CN110563839A

CN110563839A - Staphylococcus aureus enterotoxin B nano antibody B1, application and kit

Info

Publication number: CN110563839A
Application number: CN201910764200.7A
Authority: CN
Inventors: 王建龙; 季艳伟; 王妍入; 李想; 路云龙; 张敢为; 陈利莉
Original assignee: Northwest A&F University
Current assignee: Northwest A&F University
Priority date: 2019-08-19
Filing date: 2019-08-19
Publication date: 2019-12-13

Abstract

The invention discloses a staphylococcus aureus enterotoxin B nano antibody B1, application and a kit. The nano antibody obtained by the invention has the advantages of small relative molecular mass, strong stability, high yield, capability of specifically identifying SEB, wider application range and stronger specificity compared with the conventional monoclonal antibody. The invention discloses a nano antibody, a gene sequence for coding the nano antibody, a method for producing the nano antibody and a kit using the antibody. The nano antibody obtained by the invention can avoid being combined with the protein A on the surface of staphylococcus aureus, shows higher specificity, has good stability and small molecular weight, and can be produced in a large scale.

Description

Staphylococcus aureus enterotoxin B nano antibody B1, application and kit

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a staphylococcus aureus enterotoxin B nano antibody B1, application and a reagent.

background

Staphylococcus Aureus (SA) is a common food-borne pathogenic bacterium, and food poisoning caused by it is high in the first place in gram-positive bacteria, and its pathogenic ability mainly depends on enterotoxins (SEs) produced by the bacteria. SEs are soluble extracellular toxin proteins secreted by staphylococcus aureus, have similar structures, molecular weights of 27.5-30 kDa and good thermal stability, and are not damaged after being boiled for 30min at 100 ℃, so that after food polluted by the staphylococcus aureus is generally heated, bacterial thalli can be killed, but enterotoxins produced by the staphylococcus aureus still have activity and pathogenicity. Serologically classified, the SEB is mainly of serotypes A, B, Cs, D, E and the like, wherein the SEB is the most virulent and stable to heat in SEs families and mainly exists in animal foods with high protein content such as meat, milk and the like. When the intake of the SEB reaches 20-100 ng, poisoning symptoms such as nausea, vomiting, abdominal pain, diarrhea and the like can be caused to susceptible people, so that the SEB detection in the food is particularly important. However, there are two major problems with the detection of SEBs: firstly, the components of the food matrix are complex and contain a plurality of proteins, lipids and other compounds, and the existence of the components causes interference to the accurate detection of SEB; secondly, SA tends to produce only trace or trace amounts of SEB (ng/g) in food, which puts high demands on the sensitivity of the detection method. Achieving quantitative detection of enterotoxins in a food matrix has been a challenging task. Currently, the immunological detection method is widely applied to the rapid detection of SEs due to the characteristics of rapidness, strong specificity, simple and convenient operation, easy judgment of results and the like. The principle of the immunological detection method is that two antibodies which recognize two antigen sites on the surface of SEB form a sandwich structure in the presence of the SEB, and the detection result is interpreted by means of a marker on the detection antibody. Currently, staphylococcus aureus and enterotoxin antibodies thereof researched and prepared at home and abroad are polyclonal antibodies or monoclonal antibodies for recognizing surface antigens thereof, but the preparation of the traditional monoclonal antibody is time-consuming and labor-consuming and has low yield, and the interference of staphylococcus protein A (spA) is the most important problem in the immunological detection of SEs. SpA is a protein displayed on the cell surface of staphylococcus aureus and is also released externally and strongly combined with the Fc end of all IgG produced by mammals, so that an antibody for detecting staphylococcus aureus toxin can produce a false positive result, the accuracy of the method is poor, and the application value is influenced.

The nano antibody technology is developed and obtained by applying a molecular biology technology on the basis of the traditional antibody, and is the smallest known antibody molecule capable of combining with an antigen at present. Originally discovered in camelid blood by belgium scientist ham.r, the common antibody protein consists of two heavy chains and two light chains, while the novel antibodies found in camelid blood naturally lack the light chain and heavy chain constant region 1(CH1) heavy chain antibody, and the Variable region thereof is cloned to obtain a single domain antibody consisting of only one heavy chain Variable region, called single domain heavy chain antibody (VHH), also known as nanobody, Nb. Compared with polyclonal antibodies and monoclonal antibodies, the nano-antibody has the following advantages:

1) The Fc recognition site is not present, so that the problem of false positive caused by the combination with protein A can be avoided;

2) The long CDR3 region is provided, and the CDRs region and other self structural domains do not have a pair-wise complementary relationship, so that the antibody has more flexibility and convexity, and the small volume (12-15 kD, 2 multiplied by 4nm) can be better combined with cracks and cavities on the surface of an antigen, thereby improving the antigen specificity and affinity of the nano antibody, and having good affinity in a nanomole to picomole range. Within the same detection range, the affinity of the monovalent nanobody is twice that of the common bivalent antibody. Especially for bacteria or macromolecular proteins with complex surface structures, the nano antibody is beneficial to overcoming the steric effect of the surface structures and the surface antigen recognition.

3) The nano antibody has high stability and good water solubility, can be synthesized and expressed in a large amount in a microbial system, and creates conditions for the low-cost and high-efficiency production of the nano antibody.

4) the C end (C-terminal) of the nano antibody is positioned at the opposite part of the antigen binding site, so that the directional functional modification is easy to perform, and further the directional modification is performed. At present, the nano antibody aiming at SEB is not reported, so that the development of the nano antibody aiming at SEB with high affinity, high specificity and low cost is beneficial to further improving the sensitivity and specificity of SEB immunological detection so as to meet the requirement of on-site detection.

The invention adopts SEB to immunize Alxa bactrian camel, extracts RNA from peripheral blood lymphocytes of the immunized bactrian camel, and specifically amplifies camel single-chain antibody variable region genes, thereby constructing a nano antibody gene bank and analyzing the capacity and diversity of the bank. By using phage display technology, a nano antibody capable of being specifically combined with a target molecule (SEB) is screened from a nano antibody library, a nano antibody B1 expression vector is constructed, and prokaryotic expression, purification and identification are carried out on the expression vector, so that the required nano antibody B1 is obtained. And (3) establishing an ELISA detection method by adopting the nano antibody obtained by panning. The nano antibody prepared by the invention is used as a novel genetic engineering antibody, has strong antigen recognition capability due to the unique structural characteristics, and can be used for rapid and accurate SEB detection.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a staphylococcus aureus enterotoxin B nano antibody B1, application and a kit, and solves the technical problems of poor antibody specificity, high detection method cost and complex operation in the prior art.

in order to achieve the purpose, the technical scheme is as follows:

A staphylococcus aureus enterotoxin B nano antibody B1 comprises a framework region FR and a complementarity determining region CDR, wherein the framework region FR comprises amino acid sequences from FR1 to FR4,

wherein the amino acid sequence of FR1 is shown as SEQ ID NO. 2, the amino acid sequence of FR2 is shown as SEQ ID NO. 4, the amino acid sequence of FR3 is shown as SEQ ID NO. 6, and the amino acid sequence of FR4 is shown as SEQ ID NO. 8;

The CDRs include amino acid sequences of CDRs 1-3,

wherein the amino acid sequence of the CDR1 is shown as SEQ ID NO. 3, the amino acid sequence of the CDR2 is shown as SEQ ID NO. 5, and the amino acid sequence of the CDR3 is shown as SEQ ID NO. 7.

A staphylococcus aureus enterotoxin B nano antibody B1 is disclosed, wherein the amino acid sequence of the nano antibody B1 is shown in SEQ ID No. 1.

The nucleotide sequence of the coded staphylococcus aureus enterotoxin B nano antibody B1 is shown in SEQ ID No. 9.

a preparation method of a staphylococcus aureus enterotoxin A nano antibody A21 is characterized in that a nano antibody capable of being specifically combined with a target molecule SEB is screened from a camel source immune nano antibody library, and the nano antibody is prepared in a phage amplification or genetic engineering recombinant expression mode;

The phage amplification is to propagate and produce phage particles displaying the SEB nano antibody in a biological amplification mode by using phage displaying the anti-SEB nano antibody;

The gene engineering recombination expression mode refers to that the gene of the nano antibody is cloned to an expression vector to prepare the nano antibody in a protein expression mode.

The staphylococcus aureus enterotoxin B nano antibody B1 is applied to the immunological detection of staphylococcus aureus enterotoxin B.

The staphylococcus aureus enterotoxin B nano antibody B1 is used for preparing an application of a staphylococcus aureus enterotoxin B immunodetection kit.

An immunodetection kit for staphylococcal enterotoxin B, wherein the kit carries the staphylococcal enterotoxin B nano antibody B1.

Compared with the prior art, the invention has the beneficial technical effects that:

the nano antibody obtained by the invention has the advantages of small relative molecular mass, strong stability, high yield, capability of specifically recognizing SEB, wider application range and stronger specificity compared with the conventional monoclonal antibody.

The nano antibody obtained by the invention can avoid being combined with the surface protein A of staphylococcus aureus, shows higher specificity, has good stability and small molecular weight, and can be produced in a large scale.

(III) the nano antibody obtained by the invention can solve the problems of high cost, complex operation and poor specificity of the existing detection method, and has wide application prospect

Drawings

FIG. 1 is the direct ELISA identification of positive clones for panning, with clone B1OD being the largest;

FIG. 2 is a direct ELISA standard curve established with a Nanobody B1, the linear range is 3.9-1000 ng/mL, and the linear relationship is R²The lowest detection limit is 1.32ng/mL when the concentration is 0.99;

FIG. 3 is a specificity analysis of Nanobody B1;

Fig. 4 is an acid and alkali resistance analysis of nanobody B1;

Fig. 5 is a thermal stability analysis of nanobody B1;

The details of the present invention are explained in further detail below with reference to the drawings and examples.

Detailed Description

The following embodiments of the present invention are provided, and it should be noted that the present invention is not limited to the following embodiments, and all equivalent changes based on the technical solutions of the present invention are within the protection scope of the present invention.

The invention adopts SEB to immunize bactrian camel, and then uses the bactrian camel peripheral blood lymphocytes to establish a phage display nano antibody library aiming at staphylococcus aureus enterotoxin B. In the subsequent test, the staphylococcus aureus enterotoxin B is adsorbed on an enzyme label plate, and an immune nano antibody library is screened by utilizing a phage display technology, so that a specific nano antibody B1 aiming at the staphylococcus aureus enterotoxin B is obtained, and the specific nano antibody B1 has an amino acid sequence shown in SEQ ID NO. 1.

The nanobody of the present invention includes four Framework Regions (FRs) and three Complementarity-determining regions (CDRs). Wherein the framework regions (FR 1-FR 4) are respectively selected from SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6 and SEQ ID NO. 8, and the complementarity determining regions (CDR 1-CDR 3) are respectively selected from SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7. The structure of the framework region is relatively conserved, and the framework region mainly plays a role in maintaining the structure of the protein; the CDR structure is relatively diverse and is primarily responsible for antibody recognition.

The invention also relates to nucleotide for coding the amino acid sequence of the nano antibody, and the sequence is SEQ ID No. 9.

The nano-antibody can be prepared in a large scale by means of phage amplification or genetic engineering recombinant expression. The phage amplification refers to the mass propagation and production of phage particles displaying the nano antibody by a biological amplification mode of the phage displaying the nano antibody. The gene engineering recombination expression mode refers to that the gene coding the nano antibody is cloned to an expression vector to carry out mass preparation of the nano antibody in a protein expression mode.

the invention also relates to the application of the nano antibody in immunological detection. The types of immunological detection include enzyme-linked immunosorbent assay, colloidal gold immunochromatography, immunodot hybridization and other types of immunological analysis detection based on antigen-antibody specific reaction.

When the nano antibody is applied, the phage particles which are obtained by amplifying phage and display the nano antibody can be directly used for analysis and detection, and certainly, the nano antibody can also be subjected to immunological detection and analysis in the form of protein after being expressed by prokaryotes or eukaryotes.

The amino acid sequence can be used as a precursor, and can be modified by random or site-directed mutagenesis technology to obtain mutants with better properties (affinity, specificity, stability and the like).

Example 1 construction of camel-derived Nanobody phage display library

1) Immunization of Bactrian camels

SEB is used as immunogen to immunize adult male Alahan bactrian camel in a subcutaneous multi-point injection mode, and five rounds of immunization are carried out. The primary immunization was carried out by emulsifying Freund's complete adjuvant (Freund's complete adjuvant) with an equal volume of the immunizing antigen and injecting the mixture at an immunizing dose of 100. mu.g/mouse. The subsequent two-week booster immunization was carried out by emulsifying the same volume of immunogen with Freund's incomplete adjuvant (Freund's incomplete adjuvant) and injecting the mixture at a dose of 50. mu.g/mouse. And seventh day after the fifth boosting immunization, bactrian camel peripheral blood is adopted and used for constructing a nano antibody phage display library.

2) Isolation of lymphocytes

On day 7 after the last immunization, 200mL of peripheral blood was collected using a disposable plastic blood bag (containing anticoagulant) and the blood sample was diluted with an equal volume of PBS before use. The Ficoll-Paque PLUS lymphocyte separation medium is equilibrated to room temperature, 15mL of the solution is sucked and addedthe lymphocyte separation tube (with a porous partition) was centrifuged at 1000g for 30s at room temperature using a horizontal rotor centrifuge so that the lymphocyte separation solution was located just below the screen. The diluted blood sample is equilibrated to room temperature and added to a lymphocyte separation tube, 30 mL/piece, centrifuging for 10min at room temperature with 1000g of a horizontal rotor centrifuge, and adjusting the braking acceleration of the centrifuge to 0. And after centrifugation, the red blood cells are positioned at the bottom of the lymphocyte separation tube, the plasma is positioned on the uppermost layer, a layer of annular milky white substance between the plasma and the white transparent lymphocyte separation liquid is the lymphocytes, and the plasma on the upper layer is carefully removed by a dropper until the distance from the plasma to the cell layer is 5-10 mm. The lymphocytes were collected by pipette into another clean 50mL centrifuge tube, at least 10 volumes of ice-bath PBS was added, and after mixing by inversion, 250g was centrifuged at 4 ℃ for 10 min. The supernatant was discarded, the cells were resuspended in 45mL ice-bath PBS, 250g, centrifuged at 4 ℃ for 10min, and the cells were washed twice more in the same manner. After the final centrifugation, the cells were resuspended in 10mL ice-cooled PBS, counted on a hemacytometer, and then dispensed into 1.5mL centrifuge tubes at 1X 10⁷Centrifuging each cell/branch at 250g and 4 ℃ for 10min, discarding supernatant, and directly using cell precipitate for RNA extraction, or storing at-80 ℃ for later use.

3) Extraction of lymphocyte RNA

Adding 1mL of Trizol reagent into a centrifuge tube, blowing and beating lymphocyte agglomerates at the bottom of the centrifuge tube by using a liquid transfer device, and breaking up the lymphocyte agglomerates;

To the above lysate was added 1/5 volume of chloroform. The centrifuge tube cover is tightly covered, shaken vigorously for 15s, and kept stand at room temperature for 5 min. Centrifuging at 12000g for 10-15min at 4 deg.C. Carefully pipette the upper aqueous phase into a fresh centrifuge tube and add 1/2 volume of isopropanol. The mixture was inverted and left at room temperature for 10 min. Centrifuge at 12000g for 10min at 4 ℃. The supernatant was carefully discarded and an equal volume of 75% ethanol was added. Vortex to wash thoroughly and flick the bottom of the tube to suspend the precipitate. Centrifuge at 7500g for 5min at 4 ℃ and discard the supernatant. And (5) placing the mixture at room temperature and drying the mixture in air for 5-10 min. Adding 30-100 mu L of RNase-free water to dissolve RNA, taking a small amount of the RNA after the RNA is completely dissolved, and storing the rest solution at-70 ℃. Determination of OD of Total RNA₂₆₀And OD₂₆₀/OD₂₈₀and determining the concentration and quality of the total RNA.

4) Synthesis of cDNA and amplification of VHH Gene

Taking total RNA as a template, synthesizing cDNA by reverse transcription PCR through two-step reaction, and specifically comprising the following steps: preparing a reaction system according to a reverse transcription PCR system 1 (shown in table 1), reacting at 65 ℃ for 5min, and immediately carrying out ice bath; adding a reaction system prepared according to a reverse transcription PCR system 2 (shown in table 2) into the reaction liquid in the first step, wherein the reaction conditions are 42 ℃, 30min, 50 ℃, 60min, 70 ℃ and 15 min; and (5) freezing and storing the PCR product at-20 ℃ for later use.

TABLE 1 reverse transcription PCR System 1

TABLE 2 reverse transcription PCR System 2

PCR primers were designed according to the sequence of the Bactrian camel VHH upstream and downstream using Primer Premier 5.0 software and sent to the company for synthesis of primers, the sequence was as follows:

CALL001：GTCCTGGCTGCTCTTCTACAAGG

CALL002：GGTACGTGCTGTTGAACTGTTCC

VHH-FOR：5’-CATGCCATGACTGTGGCCCAGGCGGCCGAGTCTGGRGGAGG-3’

VHH-REV：5’-CATGCCATGACTCGCGGCCGGCCTGGCCGGAGACGGTGACCWGGGT-3’。

First round PCR:

Using cDNA as a template, and using primer CALL001 and primer CALL002 to perform a first round of PCR amplification, wherein the reaction system is a PCR system 3, and the details are shown in table 3:

TABLE 3 first round PCR System 3

reaction conditions are as follows: 95 deg.C, 5min, 95 deg.C, 30 s; 55 ℃, 30s, 72 ℃ and 45 s; 30 cycles; 72 deg.C, 10 min. Storing at 4 ℃. The PCR product is identified by 1.2% agarose gel electrophoresis, a target band near 700bp is cut off, the PCR product is recovered by a tapping recovery kit according to the operation steps of the instruction, and the concentration of the recovered product is measured for the next experiment.

Second round PCR: and (3) amplifying a VHH gene fragment by using primers VHH-FOR and VHH-REV by using a first round PCR gel recovered product (a band near 700 bp) as a template, wherein the reaction system is 4: see table 4 for details; reaction conditions are as follows: 98 deg.C, 10s, 55 deg.C, 15s, 72 deg.C, 30 s; 72 ℃, 10min, 30 cycles. The PCR product was electrophoresed through 1.5% agarose gel, the band of interest (around 400 bp) was excised, the PCR product was recovered using a gel recovery kit according to the protocol, and the concentration of the recovered product was determined for the next experiment.

TABLE 4 second round PCR System 4

5) construction and characterization of the library:

Digestion of vectors and inserts

The pHEN I phagemid vector and VHH fragment were digested overnight at 50 ℃ with Sfi I according to the restriction system of Table 5.

TABLE 5 Sfi I restriction enzyme reaction System

And (5) detecting whether the enzyme digestion is complete by agarose gel electrophoresis, and purifying and recovering the enzyme digestion product by adopting a DNA purification kit.

Ligation of vector and insert

Ligation reactions were performed according to the ligation system of Table 6, and negative and positive controls were set.

TABLE 6 ligation reaction System

reacting for 12 hours at 16 ℃; after adding 5. mu.L of 3M sodium acetate (pH5.2), 125. mu.L of cold absolute ethanol was added and left at-20 ℃ for 1 hour. Centrifuging at 4 deg.C at 10000g for 15min, and removing supernatant; washing the precipitate with 70% cold ethanol; centrifuging at 4 deg.C at 10000g for 5min, and removing supernatant; after vacuum drying, 20. mu.L of sterile water was resuspended, the pellet was quantitated and frozen at-20 ℃ for use.

electrotransformation of ligation products

add 5. mu.L of ligation product to 80. mu.L of competent cell E.coli TG1, mix well and let stand on ice for 1 min. Transferred into a 0.1cm cuvette for transformation by electric shock (voltage 1.8kV), 900. mu.L of LB medium was immediately added to the cuvette and cultured at 37 ℃ and 160rpm for 1 hour. Spreading the bacterial liquid on LB-AG plate, and culturing at 37 deg.C for overnight

Rescue of initial library

Cells with over 10 times the library size were seeded into 100mL of 2 XYT/amp/2% glucose and cultured to OD₆₀₀up to 0.5; adding helper phage (20: l multiplicity of infection), standing at 37 deg.C for 15min, and culturing at 220rpm for 45 min; centrifuging at 4 deg.C for 10min at 1000 g; discarding the supernatant, adding 100mL of fresh 2 XYT/amp/kan medium to resuspend the pellet, and incubating overnight at 30 ℃; centrifuging at 4 deg.C and 10000rpm for 10min, and collecting supernatant; adding 1/5 volume of PEG-NaCl solution, and standing at 4 ℃ for 3-4 h; centrifuging at 4 ℃ and 10000rpm for 15min, removing supernatant, and resuspending the precipitate with 1ml PBS; taking 10 μ L to determine the storage capacity, adding glycerol with the final concentration of 50% to the rest, and storing at-80 ℃.

Example 2: affinity panning and identification of Nanobodies

1) Affinity panning of the nano-antibody: first, SEB was diluted with PBS (pH7.4) to a final concentration of 50. mu.g/mL and coated overnight at 4 ℃. The following day, after washing 5 times with PBST (10mM PBS, 0.1% Tween-20(v/v)), 5% BSA-PBS (or 5% OVA-PBS) was added and blocked at 37 ℃ for 1 hour. Then washed 6 times with PBST, 100. mu.L of camelid single domain heavy chain antibody pool (titer about 2.0X 10) was added to each well¹¹cfu), incubated at 37 ℃ for 2 hours. Unbound phage were discarded, washed 10 times with PBST, eluted 8min with 100. mu.L of Glycine-HCl (0.2M, pH2.2), and immediately neutralized with 15. mu.L of Tris-HCl (1M, pH 9.1). Titer was determined by taking 10 μ L of eluted phage, and the remainder was used to infect 25mL of e.coli TG1 strain grown to log phase for amplification. On the third day, amplified phages were precipitated with PEG/NaCl and the titer of the phages was determined.

During the second, third and fourth panning rounds, the concentration of coated SEB was 25. mu.g/mL, 12.5. mu.g/mL and 6.25. mu.g/mL, respectively, and the number of PBST washes after incubation with phage was 12, 15 and 18, respectively, with the same procedure as above.

2) Identification of positive phage clones: randomly picking 50 clones from the plate for determining the phage titer after the third and fourth rounds of panning, amplifying the phage, and identifying positive phage clones by enzyme-linked immunosorbent assay. The specific method comprises the following steps: first, SEB was diluted to 500ng/mL with PBS (pH7.4) and coated overnight at 4 ℃. The following day after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 5% skim milk powder was added and blocked at 37 ℃ for 2 hours; discard blocking solution, wash with PBST 3 times, add 100. mu.L phage amplification solution (2.0X 10)¹¹cfu), using the original phage peptide library as a negative control, and incubating at 37 ℃ for 1 hour; adding 100 mu L of HRP-labeled anti-M13 phage secondary antibody diluted by 1:5000 times, and incubating for 1 hour at 37 ℃; adding 100 μ L TMB substrate solution, and developing in dark for 10 min; add 50. mu.L of stop solution (2M H)₂SO₄) Terminating the reaction; the absorbance at 450nm was measured with a microplate reader (Thermo Scientific Multiskan FC). Selection of OD₄₅₀Phage clones 2 times larger than the negative control were positive clones, and 23 strains of positive clones were obtained in total, which were B1-B3, B5-B7, B9-B19, B21-B28, and B30, respectively (shown in FIG. 1).

Example 3: sequencing of nano antibody coding gene and determination of amino acid sequence thereof

And (3) carrying out DNA sequencing on the B1 clone, and obtaining the amino acid sequence of the nano antibody according to the DNA sequencing result and a codon table.

Example 4: mass preparation of B1 nano antibody

(1) Preparation by phage amplification

The phage displaying the positive nanobody were added to 20mL of E.coli TG 1-inoculated culture, and cultured at 37 ℃ for 6h with shaking at 220 rpm. Transferring the culture into another centrifuge tube, centrifuging at 4 deg.C and 10000rpm for 10min, transferring the upper 80% of the supernatant into a fresh centrifuge tube, adding 1/6 volume of PEG/NaCl, standing at 4 deg.C for 120min, centrifuging at 4 deg.C and 10000rpm for 10min, and discarding the supernatant; the phage was washed with a small additional amount of PBS. Centrifuging at 4 ℃ and 10000rpm for 10min, discarding the supernatant, and adding 1mL PBS for resuspension to obtain the phage amplification solution.

(2) Preparation in the form of protein expression

The plasmid of the B1 clone was extracted and the recombinant expression vector was transformed into E.coli Top 10'. Selecting a single colony from a transformation plate, inoculating the single colony in 5mL LB liquid culture medium, carrying out shaking culture at 37 ℃ and 220r/min overnight, inoculating the overnight culture in 50mL LB/Amp and 2% glucose culture medium according to the inoculation amount (v/v), and carrying out shaking culture at 37 ℃ and 220 r/min; when the concentration of the cultured cells OD₆₀₀When the concentration reaches 0.5, adding 0.1mM IPTG into the culture, and carrying out shaking culture at 30 ℃ and 220r/min for 8-12 h; the culture was centrifuged at 8000rpm at 4 ℃ for 20min to collect the pellet. And (3) resuspending the cells in 5mL of precooled PBS solution, ultrasonically crushing for 10min, centrifuging at 8000rpm for 20min, taking the supernatant, and performing affinity chromatography purification on the supernatant to obtain the expressed nano antibody B1.

Example 5: establishment of a Standard Curve

The sensitivity is identified by adopting an ELISA method, and the specific method comprises the following steps: SEB was coated overnight with PBS (pH7.4) to 1000, 500, 250, 125, 62.5, 31.25, 15.625, 7.8125, 3.90625. mu.g/mL at 4 ℃; the following day, after washing 5 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; adding 100 mu L of 10 mu g/mL nano antibody B1, and incubating for 1 hour at 37 ℃; adding 100 mu L of HRP-labeled anti-His antibody diluted by 1:10000, and incubating for 1 hour at 37 ℃; adding 100 μ L TMB substrate solution, developing in dark for 10min, and measuring OD₄₅₀Drawing a standard curve (as shown in FIG. 2), wherein the linear range is 16.63-1000 ng/mL, and the linear relationship is R²The lowest detection limit is 5.91ng/mL, and the sensitivity is better.

Example 6 stability assessment of Nanobodies

(1) Experiment of pH stability

SEB was coated overnight with PBS (pH7.4) to 1000, 500, 250, 125, 62.5, 31.25, 15.625, 7.8125, 3.90625. mu.g/mL at 4 ℃; the following day after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; PBST (10mM PBS, 0.05% Tween-20(v/v)) 3 times washing; respectively using p as the nanobodyPBS dilution of H5.0, 6.0, 7.4, 8.0 and 9.0 to 10. mu.g/mL, incubation at 37 ℃ for 1 hour; adding 100 mu L of HRP-labeled anti-His antibody diluted by 1:10000, and incubating for 1 hour at 37 ℃; adding 100 μ L TMB substrate solution, developing in dark for 10min, and measuring OD₄₅₀Comparison of OD at different pH values₄₅₀And changing to obtain the acid and alkali resistance. The experimental result is shown in figure 3, and the result shows that the pH is 6-8, and the SC is₅₀the concentration of the half-saturation signal value has no significant difference, which shows that the nano antibody B1 has certain acid and alkali resistance stability.

(2) Heat resistance test

Coating: SEB was coated overnight with PBS (pH7.4) to 1000, 500, 250, 125, 62.5, 31.25, 15.625, 7.8125, 3.90625. mu.g/mL at 4 ℃; the following day after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; PBST (10mM PBS, 0.05% Tween-20(v/v)) 3 times washing; diluting the nano antibody to 10 mu g/mL by using PBS, respectively placing the diluted nano antibody in water baths at 37 ℃, 50 and 70 ℃ and 90 ℃ for 10min, recovering to room temperature, then respectively adding 100 mu L of the diluted nano antibody into the treated lath, and incubating for 1 hour at 37 ℃; adding 100 mu L of HRP-labeled anti-His antibody diluted by 1:10000, and incubating for 1 hour at 37 ℃; adding 100 μ L TMB substrate solution, developing in dark for 10min, and measuring OD₄₅₀. Comparing the absorbance values under different temperature treatment conditions to obtain the heat resistance of the nano antibody, wherein the result shows that the temperature is between 37 and 70 ℃, and the SC is₅₀No significant difference (concentration of half-saturation signal value) indicates that the nano antibody B1 has certain thermal stability.

Example 7: identification of specificity

The specificity identification of the positive nano antibody is carried out by adopting an ELISA method, which comprises the following steps: respectively diluting staphylococcus aureus enterotoxin B and staphylococcus aureus enterotoxin A to 500ng/mL by PBS (pH7.4), and respectively diluting staphylococcus aureus ATCC25923, staphylococcus aureus ATCC29213 and staphylococcus aureus ATCC26111 to 10⁷cfu/mL, 4 ℃ coating overnight; after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 300. mu.L of 3% skim milk powder was added and blocked at 37 ℃ for 1 hour; after 3 washes with PBST (10mM PBS, 0.05% Tween-20(v/v)), 100. mu.L of horseradish was addedThe conjugate of catalase and nano antibody is incubated for 1 hour at 37 ℃; after washing 3 times with PBST (10mM PBS, 0.05% Tween-20(v/v)), 100. mu.L of TMB substrate solution was added, and color development was carried out for 10min in the absence of light, and 50. mu.L of 2M H was added₂SO₄after the reaction was terminated with the stop solution, OD was measured₄₅₀. The results are shown in fig. 2, the B1 nano antibody has no cross reaction with staphylococcus aureus enterotoxin B, staphylococcus aureus ATCC25923, staphylococcus aureus ATCC29213 and staphylococcus aureus ATCC26111, which shows that the nano antibody B1 and staphylococcus aureus show no combination of protein A and show better specificity.

Nucleotide sequence list electronic file

<110> northwest agriculture and forestry science and technology university

<120> staphylococcus aureus enterotoxin B nano antibody B1, application and kit

<130> 2018

<160> 9

<170> PatentIn Version 3.5

<210> 1

<211> 122

<212> PRT

<213> Llama

<400> 1

Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu

1 5 10 15

Ser Cys Lys Val Ser Gly Phe Asn Phe Arg Glu His Ala Leu Ala

20 25 30

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ser Cys

35 40 45

Ile Arg Gly Ser Gly Asp Tyr Thr Thr Tyr Ala Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln Asn Thr Leu Tyr

65 70 75

Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Met Tyr Tyr

80 85 90

Cys Ala Ala Ala Arg Tyr Ala Arg Tyr Tyr Pro Asn Asn Cys Leu

95 100 105

Asp Ser Ala Glu Tyr Gly Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

110 115 120 122

<210> 2

<211> 20

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(20)

<223> FR1

<400> 2

Glu Ser Gly Gly Gly Ser Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Pro

1 5 10 15 20

<210>3

<211>10

<212> PRT

<213>Llama

<220>

<221> Domain

<222> (1)..(10)

<223> CDR1

<400>3

Gly Asp Thr Arg Ser Ser Gly Cys Val Gly

1 5 10

<210>4

<211> 16

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(16)

<223> FR2

<400>4

Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ala Thr Ile

1 5 10 15 16

<210>5

<211>10

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(10)

<223> CDR2

<400>5

Trp Arg Gly Asp Gly Thr Thr Tyr Tyr Ala

1 5 10

<210>6

<211>37

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(37)

<223>FR3

<400>6

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys

1 5 10 15

Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr

20 25 30

Ala Met Tyr Tyr Cys Ala Ala

35 37

<210>7

<211>19

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(19)

<223>CDR3

<400>7

Asp Pro Ala Thr Tyr Tyr Ala Cys Ser Tyr Arg Leu Asn His Gly

1 5 10 15

Leu Tyr Glu Tyr

19

<210>8

<211>10

<212> PRT

<213> Llama

<220>

<221> Domain

<222> (1)..(10)

<223>FR4

<400>8

Trp Gly Gln Gly Thr Gln Val Thr Val Ser

1 5 10

<210>9

<211>366

<212>DNA

<213> Llama

<400>8

gagtctggag gaggctcggt gcagcctgga gggtcgctga gactctcctg tgcagcccct 60

ggagatacga gaagtagcgg ctgcgtgggc tggttccgcc aggctccagg gaaggagcgc 120

gagggggtcg caactatttg gcgcggtgat ggtactacat actatgccga ctccgtgaag 180

ggccgattca ccatctccca agacaacgcc aagaacacgg tgtatctgca aatgaacagc 240

ctgaaacctg aggacactgc catgtactac tgtgcggcag atccggcgac atactatgct 300

tgtagttacc gccttaacca cgggttgtat gagtactggg gccaggggac ccaggtcacc 360

gtctcc 366

Claims

1. A staphylococcus aureus enterotoxin B nano antibody B1 is characterized by comprising a framework region FR and a complementarity determining region CDR, wherein the framework region FR comprises an amino acid sequence from FR1 to FR4,

The CDRs include amino acid sequences of CDRs 1-3,

2. a staphylococcus aureus enterotoxin B nano antibody B1 is characterized in that the amino acid sequence of the nano antibody B1 is shown in SEQ ID No. 1.

3. The staphylococcus aureus enterotoxin B nanobody B1 of claim 1, wherein the nucleotide sequence encoding the staphylococcus aureus enterotoxin B nanobody B1 is as shown in SEQ ID No. 9.

4. A preparation method of a staphylococcus aureus enterotoxin B nano antibody B1 is characterized in that a nano antibody capable of being specifically combined with a target molecule SEB is screened from a camel source immune nano antibody library, and the nano antibody is prepared in a phage amplification or genetic engineering recombinant expression mode;

5. The use of the nano antibody B1 for detecting the staphylococcal enterotoxin B according to any one of claims 1-4 in the immunological detection of the staphylococcal enterotoxin B.

6. the use of the staphylococcus aureus enterotoxin B nanobody B1 of any one of claims 1-4 in the preparation of a staphylococcus aureus enterotoxin B immunodetection kit.

7. An immune detection kit for staphylococcal enterotoxin B, which is characterized in that the kit carries the staphylococcal enterotoxin B nano antibody B1 of any claim 1-3.