CN108060113B

CN108060113B - Genetically engineered single-chain antibody strain capable of stably expressing interferon gamma and application thereof

Info

Publication number: CN108060113B
Application number: CN201711338429.1A
Authority: CN
Inventors: 王荣智; 杨航; 王俊程; 钟燕芳; 汪世华; 凌素美
Original assignee: Fujian Agriculture and Forestry University
Current assignee: Fujian Agriculture and Forestry University
Priority date: 2017-12-14
Filing date: 2017-12-14
Publication date: 2021-03-30
Anticipated expiration: 2037-12-14
Also published as: CN108060113A

Abstract

The invention belongs to the field of antibody engineering, and particularly relates to a genetic engineering single-chain antibody strain capable of stably expressing interferon gamma (IFN-gamma) and application thereof. The invention clones the gene of interferon gamma in vitro by means of genetic engineering, constructs a prokaryotic expression vector, and obtains soluble interferon antigen protein by IPTG induced expression and purification. A genetic engineering single-chain antibody strain capable of stably secreting and expressing anti- (IFN-gamma) is selected by utilizing a phage display technology, a prokaryotic expression vector is constructed to express and purify a functional single-chain antibody, and a competitive ELISA method is utilized to realize qualitative and quantitative detection of IFN-gamma in human blood, thereby laying a foundation for commercial development and production of high-quality enzyme-linked immunoassay kits and gold-labeled antibody detection cards.

Description

Genetically engineered single-chain antibody strain capable of stably expressing interferon gamma and application thereof

Technical Field

The invention belongs to the field of antibody engineering, and particularly relates to a genetic engineering single-chain antibody strain capable of stably expressing interferon gamma and application thereof.

Background

Interferon-gamma (IFN-. gamma.) is a cytokine secreted mainly by activated T cells and natural killer cells (NK cells) and is the only member of type II interferons. The interferon gamma monomer is a segment sequence which consists of six alpha helices and forms a core and extends and develops in a C terminal area. The biologically active interferon gamma dimer is formed by two antiparallel interlocked monomers and is widely present in the blood of humans and mammals. Interferon gamma has antiviral, immunoregulatory and antitumor properties. It has also been reported that interferons can be used to treat infectious diseases, but also to contribute to autoimmunity.

At present, electrochemical methods are generally adopted for interferon gamma detection technology in human blood, and mainly include Cyclometalated iridium sensor detection (Cyclometalated iridium (III) complex), Micropatterned aptamer-modified electrodes (Micropatterned aptamers), DNA aptamer-based electrochemical detection (DNA aptamer-based electrochemical biosensor), and the like. Although the interferon gamma detection based on the electrochemical method has high detection sensitivity, the detection is time-consuming, has high requirement on the purity of a sample, is complex to operate, has high environmental requirement and poor stability, and needs a professional detection mechanism and technical personnel, so the method is not suitable for popularization and rapid and accurate detection of the interferon gamma in an actual clinical blood sample. The immunoassay (Immuno-analysis) method is a new method developed in nearly more than ten years, is an analysis method formed by combining antigen-antibody reaction with a sensitive detection system, has the advantages of good specificity, high sensitivity, simple operation technology, low cost, low requirement on the purity of a sample and the like, is particularly suitable for detecting a large quantity of samples, and is widely applied to the detection of various toxins in recent years.

Interferon gamma is produced by lymphocytes upon antigen stimulation. The interferon gamma has strong antiviral activity, can inhibit the proliferation of various viruses, and is a broad-spectrum antiviral medicament in medicine. Meanwhile, the interferon gamma is an important detection index for evaluating the cellular immune response of the organism and has extremely important detection and diagnosis significance in practical clinical medicine. For this reason, a simple, rapid and sensitive method for detecting interferon gamma is required for hospitals, research institutes and epidemic prevention departments. However, no studies have been reported on immunological detection methods of interferon γ based on genetically engineered antibodies. Therefore, the genetic engineering antibody with high affinity and strong specificity for the interferon gamma is prepared, and the immunological detection method based on the genetic engineering antibody is established, so that the foundation is laid for finally developing the commercial detection kit and the colloidal gold detection card based on the genetic engineering antibody.

Disclosure of Invention

The invention aims to provide an anti-interferon gamma (IFN-gamma) genetic engineering single-chain antibody strain capable of stably expressing high affinity.

The invention firstly provides a genetic engineering single-chain antibody strain pET28a-mbp-linker-scFv-A8/BL21 for resisting IFN-gamma toxin.

The antibody strain is Escherichia coli (Escherichia coli) pET28a-mbp-linker-scFv-A8/BL21 which is preserved in the general microbiological center of China Committee for culture Collection of microorganisms (CGMCC) No. 14860 at 11 and 6 months in 2017, wherein the accession number is No. 3 of West Lu No. 1 of the North China academy of sciences, the south China area of the morning, Beijing.

Secondly, a single-chain antibody expressed by the single-chain antibody strain pET28a-mbp-linker-scFv-A8/BL21 is provided.

The preparation method of the genetic engineering single-chain antibody is to amplify the single-chain antibody gene obtained by phage display panning, clone the single-chain antibody gene into a prokaryotic expression vector, and transform escherichia coli BL21 to carry out IPTG induced expression and purification, so as to obtain the single-chain antibody with IFN-gamma antigen binding activity.

The invention also provides the application of the single-chain antibody in preparing a kit and a detection card for detecting IFN-gamma, and the generated single-chain antibody is used for detecting interferon gamma (IFN-gamma) in clinical blood samples by utilizing the antigen-antibody reaction principle.

The application of the single-chain antibody pET28a-mbp-linker-scFv-A8/BL21 is that the single-chain antibody is configured in an immunoassay kit for detecting IFN-gamma.

The invention has the advantages that:

the invention clones IFN-gamma gene, constructs in vitro expression vector, and obtains high-purity soluble IFN-gamma antigen protein through IPTG induced expression and affinity chromatography purification. After animal immunization, a genetic engineering single-chain antibody strain capable of stably secreting and expressing anti-IFN-gamma is selected by utilizing a phage display technology, a prokaryotic expression vector is constructed to express and purify a functional single-chain antibody, and an ELISA detection kit is assembled to realize qualitative and quantitative detection of IFN-gamma in a blood sample, thereby laying a foundation for commercial development and production of high-quality ELISA detection kits and gold-labeled antibody detection cards.

Drawings

FIG. 1 purification of interferon gamma antigen expression and immunization of animals. Wherein A is the result of prokaryotic expression and purification of IFN-gamma protein; and B is the result of measuring the serum titer of the immunized mice.

FIG. 2A shows the panning results of the phage antibody library.

FIG. 2B shows the result of PCR detection of single-chain antibody.

FIG. 2C shows the result of ELISA assay of single-chain antibody strains.

FIG. 3A is a schematic diagram of scFv prokaryotic expression vector construction.

FIG. 3B shows SDS-PAGE of scFv fusion protein expression.

FIG. 3C shows the results of scFv fusion protein expression solubility analysis.

FIG. 4A is an analysis of scFv fusion protein purification results.

FIG. 4B shows the result of ELISA detection of scFv fusion protein interaction with antigen.

FIG. 4C shows the result of Western Blotting detection of scFv fusion protein and antigen interaction.

FIG. 5A is a specificity analysis of scFv antibodies.

FIG. 5B is a scFv antibody molecule affinity assay.

FIG. 6A is an indirect competition ELISA assay curve.

FIG. 6B is a standard curve for indirect competition ELISA assay.

Detailed Description

Example 1

Firstly, the preparation and identification of the single-chain antibody.

1. Expression and purification of interferon gamma antigen

In the experiment, an interferon gamma antigen DNA sequence is taken as a template, a specific primer (IFN-gamma-F: CAAGAATTCTGTTACT GCCAGGACCCATATGT; IFN-gamma-R: TTAAAGCTTCTGGGATGCTCTTCGACCTCGA) is designed for PCR amplification, restriction enzymes EcoR I and Hind III are used for enzyme digestion, and the restriction enzymes are connected with a prokaryotic expression vector pET28a with the same enzyme digestion to construct a recombinant expression vector pET28a-IFN-γ。Transforming Escherichia coli competent cell BL21, inducing expression with IPTG (concentration of 1 mM/L), and subjecting expression product to Ni²⁺Obtaining high-purity IFN-gamma antigen protein by affinity chromatography. The method comprises the following specific steps:

1）、IFN-γgene amplification reaction system:

PCR mixture 25 µL

IFN-γ-F(20 mM) 0.5 µL

IFN-γ-R(20 mM) 0.5 µL

Template DNA 2 µL

ddH₂O 25 µL

the PCR amplification conditions were: 5 min at 94 ℃, 45s at 53 ℃ and 30s at 72 ℃ and react for 30 cycles; extension at 72 ℃ for 5 min.

2) PCR product recovery, enzyme digestion and connection

And (3) detecting a product obtained by PCR through agarose gel electrophoresis, and recovering a target DNA fragment from a target band on the cut gel through a Fermentas gel recovery kit. And connecting the recovered PCR product after double enzyme digestion with the vector DNA subjected to the same enzyme digestion, wherein the molar ratio of the connection reaction of the two is 3: 1. Ligation was performed overnight at 16 ℃.

A connection system:

Vector DNA （double digested） 0.5 µL

Target DNA （double digested） 2.0 µL

10×buffer 1.0 µL

T4-DNA ligase 0.5 µL

ddH₂O up to 10 µL

3) transformation of recombinant plasmid

And adding the 3 muL DNA product connected at the temperature of 16 ℃ into the pre-cooled 50 muL BL21 competent cells under the aseptic condition, lightly flicking the bottom of the EP tube by using the tip of the forefinger finger, and uniformly mixing the connection product and the competent cells for about 5-6 times. The EP tube was gently inserted into ice and left for at least 30 min. The EP tube was transferred to a 42 ℃ constant temperature water bath for 60 seconds. And then placing the EP pipe on ice for 3 min, rapidly adding 900 mu L preheated SOC solution into the EP pipe in an ultra-clean workbench, and inverting and uniformly mixing the solution. Shaking and culturing at 37 deg.C for 60 min, 4000 r/min, and centrifuging for 5 min. After centrifugation, 900 muL of supernatant is discarded, and residues are gently mixed and coated on an LB flat plate containing corresponding antibiotics. Culturing at 37 deg.C for 30 min, and culturing under inverted condition overnight.

4) Identification of recombinant expression vectors

Selecting 5 single colonies, inoculating the single colonies in 4 mL LB culture medium containing 100 mug/mL Amp or 50 mug/mL Kana, carrying out shake culture for 8 h, centrifuging at 10000 r/min, collecting thallus precipitates for carrying out plasmid DNA extraction, and carrying out PCR, enzyme digestion and gene sequencing verification by using the extracted recombinant plasmid DNA as a template.

2.7 inducible expression of recombinant proteins

Taking 50 mu L of bacterial liquid containing the recombinant plasmid, inoculating the bacterial liquid into 4 mL of fresh LB culture medium containing 100 mu g/mL Amp or 50 mu g/mL Kana, carrying out shake culture for 2-3 h, adding 4 mu L of TPTG into a test tube when the bacterial body grows to an OD600 value of 0.8, carrying out shake culture at 37 ℃ for 4 h, and collecting the expressed bacterial liquid for SDS-PAGE analysis.

5) SDS-PAGE gel electrophoresis

Taking 1mL of expressed fresh bacterial liquid in a 1.5 mL EP tube, centrifuging at 10000 r/min to collect bacterial precipitation, discarding supernatant, sucking the residual liquid in the centrifugal tube by using clean filter paper, adding 60 muL SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) loading buffer solution, and violently and uniformly mixing. Heating in 100 ℃ water bath for 5 min, placing on ice for 2 min, centrifuging at 10000 r/min for 5 min, and taking 10 mu L of supernatant to carry out SDS-PAGE to analyze the expression of the target protein.

6) Purification of recombinant protein (His 6 tag)

Inoculating 1mL of fresh cultured bacterial liquid into 500 mL of LB culture medium containing 100 mug/mL Amp or 50 mug/mL Kana, culturing until OD600 value is 0.6, adding 500 mug L of IPTG with the concentration of 1 mol/L, and performing induced expression for 12 h under the low-temperature condition of 16 ℃. Centrifuging at 4 ℃ and 10000 r/min for 5 min, discarding the supernatant, collecting the thallus precipitate, adding 30 mL binding buffer (containing 0.05% Tween 20) into the centrifuge tube, and performing thallus disruption by ultrasonic wave. Crushing 30 times with 5s on and 10 s off interval with 30% of rated power. Centrifuging at 4 ℃ and 10000 r/min for 5 min, and filtering the supernatant through a filter membrane of 0.22 mu m to remove insoluble thallus fragments. Adding the filtered supernatant into a nickel ion affinity chromatography column, opening a lower plug of the column to enable the liquid to pass through the chromatography column by using the action of gravity, collecting the flowing liquid, marking as A1-A4, and taking 10 mu L of each liquid to perform SDS-PAGE analysis. 300 mL of Wash buffer was added to the column and rinsed to remove unbound hetero-protein molecules. The flow-through was collected in four fractions, labeled B1-B4, and 10 μ L each was analyzed by SDS-PAGE. Adding 1mL of Elution buffer into the chromatographic column for protein Elution, carrying out Elution by four times, collecting Elution liquid marked as C1-C4, and carrying out SDS-PAGE analysis on 10 mu L of each Elution liquid.

2. Preparing the gene engineering single-chain antibody.

1) Animal immunization

IFN-gamma antigen obtained by expression and purification is used for immunizing 6 female Balb/c mice, 100 mu g of protein antigen is taken for immunization and dissolved in 100 mu L of 1 XPBS buffer solution, then the protein antigen is mixed with equal volume of Freund's complete adjuvant and completely emulsified, the mice are immunized by adopting a subcutaneous multi-point injection method, and a control group is immunized by equal volume of PBS. After two weeks, taking an equal amount of immunogen to dissolve in 100 mu L of PBS buffer solution, mixing and emulsifying with an equal volume of incomplete adjuvant, and immunizing the mouse by adopting a mode of combining subcutaneous multi-point injection and intraperitoneal injection; immunizations were performed every two weeks. The subsequent immunization step is identical to the second immunization. And after 3-5 days of immunization, tail blood collection is carried out on the immunized mice. Standing at normal temperature for 30 min, centrifuging at 12000 r/min for 20 min, collecting the upper orange-yellow serum, and measuring the antiserum titer by iELISA. Mice were sacrificed when serum titers were above 8000 and spleens were removed for use.

2) Extraction of spleen Total RNA

After the immune mice obtain satisfactory antiserum, the spleen total RNA is extracted by a Trizol method. Animals were sacrificed by pulling their necks, the abdomens of the mice were cut open with DEPC-treated scissors, the spleens were quickly removed, placed in a liquid nitrogen pre-cooled mortar, triturated with liquid nitrogen and ground into powder. Transferring the powder into an EP (ethylene propylene carbonate) tube treated by DEPC (diethyl phthalate), adding 1mL of Trizol and 200 muL of chloroform, violently oscillating and uniformly mixing, centrifuging at 10000 r/min for 5-10 min, extracting supernatant, adding 2 times of volume of absolute ethyl alcohol or 0.6 times of volume of isopropanol to perform RNA (ribonucleic acid) precipitation, drying the precipitate after centrifugation, and adding 50-100 muL of DEPC water to dissolve RNA.

3) RT-PCR and antibody gene amplification

The first strand cDNA was synthesized using the extracted spleen total RNA as a template according to the Promega kit procedures. Amplification of V separately Using primers for heavy and light chains of antibodies_HAnd V_LGene, using recovered V_HAnd V_LThe gene is recombined with a certain amount of Linker DNA gene by PCR, and the scFv gene is amplified by overlap extension PCR.

4) Preparation of genetically engineered antibody

Detecting the product obtained by PCR through agarose gel electrophoresis, cutting the target band on the gelThe objective DNA fragment was recovered by using a gel recovery kit from Fermentas corporation. And carrying out double enzyme digestion on the recovered PCR product by Sfi I and Not I, and then connecting the PCR product with the vector pCANTAB 5E DNA subjected to the same enzyme digestion, wherein the molar ratio of the connection reaction of the two is 3: 1. Ligation was performed overnight at 16 ℃. Transforming the overnight ligated DNA into 100. mu.L of Escherichia coli TG1 competent cells by electric shock, immediately adding 10 mL of 2 XYTG (containing 2% glucose) medium, culturing at 37 ℃, adding M13KO7 helper phage to a final concentration of 10 when the cells grow to OD600 of 0.8¹⁰pfu/mL. Adding Amp antibiotics to a final concentration of 100 mug/mL after 30 min, continuously culturing for 1 h, culturing for 1000 g, and centrifugally collecting thallus precipitates at 4 ℃; adding fresh YT medium (containing 100. mu.g/mL Amp and 50. mu.g/mL Kana) into the precipitate, and culturing at 37 ℃ overnight; at low temperature, 1000 g centrifugation collection supernatant, using PEG/NaCl precipitation phage (volume ratio of supernatant: PEG/NaCl = 5: 1), using fresh YT medium dissolved phage, the solution is phage antibody primary library. 10 muL of each phage diluted by different gradients was coated on an LB plate of surface agarose, and the library volume was calculated.

5) Panning of Single chain antibodies

Antigen (IFN-gamma) is diluted to be 5 mug/mL by protein coating liquid with pH of 9.6, 96-well plate coating is carried out, 100 mug/well is carried out, and the mixture is coated overnight in an environment of 4 ℃. And sucking the protein coating solution by using a pipette, washing the protein coating solution for 3 times by using PBS (phosphate buffer solution) to remove free antigen molecules, adding 200 mu L/hole of PBSM (Poly-p-phenylene benzobisoxazole) sealing solution into the hole, and sealing the hole at 37 ℃ for 2 hours. And removing the confining liquid, adding the prepared phage antibody library into the holes, and reacting at 37 ℃ for 2 h, wherein the phage antibody library is 100 muL/hole. The wells were washed 10 times with PBST and PBS, 200 μ L/well, respectively. Gly-HCl was added to the reaction well, and the phage bound to the TLH antigen was eluted using the acidic condition of the solution, and Gly-HCl was neutralized with 1 mol/L Tris-HCl (pH 8.0). The eluted neutralized phage was immediately removed for TG1 cell infection to expand phage numbers for the next round of panning. According to the method, 6 successive rounds of enrichment panning are carried out, and from the third round, 10 mu L of each phage obtained by panning is coated.

6) ELISA detection of antigen-specific single-chain antibodies

Single colonies of 25 single-chain antibodies were picked from each of the third, fourth, fifth and sixth rounds of coated SOB-AG plates and phage antibody preparation was performed as described above. Diluting the antigen to 5 mug/mL by using a protein coating solution with pH of 9.6, coating the antigen in a 96-well plate, coating the antigen in 100 mug/well, and coating the antigen overnight in an environment of 4 ℃. And sucking the protein coating solution by using a pipette, washing the protein coating solution for 3 times by using PBS (phosphate buffer solution) to remove free antigen molecules, adding 200 mu L/hole of PBSM (Poly-p-phenylene benzobisoxazole) sealing solution into the hole, and sealing the hole at 37 ℃ for 2 hours. And (4) discarding a confining liquid, adding the phage antibody of the single colony into the hole respectively, recording, and reacting at 37 ℃ for 2 h. The wells were washed 10 times with PBST and PBS, 200 μ L/well, respectively. PBSM diluted monoclonal antibody (1: 4000 dilution) against pIII protein was added and left to react at 37 ℃ for 2 h. Repeat step 6 once, add PBSM diluted goat anti-mouse IgG antibody (1: 8000 dilution), and react at 37 ℃ for 2 h. Repeat step 6 once more. Adding 100 muL of TMB color development buffer solution into each well, reacting for 15 min at 37 ℃, and adding 2M H₂SO₄The reaction was terminated. The absorbance was measured at OD450 nm. All experiments were performed in 3 replicates, with M13KO7 set as positive and BSA set as negative control.

7) Identification of antigen-specific Single chain antibodies

DNA sequencing of all positive single-chain antibody strain recombinant plasmids is carried out in Huada gene company, the sequenced sequences are directly compared and analyzed with an NCBI database, and the primer sequences adopted in sequencing are as follows: 5'-CCATGATTACGCCAAGCTTTGGAG CC-3' are provided. After obtaining the scFv gene sequence by DNA sequencing, sequence homology analysis was performed using IMGT software (http:// www.IMGT.org). And analyzing whether the scFv has the structural characteristics of the murine antibody molecule, whether the scFv is a murine scFv gene and determining the CDR characteristic region of the scFv by the result.

8) Prokaryotic expression and Western-Blot detection of single-chain antibody strain

By usingEcoRI andHindIII cleavage site insertion of scFv Gene into pET28a-mbp-linkerIn the vector, a recombinant vector pET28a was formedmbp-linker-scFv-8And performing fusion protein expression on the recombinant plasmid with correct sequencing in Escherichia coli BL 21. Watch (A)The protein expressed contained His6 tag.

9) Single-chain antibody strain specificity analysis and affinity determination

Different antigens (IFN-. gamma., TLH, OVA, BSA, KLH) were diluted to a concentration of 1. mu.g/mL with coating buffer (pH 9.6), washed and blocked as in the ELISA above, and the specificity of the antibodies was analyzed by OD450 nm. Determination of monoclonal antibody affinity constant by iELISA methodKaff. The method comprises the following specific steps: diluting the coating antigen into four concentration coating enzyme label plates of 0.25, 0.5, 1.0 and 2.0 mu g/mL, washing and sealing; diluting the purified single-chain antibody by using 5% PBSM fold ratio, adding the diluted single-chain antibody into an enzyme label plate, adding PBSM into a blank hole, adding the PBSM into the blank hole, performing reaction at the temperature of 37 ℃ for 1-1.5 h. After rinsing, adding a mouse monoclonal antibody which is diluted by 5% PBSM according to a ratio of 1:8000 and is used for resisting MBP protein, wherein the concentration is 100 mu L/hole, and the temperature is 37 ℃ for 1-1.5 h. After rinsing, HRP-IgG diluted with 5% PBSM at 1:8000, 100. mu.L/well, incubation at 37 ℃ for 1.5 h, color development termination and determination of OD450nm were added, and the affinity constant of the antibody was calculated from the IC50 of each curve.

10) Single-chain antibody based IFN-gamma mimetic sample detection

Adding IFN-gamma toxin standard substances (0, 6.64, 13.28, 26.562 and 53.125 ng/mL) into the sample extraction diluent in proportion, detecting by adopting an indirect competitive ELISA method, bringing the value of detected OD450nm into a standard curve, calculating the actually measured CIT content of each concentration, and further calculating the recovery rate and the measuring accuracy thereof. The intra-batch variation coefficient was determined for 3 parallel replicates per group to represent the intra-batch error (CV% = (mean SD/mean intra-batch binding) × 100%); the batch-to-batch error is expressed as the mean number of binding rates of 4 measurements versus the batch-to-batch coefficient of variation.

11) Single chain antibody based detection of actual samples

Different patient (volunteer) blood samples are randomly taken from a hospital, the samples are pretreated, the OD450 value of each sample is detected according to the ic-ELISA method established by the experiment, each sample is repeated for 6 times, the concentration of IFN-gamma in the extracting solution is calculated according to a standard curve, and then the concentration of IFN-gamma in the actual blood sample is obtained after the concentration is multiplied by the dilution.

Two result analysis

1. Interferon gamma antigen expression purification and animal immunity

The experimental result is shown in figure 1, the prokaryotic expression vector of the interferon gamma is successfully constructed, and the high-purity interferon gamma antigen protein is obtained by IPTG induced expression and purification. The result of ELISA detection shows that the antiserum titer of the immunized mice can reach more than 8000, and the result shows that the antigen expression and purification and the animal immunization are successful!

2. Construction, panning and ELISA detection of single-chain antibody library

The experimental results are shown in FIG. 2, and we successfully constructed the library capacity of 10⁸The library of (1) for genetically engineered single-chain antibodies. The PCR results show that our antibody library construction was successful. After 6 rounds of continuous panning, 4 single-chain antibody strains capable of effectively recognizing IFN-gamma are obtained, wherein the gathering capability of the scFv-A8 antibody strain and antigen molecules is strongest, so that the scFv-A8 single-chain antibody strain is selected for subsequent research work.

3. Construction and solubility analysis of prokaryotic expression vectors in different fusion modes

In order to express and purify to obtain a single-chain antibody with strong solubility and high affinity, three prokaryotic expression vectors (shown in figure 3A) with different fusion forms are constructed, and the results of protein SDS-PAGE experiments show that compared with a control strain and an empty vector control, a significant fusion protein expression band is respectively arranged at 30 kDa and 74 kDa. SDS-PAGE analysis results show that the construction of the prokaryotic expression vector is successful, and subsequent related experiments can be carried out (as shown in FIG. 3B). The solubility results show that pET28a-scFvThe expressed antibodies were present as insoluble inclusion bodies, with the least soluble of the 3 fusion expression forms. And pET28a-mbp-scFvAnd pET28a-mbp-linker-scFvThe expression quantity is basically the same and similar solubility is kept, and is similar to pET28a-scFvCompared with the expression, the solubility of the MBP fusion form scFv protein is obviously improved (as shown in figure 3C).

4. scFv fusion antibody purification and identification

The results of SDS-PAGE analysis are shown in FIG. 4A: we successfully purified 2 different fusion forms of scFv fusion antibody proteins, with a distinct fusion protein purification band at about 75 kDa. The ELISA detection result shows that: the MBP-scFv protein, although more soluble, had a weaker antibody activity, whereas the MBP-linker-scFv protein retained a solubility similar to that of the MBP-scFv protein, but the antigen-binding activity was the highest (FIG. 4B). Compared to the negative control: the ability to recognize and bind antigens is, in order from high to low: MBP-linker-scFv > MBP-scFv > control. To further verify the interaction between the soluble antibody and the interferon gamma antigen, the binding ability of the scFv was verified by Western Blotting. Firstly, carrying out SDS-PAGE gel electrophoresis on interferon gamma antigen, carrying out membrane transfer, then, incubating with scFv antibody of osmotic shock, carrying out reaction on the antibody of an anti-MBP-tag label and an HRP-goat anti-mouse IgG antibody, and then, adopting ECL development to carry out detection. The result of Western blotting detection is shown in FIG. 4C, the expression of the purified soluble scFv can recognize CIT, and an obvious ECL development band is formed at about 20 kDa. The results show that the soluble scFv molecules have certain binding capacity to the interferon gamma antigen.

5. Specificity and affinity determination of Single chain antibodies

As shown in fig. 5A, the scFv antibody specifically recognizes only interferon γ, and does not react with other related antigen molecules. The single-chain antibody is shown to have better specificity and almost no cross reaction with other proteins. As shown in FIG. 5B, the affinity of the antibody was 2.6X 10⁹L/mol, high affinity antibody.

6. Establishment of standard detection system based on scFv antibody molecule

Under the optimal detection condition, the detection threshold of ELISA detection is 6-60 pg/mL, and the lowest detection line is 2 pg/mL.

7. Detection of interferon gamma simulation sample and actual sample based on single-chain antibody

As can be seen from Table 1, the recovery rates of the samples in the batch and in the batch are respectively determined to be 78.46% -94.04% and 77.71% -90.89%, and the variation coefficients in the batch and in the batch are both less than 5%. Therefore, the method has good repeatability and high stability. As shown in table 2, it can be seen that interferon γ was not detected in the actual samples.

TABLE 1 recovery and Coefficient of Variation (CV) measurements for spiked samples

TABLE 2 ELISA detection of gamma-interferon in real samples

-a represents no detection.

The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> Fujian agriculture and forestry university

<120> gene engineering single-chain antibody strain capable of stably expressing anti-interferon gamma and application thereof

<130> 3

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 32

<212> DNA

<213> Artificial sequence

<400> 1

caagaattct gttactgcca ggacccatat gt 32

<210> 2

<211> 31

<212> DNA

<213> Artificial sequence

<400> 2

ttaaagcttc tgggatgctc ttcgacctcg a 31

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence

<400> 3

ccatgattac gccaagcttt ggagcc 26

Claims

1. A genetic engineering single-chain antibody strain capable of stably expressing interferon gamma is characterized in that: the antibody strain is Escherichia coli (E.coli)Escherichia coli) pET28a-mbp-linker-scFv-A8/BL21 has been preserved in China general microbiological culture Collection center (CGMCC) at 11/6 of 2017 with the preservation number of CGMCC No. 14860.

2. A single chain antibody secreted by the genetically engineered single chain antibody strain of claim 1.

3. The use of the single-chain antibody secreted by the genetically engineered single-chain antibody strain of claim 2 in the preparation of a kit for detecting IFN- γ and a detection card.

4. The use of the genetically engineered single chain antibody strain of claim 1 in the preparation of an immunoassay kit for the detection of IFN- γ.