Ltd.). The result shows that the ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein are correctly expressed, the cell emits green fluorescence, and the result is shown in figure 12. In addition, the collected cell supernatant was subjected to indirect ELISA to detect whether the expressed recombinant ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion proteins were secreted into 293T cell supernatant, and the results showed that the expressed nanobody and HRP fusion protein were secreted into cell supernatant, as shown in fig. 13.

After transfection for 72h, collecting the culture supernatant of the transfected cells, namely ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein.

Example 4 application of ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein in detection of anti-ASFV antibody in porcine serum

4.1 detection of anti-ASFV antibody in porcine serum by ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein

After the purified ASFV-p30 recombinant protein is coated on an ELISA plate overnight, the plate is blocked for 1h, and ASFV-p30-Nb12-HRP and ASFV-p30-Nb37-HRP fusion protein are diluted by using blocking solution according to the ratio of 1:100 and the ratio of 1:1000 respectively. And then diluting the pathogen inactivated anti-ASFV antibody positive pig serum, anti-ASFV antibody negative pig serum and PBS respectively with the prepared serum diluent according to the ratio of 1:2, adding the diluted serum into an ELISA plate, and incubating for 1h at 37 ℃. After washing the plate, adding TMB chromogenic substrate, and developing for 15min at room temperature in the dark. After the color development was completed, 3M sulfuric acid was added to terminate the reaction, and the color change of the ELISA plate was observed. The results showed that the positive sera turned colorless without any color change and the negative sera turned yellow. And the OD of each well of the ELISA plate was read using a spectrophotometer₄₅₀The results are shown in Table 13:

TABLE 13 reaction of Nb and HRP fusion proteins with serum

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Claims

1. A nanometer antibody for resisting ASFV-p30 protein, which is characterized in that: is named as ASFV-p30-Nb12, and the amino acid sequence is shown as SEQ ID No. 1.

2. A nanometer antibody for resisting ASFV-p30 protein, which is characterized in that: is named as ASFV-p30-Nb37, and the amino acid sequence is shown as SEQ ID No. 2.

3. The method for preparing nanobody according to any one of claims 1 to 2, comprising the steps of:

(1) emulsifying ASFV-p30 protein with adjuvant, injecting Bactrian camel animal, and injecting five times continuously, each time at 2 weeks interval;

4. The method according to claim 3, wherein the adjuvant is in particular: the first time complete Freund's adjuvant is used, and the last four times incomplete Freund's adjuvant is used.

5. A nucleotide molecule encoding the nanobody amino acid sequence of claim 1, characterized in that: the nucleotide sequence is shown as SEQ ID No. 3.

6. A nucleotide molecule encoding the nanobody amino acid sequence of claim 2, characterized in that: the nucleotide sequence is shown as SEQ ID No. 4.

7. A fusion protein containing the nanobody of any one of claims 1 to 2 and horseradish peroxidase, wherein the fusion protein is formed by connecting a nanobody of ASFV-p30-Nb12 or ASFV-p30-Nb37 in tandem with HRP.

8. The method for preparing the fusion protein of the nanobody and the HRP according to claim 7, which comprises the following steps:

9. Use of the fusion protein according to claim 7 for the preparation of a product for detecting anti-ASFV antibodies in porcine serum.

10. The use of a fusion protein according to claim 9 for the preparation of a product for the detection of anti-ASFV antibodies in porcine serum, comprising the steps of: