CN115925913A - Nano antibody BC16 for specifically recognizing staphylococcus aureus enterotoxin B and C and application thereof - Google Patents

Abstract

The invention discloses a staphylococcus aureus enterotoxin B and C nano antibody BC16, application and a kit, and relates to the technical field of detection of staphylococcus aureus enterotoxin. The invention discloses an amino acid sequence of the nano antibody capable of specifically recognizing staphylococcus aureus enterotoxin B and C, a gene sequence for coding the nano antibody, a method for producing the nano antibody and a kit using the antibody. The nano antibody provided by the invention has small relative molecular mass, has wider application and stronger specificity compared with the conventional monoclonal antibody; can simultaneously identify staphylococcus aureus enterotoxin B and C, has better sensitivity, can avoid the combination with staphylococcus aureus surface protein A, provides core raw materials for establishing broad-spectrum immunological detection of staphylococcus aureus enterotoxin, and has wide application prospect.

Description

Nano antibody BC16 for specifically recognizing staphylococcus aureus enterotoxin B and C and application thereof

Technical Field

The invention relates to the technical field of detection of staphylococcus aureus enterotoxin, in particular to a nano antibody BC16 for specifically recognizing staphylococcus aureus enterotoxin B and C and application thereof.

Background

Staphylococcus Aureus (SA) is a common food-borne pathogenic bacterium, the incidence of food poisoning caused by it is high in the priority of gram-positive bacteria, and its pathogenic ability is mainly determined by enterotoxins (SEs) produced by the bacteria. SEs are soluble extracellular toxin proteins secreted by Staphylococcus aureus, which have similar structures and molecular weights of 27.5-30kDa. SEs are stable in property, have remarkable heat resistance and acid resistance, and are not damaged after being boiled for 30min at 100 ℃. Therefore, staphylococcus aureus-contaminated food can be killed by ordinary heat treatment, but the enterotoxin produced by staphylococcus aureus still has activity and pathogenicity, and can cause gastroenteritis, nausea, abdominal pain and spasm, sweating, shock and other symptoms after entering the digestive system of a human body, and the food poisoning phenomenon caused by SEs attracts wide attention of society. Serologically classifying, wherein serotypes A, B, cs, D, E and the like are mainly included; wherein, the SEB has the highest resistance to heat and the highest toxicity, and can cause the susceptible people to have poisoning symptoms when being ingested by 20-100 ng; SEC has certain immunotoxicity and is highly homologous with SEB. SEB and SEC are mainly present in animal foods with high protein content such as meat and milk. Therefore, the detection of SEB and SEC in food is particularly important.

The existing SEB and SEC detection has two main problems, one is that the components of the food matrix are complex and contain various proteins, lipids and other compounds, and the existence of the components causes interference to the accurate detection of the SEB and SEC; secondly, SA often only generates trace or trace SEB and SEC (ng/g) in food, which puts higher requirements on the sensitivity of the detection method. Therefore, achieving trace detection of enterotoxins in a food matrix has been a challenging task.

At present, the immunological detection method is widely applied to the rapid detection of SEs due to the characteristics of rapidness, strong specificity, simple and convenient operation, easy judgment of results and the like; the principle is that two antibodies capable of simultaneously recognizing two antigen sites on the surfaces of SEs form a sandwich structure in the presence of the SEs, and the detection result is interpreted by means of a marker on the detection antibody. Currently, staphylococcus aureus enterotoxin antibodies researched and prepared at home and abroad are all polyclonal antibodies or monoclonal antibodies, but the preparation of the traditional monoclonal antibody is time-consuming and labor-consuming and has low yield, and the interference of staphylococcus aureus Protein A (SpA) is the most important problem in the immunological detection of SEs. SpA is a cell surface displayed protein of staphylococcus aureus, also released externally, that strongly binds to the Fc-terminus of all IgG produced by mammals. Therefore, the antibody for detecting staphylococcus aureus toxin can generate a false positive result, so that the method has poor accuracy and influences the application value.

The nanobody (Nb) is developed and obtained by applying molecular biology technology on the basis of the traditional antibody, and is the smallest known antibody molecule capable of binding antigen. Nanobodies were originally found in camelid blood by the belgium scientist ham. While the common antibody proteins consist of two heavy chains and two light chains, a novel antibody found in camel blood naturally lacks a light chain and a heavy chain constant region 1 (CH 1) heavy chain antibody, and clones the Variable region thereof to obtain a single domain antibody consisting of only one heavy chain Variable region, which is called a single domain heavy chain antibody (VHH). Compared with polyclonal antibodies and monoclonal antibodies, the nano-antibody has the following advantages: (1) The Fc recognition site is not present, so that the problem of false positive caused by the combination with SpA can be avoided; (2) The long CDR3 region is provided, and the CDRs and other domains of the CDRs do not have a pair-wise complementary relationship, so that the double-stranded CDRs have more flexibility and convexity; and the small volume (15-20kDa, 2 multiplied by 4 nm) enables the nano-antibody to be better combined with cracks and gaps on the surface of the antigen, and the antigen specificity and affinity of the nano-antibody are improved. Within the same detection range, the affinity of the monovalent nanobody is twice that of the common bivalent antibody. Especially for bacteria or macromolecular proteins with complex surface structures, the nano antibody is beneficial to overcoming the steric effect of the surface structures and the surface antigen recognition; (3) The water solubility is good, and the nano antibody can be synthesized and expressed in a large amount in a microbial system, so that conditions are created for producing the nano antibody with low cost and high efficiency; (4) The C end (C-terminal) of the nano antibody is positioned at the opposite part of the antigen binding site, so that the directional functional modification is easy to perform, and further the directional modification is performed.

At present, the nano antibody aiming at SEB and SEC is not reported, so that the prepared nano antibody which can simultaneously recognize SEB and SEC and has high affinity, high specificity and low cost is beneficial to further improving the sensitivity and specificity of SEB and SEC immunological detection and is beneficial to constructing a staphylococcus aureus enterotoxin broad-spectrum immunological detection method so as to meet the requirements of accuracy and simultaneous detection.

Disclosure of Invention

Compared with the existing antibody which can only specifically recognize and combine staphylococcus aureus enterotoxin B (SEB) or staphylococcus aureus enterotoxin C (SEC), the invention creatively uses the SEB and the SEC to simultaneously immunize an animal body (such as bactrian camel), extracts corresponding RNA from peripheral blood lymphocytes, and obtains the nano antibody which can simultaneously recognize the SEB and the SEC in a specific way through multiple rounds of selection, and has higher sensitivity (the lowest detection limit of the SEB reaches about 12ng/mL and the lowest detection limit of the SEC reaches about 8 ng/mL), thereby solving the technical problems of poor antibody specificity aiming at the staphylococcus aureus enterotoxin B and C, high detection cost and complex operation in the prior art. Specifically, the following technique is used.

The nanobody BC16 specifically recognizing the staphylococcus aureus enterotoxins B and C comprises framework regions FR1, FR2, FR3 and FR4 and complementary determining regions CDR1, CDR2 and CDR3;

wherein, the amino acid sequence of FR1 is shown as SEQ ID NO.2, the amino acid sequence of FR2 is shown as SEQ ID NO.4, the amino acid sequence of FR3 is shown as SEQ ID NO.6, and the amino acid sequence of FR4 is shown as SEQ ID NO. 8;

the amino acid sequence of CDR1 is shown in SEQ ID NO.3, the amino acid sequence of CDR2 is shown in SEQ ID NO.5, and the amino acid sequence of CDR3 is shown in SEQ ID NO. 7.

Preferably, the amino acid sequence of the nanobody BC16 is shown in SEQ ID NO. 1.

Preferably, the nucleotide sequence encoding the nanobody BC16 is shown in SEQ ID No.9, or the nucleotide sequence having at least 95% homology with SEQ ID No. 9.

The invention also provides a preparation method of the nano antibody BC16 for specifically identifying the staphylococcus aureus enterotoxin B and C, which comprises the steps of screening the nano antibody which can be specifically combined with target molecules SEB and SEC from a camel source immune nano antibody library, and preparing the nano antibody by adopting a phage amplification or genetic engineering recombinant expression mode;

the phage amplification is to propagate and produce phage particles displaying anti-SEB and SEC nano antibodies in a biological amplification mode by using phage displaying anti-SEB and SEC nano antibodies;

the gene engineering recombinant expression mode refers to the preparation of the nano antibody in a protein expression form by cloning the gene of the nano antibody BC16 provided by the invention to an expression vector.

The nano antibody BC16 specifically recognizing the staphylococcus aureus enterotoxin B and C provided by the invention can be used for non-treatment and non-diagnosis purposes and can also be used for immunological detection of the staphylococcus aureus enterotoxin B and C for treatment and diagnosis purposes; or used for preparing a kit for immunodetection of staphylococcal enterotoxin B and staphylococcal enterotoxin C.

The immunoassay kit for specifically recognizing the staphylococcal enterotoxins B and C provided by the invention comprises any one of the nano antibodies BC16 provided by the invention.

Compared with the prior art, the invention has the advantages that:

(1) The nano antibody obtained by the invention has small molecular weight (about 15-20 kDa), high yield (up to 1.48 mg/mL), high sensitivity, high specificity identification of SEB and SEC, low limit of detection on SEB (up to about 12 ng/mL), and low limit of detection on SEC (up to about 8 ng/mL); compared with the conventional monoclonal antibody, the monoclonal antibody has wider application and stronger specificity;

(2) The nano antibody obtained by the invention can avoid being combined with the surface protein A of staphylococcus aureus, shows higher specificity and small molecular weight and can be produced in a large scale;

(3) The nano antibody obtained by the invention can solve the problems of high cost, complex operation and poor specificity of the existing detection method, and has wide application prospect.

Drawings

FIG. 1 shows the results of direct ELISA assay of panning positive clones in Experimental example 2;

FIG. 2 is an indirect ELISA standard curve established by phage display nano antibody BC16 to SEB, the linear range is 16-2048ng/mL, and the correlation coefficient is R ² =0.97, with a minimum detection limit of 12.55ng/mL;

FIG. 3 is an indirect ELISA standard curve established by phage display nano antibody BC16 against SEC, the linear range is 16-1024ng/mL, and the correlation coefficient is R ² =0.98, minimum detection limit is 7.84ng/mL;

FIG. 4 is an SDS-PAGE pattern of the nanobody BC16 of experimental example 4;

FIG. 5 shows the result of specificity analysis of the Nanobody BC16.

Detailed Description

The technical solutions of the present invention will be described clearly and completely below, and it should be apparent that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

In the following specific embodiment, SEB and SEC are adopted to immunize Alexan bactrian camel, RNA of the Alexan bactrian camel is extracted from peripheral blood lymphocytes of the immunized bactrian camel, and camel single-chain antibody variable region genes are specifically amplified, so that a nano antibody gene bank is constructed, and the bank capacity and diversity of the nano antibody gene bank are analyzed. By using a phage display technology, a nano antibody which can be specifically combined with target molecules (SEB and SEC) is screened from a nano antibody library, a nano antibody BC16 expression vector is constructed, and prokaryotic expression and identification are carried out on the nano antibody BC16 expression vector, so that the required nano antibody BC16 is obtained. And establishing an ELISA detection method by using the nano antibody obtained by panning. The nano antibody prepared by the invention is used as a novel genetic engineering antibody, has strong antigen recognition capability due to the unique structural characteristics, and can be used for rapid and accurate SEB and SEC detection.

In the following specific embodiment, SEB and SEC are used for immunizing bactrian camel, and then the bactrian camel peripheral blood lymphocytes are used for establishing a nano antibody phage display library aiming at staphylococcus aureus enterotoxin B and C. In the subsequent test, the staphylococcus aureus enterotoxins B and C are adsorbed on an enzyme label plate, and an immune nano antibody phage display library is screened by using a phage display technology, so that a nano antibody BC16 for specifically recognizing the staphylococcus aureus enterotoxins B and C is obtained, and the amino acid sequence of the nano antibody BC is shown in SEQ ID NO. 1. The nucleotide sequence of the coded nano antibody BC16 is shown in SEQ ID NO. 9.

In the following embodiments, reference to nanobodies includes four Framework Regions (FRs) and three complementary-determining regions (CDRs). Wherein, the amino acid sequences of the framework regions FR1-4 are respectively shown as SEQ ID NO.2, 4, 6 and 8, and the amino acid sequences of the complementarity determining regions CDR1-3 are respectively shown as SEQ ID NO.3, 5 and 7. The structure of the framework region is relatively conserved, and the framework region mainly plays a role in maintaining the structure of the protein; the CDR structure is relatively diverse and is primarily responsible for antibody recognition.

In the following embodiments, the nano antibody BC16 may be prepared in large quantities by means of phage amplification or recombinant expression by genetic engineering. The phage amplification refers to the mass propagation and production of phage particles displaying the nano antibody BC16 by using a biological amplification mode for the phage displaying the nano antibody BC16. The gene engineering recombinant expression mode refers to that the gene coding the nano antibody BC16 is cloned to an expression vector to carry out mass preparation of the nano antibody BC16 in a protein expression mode.

The following embodiments further relate to the application of the nanobody BC16 in immunological detection, and the types of immunological detection include enzyme-linked immunosorbent assay, colloidal gold immunochromatography, and immunodot hybridization, and the like, based on antigen-antibody specific reaction.

In the following embodiments, when the nanobody BC16 is applied, the phage particles displaying the nanobody BC16 obtained by phage amplification can be directly used for analysis and detection, and of course, the nanobody BC16 may be expressed by a prokaryote or a eukaryote and then subjected to immunological detection and analysis in the form of protein.

In the following embodiments, the amino acid sequence may be used as a precursor, and may be modified by random or site-directed mutagenesis techniques to obtain mutants with better properties (affinity, specificity, stability, etc.).

Experimental example 1: construction of camel-derived nano-antibody phage display library

1. Immunization of Bactrian camels

SEB and SEC are used as immunogen to immunize adult male Alxa bactrian camel in a subcutaneous multi-point injection mode, and five rounds of immunization are carried out. The primary immunization was carried out by emulsifying Freund's complete adjuvant (Freund's complete adjuvant) with an equal volume of immunizing antigen and injecting the mixture at an immunizing dose of 100. Mu.g/mouse. The subsequent two-week booster immunization was carried out by emulsifying the same volume of immunogen with Freund's incomplete adjuvant (Freund's incomplete adjuvant) and injecting the mixture at a dose of 50. Mu.g/mouse.

2. Isolation of isolated lymphocytes

On the seventh day after the completion of the fifth booster immunization of bactrian camels, an additional 200mL of bactrian camel peripheral blood was collected with a disposable plastic blood bag (containing an anticoagulant) and the blood sample was diluted with an equal volume of PBS prior to use. The Ficoll-Paque PLUS lymphocyte separation solution is balanced to room temperature, 15mL of the lymphocyte separation solution is sucked and added into a lymphocyte separation tube (with a porous partition plate), and 1000g of the lymphocyte separation solution is centrifuged for 30s at room temperature by a horizontal rotor centrifuge, so that the lymphocyte separation solution is just below a screen mesh.

And then balancing the diluted blood sample to room temperature, adding 30 mL/branch lymphocyte separation tubes, centrifuging for 10min at room temperature by using a horizontal rotor centrifuge 1000g, and adjusting the braking acceleration of the centrifuge to 0. After centrifugation, the red blood cells are positioned at the bottom of the lymphocyte separation tube, the plasma is positioned at the uppermost layer, a layer of annular milky white substance between the plasma and the white transparent lymphocyte separation liquid is the lymphocytes, and the plasma at the upper layer is carefully removed by a dropper until the distance from the cell layer is 5-10mm.

Collecting lymphocytes by using a dropper, putting the lymphocytes into another clean 50mL centrifuge tube, adding PBS with 10 times volume of ice bath, reversing, uniformly mixing, centrifuging for 10min at 250g and 4 ℃, and removing supernatant; the cells were resuspended in 45mL ice-cooled PBS, centrifuged at 250g, 4 ℃ for 10min, and the procedure was repeated three times to complete the cell wash.

After washing, the cells were resuspended in 10mL ice-cooled PBS, counted on a hemocytometer, and then dispensed into 1.5mL centrifuge tubes at 1X 10 ⁷ Individual cells/branch; centrifuging at 4 deg.C for 10min at 250g, discarding supernatant, and directly extracting lymphocyte RNA from the obtained cell precipitate (or storing at-80 deg.C for use).

3. Extraction of lymphocyte RNA

Adding 1mL of Trizol reagent into a centrifuge tube which is subpackaged with lymphocytes, blowing lymphocyte agglomerates at the bottom of the centrifuge tube by using a liquid transfer device, and scattering the lymphocyte agglomerates; adding 1/5 volume of chloroform into the lysate, covering a centrifugal tube cover tightly, shaking violently for 15s, and standing at room temperature for 5min; centrifuging at 12000g for 10-15min at 4 deg.C, carefully sucking the upper water phase into a new centrifuge tube, adding 1/2 volume of isopropanol, mixing, and standing at room temperature for 10min; centrifuging at 12000g for 10min at 4 ℃. Carefully discard the supernatant and add an equal volume of 75% ethanol; fully washing by vortex, and flicking the bottom of the tube to suspend the precipitate; centrifuging at 7500g for 5min at 4 deg.C, and discarding the supernatant; air-drying at room temperature for 5-10min. Adding 30-100 μ L RNase-free water to dissolve RNA, taking a small amount of solution after complete dissolution, and storing the rest solution at-70 deg.C. Determining the OD260 and OD260/OD280 of the total RNA of the lymphocytes, and determining the concentration and the quality of the total RNA.

4. Synthesis of cDNA and amplification of VHH Gene

(1) Synthesis of cDNA

Taking total RNA of lymphocytes as a template and oligo (dT) as a primer to synthesize cDNA by two-step reaction by adopting reverse transcription PCR, and the method comprises the following steps: preparing a reaction system according to a reverse transcription PCR system 1 (shown in the following table 1), reacting at 65 ℃ for 5min, and immediately performing ice bath; then adding into a reaction system prepared according to a reverse transcription PCR system 2 (shown in the following table 2), wherein the reaction conditions are 42 ℃,30min,50 ℃,60min,70 ℃, and 15min; the PCR product, i.e., cDNA, was obtained and stored frozen at-20 ℃ until use.

TABLE 1 reverse transcription PCR System 1

Reagent	Reagent Volum(μL)
		d NTP Mixture(10m M each)	3.0
Oligo dT Primer(2.5μM)	3.0
		Total RNA X	＜15μg
RNase-Free dH 2 O	Up to 30μL

TABLE 2 reverse transcription PCR System 2

Reagent	Reagent Volum(μL)
		Systeml	10
5×Prime Script Buffer	4.0
		RNA Inhibitor(40U/μL)	0.5
Prime Script RTase(for 2step)	0.5
		dH 2 O	Up to 20μL

(2) Amplification of VHH genes

Designing PCR primers by using Primer Premier 5.0 software according to upstream and downstream sequences of the bactrian camel VHH gene, and sending the PCR primers to a company for synthesizing the primers, wherein the sequences are as follows:

primer CALL001: GTCCTGGCTGTCTTCTACAAGG;

primer CALL002: GGTACGTGCTGAACTGTTCC;

forward primer VHH-FOR:

5’-CATGCCATGACTGTGGCCCAGGCGGCCGAGTCTGGRGGAGG-3’

reverse primer VHH-REV:

5’-CATGCCATGACTCGCGGCCGGCCTGGCCGGAGACGGTGACCWGGGT-3’。

(1) first round PCR

cDNA is used as a template, the primer CALL001 and the primer CALL002 are used for carrying out the first round of PCR amplification, the reaction system is a PCR system 3, and the details are shown in the following table 3.

TABLE 3 first round PCR System 3

Reaction conditions are as follows: 95 deg.C, 5min,95 deg.C, 30s,55 deg.C, 30s,72 deg.C, 45s,30 cycles; 72 deg.C, 10min. Storing at 4 deg.C. The PCR product is identified by 1.2% agarose gel electrophoresis, a target band near 700bp is cut off, the PCR product is recovered by a gel cutting recovery kit according to the operation steps of the instruction, and the concentration of the recovered product is measured for the next experiment.

(2) Second round PCR

The VHH gene fragment was amplified using the recovered product of the first round PCR gel (band around 700 bp) as a template and the above forward primer VHH-FOR and reverse primer VHH-REV, and the reaction system 4 is detailed in Table 4 below.

TABLE 4 second round PCR System 4

Reagent	Reagent Volum(μL)
		5×Prime STAR Buffer	5.0
d NTP Mixture(10mM each)	2.0
		Prime F(10μM)	1.0
Prime R(10μM)	1.0
		Prime STAR(2.5U/μL)	0.25
Template	X
		RNase-Free dH 2 O	Up to 25μL

Reaction conditions are as follows: 98 deg.C, 10s,55 deg.C, 15s,72 deg.C, 30s;72 ℃, 10min,30 cycles. The PCR product was electrophoresed through 1.5% agarose gel, a band of interest (about 400 bp) was excised, the PCR product was recovered with a gel recovery kit according to the instructions and the concentration of the recovered product was determined for the next experiment.

5. Construction of vectors

(1) Digestion of vectors and inserts

The pHEN I phagemid vector and VHH fragment were digested overnight at 50 ℃ with Sfi I following the digestion system of Table 5 below.

TABLE 5 Sfi I enzyme digestion reaction System

Reagent	Reagent Volum(μL)
		10×M Buffer	10.0
Sfi I	5.0
		pHEN I or VHH	X(～10μg)
RNase-Free dH 2 O	Up to 100μL

Detecting whether the enzyme digestion is complete by using agarose gel electrophoresis, and purifying and recovering the enzyme digestion product by using a DNA purification kit.

(2) Ligation of vector and insert

Ligation reactions were performed according to the ligation system of Table 6 below, with negative and positive controls being set.

TABLE 6 ligation reaction System

Regent	Test group	NC	PC
				vector/Sfi I	200.0ng	200.0ng	200.0ng
Insert	20-100ng
				10*Ligase Buffer	5μL	5μL	5μL
Ligase	0.5μL	0.5μL	0.5μL
				dH 2 O	Up to 50μL	Up to 50μL	Up to 50μL

Reacting for 12 hours at 16 ℃; after addition of 5 μ L of 3M sodium acetate (pH = 5.2), 125 μ L of cold absolute ethanol was added and left at-20 ℃ for 1h; centrifuging at 4 deg.C and 10000g for 15min, and discarding supernatant; washing the precipitate with 70% cold ethanol; centrifuging at 4 deg.C and 10000g for 5min, and removing supernatant; after vacuum drying, 20. Mu.L of sterile water was resuspended, the pellet was quantitated and frozen at-20 ℃ for use.

(3) Electrotransformation of ligation products

Add 5. Mu.L of ligation product to 80. Mu.L of competent cell E.coli TG1, mix well and let stand on ice for 1min. Transferring into 0.1cm electric shock cup, performing electric shock transformation (voltage is 1.8 kV), immediately adding 900 μ L LB culture medium into the electric shock cup, culturing at 37 deg.C and 160rpm for 1h; the bacterial liquid was spread on LB-AG plates and cultured in an inverted state at 37 ℃ overnight.

6. Construction of camel-derived nanobody phage display library

Inoculating cells with over 10 times of library volume into 100mL of 2 XYT/amp/2% glucose, and culturing to OD ₆₀₀ Up to 0.5; adding helper phage (20 l multiplicity of infection), standing at 37 deg.C for 15min, and culturing at 220rpm for 45min; centrifuging at 1000g for 10min at 4 deg.C; discarding the supernatant, adding 100mL of fresh 2 XYT/amp/kana medium to resuspend the pellet, and incubating overnight at 30 ℃; centrifuging at 4 deg.C and 10000rpm for 10min, and collecting supernatant; adding 1/5 volume of PEG-NaCl solution, and standing at 4 deg.C for 3-4h; centrifuging at 10000rpm for 15min at 4 deg.C; discarding the supernatant, taking the precipitate, and resuspending the precipitate with 1mL of PBS; taking 10 μ L to measure the storage capacity, adding glycerol with the final concentration of 50%, and storing at-80 deg.C.

Experimental example 2: affinity panning and identification of Nanobodies

1. Affinity panning of Nanobodies

SEB was first diluted with PBS (pH = 7.4) to a final concentration of 10 μ g/mL, coated overnight at 4 ℃; the following day, after 5 washes with PBST (10mM PBS,0.1% (v/v) Tween-20), 5% BSA-PBS (or 5% OVA-PBS) was added and blocked at 37 ℃ for 1h; then, the phage display library was washed 6 times with PBST, and 100. Mu.L of the nanobody phage display library constructed in Experimental example 1 (titer about 2.0X 10) was added to each well ¹¹ cfu), incubating for 2h at 37 ℃; unbound phage were discarded, washed 10 times with PBST, eluted for 8min with 100. Mu.L of Glycine-HCl (0.2M, pH = 2.2), and immediately neutralized with 15. Mu.L of Tris-HCl (1M, pH = 9.1). Titer was determined by taking 10 μ L of eluted phage, and the remainder was used to infect 25mL of e.coli TG1 strain grown to log phase for amplification. On the third day, amplified phages were precipitated with PEG/NaCl and the titer of the phages was determined.

During the second and third rounds of panning, the plates were coated with 10. Mu.g/mL SEC, SEB and SEC mixture, respectively, and the rest of the procedure was as above.

2. Identification of Positive phage clones

Randomly picking 50 clones from a plate for determining the titer of the phage after each round of panning, amplifying the phage, and identifying positive phage clones by adopting an enzyme-linked immunosorbent assay method. The specific method is as follows.

SEB, SEC diluted to 500ng/mL with PBS (pH = 7.4) and coated overnight at 4 ℃; the next day, after washing 3 times with PBST (10mM PBS,0.1% (v/v) Tween-20), 350. Mu.L of 5% skim milk powder was added, and blocking was performed at 37 ℃ for 2 hours; discard the blocking solution, wash with PBST 3 times, addAdd 100. Mu.L phage amplification medium (2.0X 10) ¹¹ cfu), with PBS as negative control, incubated for 1h at 37 ℃; adding 100 mu L of HRP-labeled anti-M13 phage secondary antibody diluted by 1 times of 50000, and incubating for 1h at 37 ℃; adding 100 μ L TMB substrate solution, and developing in dark for 10min; add 50. Mu.L of stop solution (2M H) ₂ SO ₄ Solution) to terminate the reaction; the absorbance at 450nm was measured with a microplate reader (Thermo Scientific Multiskan FC), and the results are shown in FIG. 1. Selection of OD ₄₅₀ Phage clones which are 3 times larger than the negative control are positive clones, and 21 strains of positive clones are obtained in total and are respectively as follows: clone BC4, clone BC6, clone BC9, clone BC10, clone BC14, clone BC16, clone BC25, clone BC32, clone BC35, clone BC38, clone BC41, clone BC43, clone BC48, clone BC51, clone BC52, clone BC56, clone BC60, clone BC64, clone BC67, clone BC68, clone BC71.

Experimental example 3: screening of nano antibody, sequencing of nano antibody coding gene and determination of amino acid sequence thereof

The sensitivity of 21 positive clones of experiment example 2 was determined by ELISA, and the specific determination method for the sensitivity of each positive clone was: SEB and SEC standards were diluted to 2048, 1024, 512, 256, 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125ng/mL with PBS (pH = 7.4), respectively, coated overnight at 4 ℃; the next day, after washing 3 times with PBST (10mM PBS,0.1% (v/v) Tween-20), 350. Mu.L of 5% skim milk powder was added, and blocking was performed at 37 ℃ for 2 hours; adding 100 mu L of 10 mu g/mL phage-displayed nano antibody BC16, and incubating at 37 ℃ for 45min; adding 100 mu L of HRP-labeled anti-M13 antibody diluted by 1; adding 100 μ L TMB substrate solution, developing in dark for 15min, adding 50 μ L2M H ₂ SO ₄ Stop solution, OD measurement ₄₅₀ And drawing a standard curve.

By comparing the standard curve and the correlation coefficient of 21 positive clones, clone BC16 with the best sensitivity is finally selected. The standard curves for Clone BC16 for SEB and SEC are shown in FIGS. 2 and 3, respectively. As can be seen from the figure, the linear range of the nanometer antibody BC16 to SEB is 16-2048ng/mL, and the correlation coefficient is R ² =0.97, with a minimum detection limit of 12.55ng/mL; linearity to SECThe range is 16-1024ng/mL, and the linear relation is R ² =0.98, with a minimum detection limit of 7.84ng/mL; it can be seen that the nanometer antibody BC16 has higher sensitivity to SEB and SEC.

Performing DNA sequencing on Clone BC16 Clone, wherein the nucleotide sequence is shown as SEQ ID NO. 9; the amino acid sequence of the nano antibody can be obtained according to the DNA sequencing result and the codon table, and is shown as SEQ ID NO. 1.

Experimental example 4: preparation of BC16 nano antibody

1. Preparation by phage amplification

Adding the phage displaying the positive nano antibody BC16 into 20mL of culture inoculated with E.coli TG1, and carrying out shake culture at 37 ℃ and 220rpm for 6h; transferring the culture into another centrifuge tube, centrifuging at 4 deg.C and 10000rpm for 10min, transferring the supernatant into a fresh centrifuge tube, adding 1/5 volume of PEG/NaCl, standing at 4 deg.C for 120min, centrifuging at 4 deg.C and 10000rpm for 10min, and discarding the supernatant; then adding a small amount of PBS to clean the phage; centrifuging at 4 ℃ and 10000rpm for 10min, discarding the supernatant, adding 1mL PBS for resuspension to obtain the phage-displayed nano antibody, and reserving 10 mu L for titer determination.

2. Preparation in the form of protein expression

Extracting the plasmid cloned by BC16, and transferring the recombinant expression vector into escherichia coli Top10'; selecting a single colony from a transformation plate, inoculating the single colony in 5mL LB liquid culture medium, carrying out shaking culture at 37 ℃ and 220rpm overnight, inoculating the overnight culture in 50mL LB/Amp and 2% glucose culture medium according to the inoculation amount of 1% (v/v), and carrying out shaking culture at 37 ℃ and 220 rpm; when the concentration of the cultured cells OD ₆₀₀ When the concentration reached 0.5, 0.1mM IPTG was added to the culture, and the mixture was subjected to shaking culture at 30 ℃ and 220rpm for 11 hours; the culture was centrifuged at 7000rpm at 4 ℃ for 20min to collect the pellet. Resuspending the cells in 4mL of cell lysate, standing for 15min, centrifuging at 8000rpm for 20min, and collecting the supernatant to obtain the expressed nano antibody BC16 (the SDS-PAGE result is shown in FIG. 4). In fig. 4, a dark band near 14.4 on the right side is a band containing nanobody BC16.

Experimental example 5: specificity identification of Nanobody BC16

Method for carrying out nano antibody by adopting ELISA (enzyme-linked immunosorbent assay)The specific method for identifying the opposite sex comprises the following steps: respectively diluting staphylococcus aureus enterotoxin A, staphylococcus aureus enterotoxin B and staphylococcus aureus enterotoxin C to 500ng/mL by PBS (pH = 7.4), and coating overnight at 4 ℃; after washing 3 times with PBST (10 mM PBS,0.1% (v/v) Tween-20), 350. Mu.L of 5% skim milk powder was added and blocked at 37 ℃ for 2h; after washing 3 times with PBST (10 mM PBS,0.1% (v/v) Tween-20), 100. Mu.L of phage amplification solution of Nanobody BC16 was added and incubated at 37 ℃ for 45min; after washing 3 times with PBST (10 mM PBS,0.1% (v/v) Tween-20), 100. Mu.L of TMB substrate solution was added, and color development was carried out in the dark for 10min, and 50. Mu.L of 2M H was added ₂ SO ₄ After the reaction was terminated with the stop solution, OD was measured ₄₅₀ . The results are shown in fig. 5, and the nano antibody BC16 has better specificity to staphylococcus aureus enterotoxin B and staphylococcus aureus enterotoxin C.

The practice of the present invention has been described in detail in the foregoing detailed description, however, the present invention is not limited to the specific details in the foregoing embodiment. Within the scope of the claims and the technical idea of the invention, a number of simple modifications and changes can be made to the technical solution of the invention, and these simple modifications are within the scope of protection of the invention.

Claims (7)

1. The nanobody BC16 for specifically recognizing the staphylococcus aureus enterotoxins B and C is characterized by comprising framework regions FR1, FR2, FR3 and FR4 and complementary determining regions CDR1, CDR2 and CDR3;

wherein, the amino acid sequence of FR1 is shown as SEQ ID NO.2, the amino acid sequence of FR2 is shown as SEQ ID NO.4, the amino acid sequence of FR3 is shown as SEQ ID NO.6, and the amino acid sequence of FR4 is shown as SEQ ID NO. 8;

the amino acid sequence of CDR1 is shown in SEQ ID NO.3, the amino acid sequence of CDR2 is shown in SEQ ID NO.5, and the amino acid sequence of CDR3 is shown in SEQ ID NO. 7.

2. The nanobody BC16 capable of specifically recognizing staphylococcus aureus enterotoxin B and C according to claim 1, wherein the amino acid sequence of said nanobody BC16 is shown in SEQ ID No. 1.

3. The nanobody BC16 capable of specifically recognizing staphylococcus aureus enterotoxin B and C according to claim 2, wherein the nucleotide sequence encoding the nanobody BC16 is shown in SEQ ID No.9 or the nucleotide sequence having at least 95% homology with SEQ ID No. 9.

4. The method for preparing the nano-antibody BC16 capable of specifically recognizing the staphylococcal enterotoxins B and C according to any one of claims 1 to 3, wherein the nano-antibody which can be specifically combined with the target molecules SEB and SEC is screened from a camel source immune nano-antibody library, and is prepared by adopting a phage amplification or genetic engineering recombinant expression mode;

the phage amplification is to propagate and produce phage particles displaying the anti-SEB and SEC nano antibodies in a biological amplification mode by using phage displaying the anti-SEB and SEC nano antibodies;

the gene engineering recombinant expression mode is to clone the gene of the nano antibody BC16 of any one of claims 1 to 3 into an expression vector to prepare the nano antibody in a protein expression mode.

5. Use of the nanobody BC16 specifically recognizing staphylococcal enterotoxins B, C of any of claims 1-3 in the immunological detection of staphylococcal enterotoxins B, C for non-diagnostic and therapeutic purposes.

6. Use of the nanobody BC16 specifically recognizing staphylococcus aureus enterotoxin B and C as claimed in any one of claims 1 to 3 in preparation of a kit for immunodetection of staphylococcus aureus enterotoxin B and C.

7. An immunoassay kit for specifically recognizing staphylococcus aureus enterotoxin B and C, which is characterized in that the kit comprises the nanobody BC16 of any one of claims 1 to 3.

Images