CN107402304A - One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method - Google Patents
One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method Download PDFInfo
- Publication number
- CN107402304A CN107402304A CN201710495241.1A CN201710495241A CN107402304A CN 107402304 A CN107402304 A CN 107402304A CN 201710495241 A CN201710495241 A CN 201710495241A CN 107402304 A CN107402304 A CN 107402304A
- Authority
- CN
- China
- Prior art keywords
- mip
- labels
- miscarriage
- sandwich elisa
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56927—Chlamydia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/295—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Chlamydiales (o)
Abstract
One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method, it is characterized in that, the MIP recombinant proteins without His labels are marked as envelope antigen using with S, using the antibody of His labels marked with MIP recombinant protein of the His labels without S labels as instruction antigen and HRP, anti-, the double antigens sandwich ELISA detections of animal blood serum miscarriage chlamydial antibody are carried out.The miscarriage chlamydial antibody double antigens sandwich ELISA detection method of the present invention can reduce false positive rate, improve detection specificity.
Description
Technical field
The present invention relates to one kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method, and in particular to one kind is with MIP
The miscarriage chlamydial antibody double antigens sandwich ELISA detection method that expressing protein is established.
Background technology
Preferendum Chlamydia (Chlamydophila abortus) of miscarrying is a kind of entozoic Gram's staining of special sexual cell
Negative germs, belong to a member of Chlamydiaceae (Chlamydiaceae) preferendum chlamydiaceae (Chlamydophila),
With extensive host's preferendum, main parasitic causes in the epithelial cell of many animals genital tract mucous membrane surface such as pig, ox, sheep
Reproduction mucous membrane is damaged, and causes the Chronic exposure miscarried with dam, stillborn foetus, weak tire, male animal orchitis, posthitis etc. are characterized
Infectious disease, while the mankind can be also infected, cause pregnant woman to miscarry, be a kind of important Amphixenosis's cause of disease.In recent years, flow
It is more serious in China's prevalence to produce preferendum Chlamydia, especially milk cow, yak, sheep, goat, pig etc., seriously hinder milk cow
The further development of industry, Yak production etc., and cause huge economic loss.In addition, as a kind of Amphixenosis, stream
Production preferendum Chlamydia not only causes the conjunctivitis of people, and causes pregnant woman to miscarry.Therefore, timely, discovery Chlamydia early, and
Using sensitive, special diagnostic method, in Accurate Diagnosis animal miscarriage preferendum chlamydiosis, there is provided science bridle miscarriage preferendum clothing
The diagnosis basis of substance disease, promotes aquaculture to develop in a healthy way, guarantee food security, particularly heavy in terms of protection people's health
Will.
For many years, mainly there is indirect hemagglutination diagnostic test for the serological diagnostic method for preferendum Chlamydia of miscarrying both at home and abroad
(IHA) and complement fixation test (CFT) (CFT), but both approaches are respectively provided with low sensitivity, poor specificity, result judge subjectivity
The features such as strong and unsuitable mass detection, limit their extensive uses in clinic.In recent years, domestic and foreign scholars for
EUSA (ELISA) antibody detection method is studied, and is made some progress.Such as prior art
It is to recombinate Chlamydia that CN201110367644.0, which discloses a kind of ELISA kit for detecting swine Chlamydophila abortus antibody,
Major outer membrane protein rMOMP is envelope antigen, and in the prior art to recombinate polymorphism outer membrane protein POMP as envelope antigen
The swine Chlamydophila abortus disease indirect ELISA antibody detection method of foundation, but these prior arts are to be directed to specific one
The ELISA antibody indirects detection method or kit of kind animal exploitation, narrow application range, without versatility, are not used to more
The Chlamydia checkout and diagnosis of kind animal, use cost are higher, it is difficult to popularize；MOMP simultaneously, POMP expressing protein are mainly with bag
Contain body form to exist, also need after denaturation is dissolved, carry out the troublesome operation of renaturation, recombinant protein is folded into native conformation shape
State, recover its bioactivity.
At present, also not on chlamydial antibody double antigens sandwich ELISA detection method of miscarrying, and dual-antigen sandwich method
Usually it can cause non-specificity due to some interference materials in the factors such as reagent, material, environment, particularly testing sample
With reference to causing have a certain degree of false positive, have impact on the confidence level of testing result.Therefore, dual-antigen sandwich method testing goal
During antibody, background is too high and false positive rate height is an insoluble problem all the time.Therefore, seek a kind of dual anti-former folder of reduction
The background of heart method and false positive rate, the specific method for improving detection is trend of the times.
The content of the invention
The technical problem to be solved by the invention is to provide one kind to reduce false positive rate, improves and detects specific miscarriage clothing
Mycoplasma antibody double antigens sandwich ELISA detection method.
The present invention solves the technical scheme that technical problem uses, one kind miscarriage chlamydial antibody double antigens sandwich ELISA
Detection method, the MIP recombinant proteins without His labels are marked as envelope antigen using with S, with His labels without S labels
MIP recombinant proteins as instruction antigen and HRP marks, anti-His labels antibody, carry out animal blood serum miscarriage Chlamydia and resist
The double antigens sandwich ELISA detections of body.
Further, the double antigens sandwich ELISA reaction conditions are the bag of the MIP recombinant proteins with His labels respectively
It is 0.2 μ g/ holes by concentration, serum dilution 1:100, HRP mark the MIP recombinant protein dilution factors with His labels be
1:5000, confining liquid is 5% gelatin, and test serum and the MIP recombinant proteins with His labels react 45min, bottom in 37 DEG C
Thing is in color development at room temperature time 20min.
Further, the MIP recombinant proteins of the His labels of the HRP marks are enzyme-labelled antigen.
Further, the double antigens sandwich ELISA detects that negative and positive critical point is 0.261.
Further, the MIP recombinant proteins with His labels are built-up by following steps：
(1) the coding gene sequence amplification of miscarriage preferendum Chlamydia MIP albumen：Using Chlamydia SX5 genomes of miscarrying as mould
Plate, design the primer such as SED ID NO of the instruction antigen MIP GFPs containing His labels：3 and SED ID NO：Shown in 4；
Amplify containing His label Macrophage infection potentiator genes, the recovery and purifying for carrying out pcr amplification product are contained
The encoding gene of the miscarriage preferendum Chlamydia MIP albumen of His labels；
(2) recombinant vector pET-30a (+)-mip structure：It will be contained by NdeI enzymes, XhoI enzymes double digestion, connection, conversion
The encoding gene for having the miscarriage preferendum Chlamydia MIP albumen of His labels inserts expression vector pET-30a (+) a and obtained accordingly respectively
Recombinant expression carrier pET-30a (+) a-mip, corresponding pET-30a (+) a-mip is then converted into entrance respectively respectively
Trans109 competent cells, picking monoclonal bacterium colony carry out respectively bacterium solution PCR identifications, digestion identification, bacterium solution sequencing determination contain
The encoding gene for having the miscarriage preferendum Chlamydia MIP albumen of His labels is successfully connected on pET-30a (+) carrier；
(3) expression and purity of recombinant protein：By the volume of the miscarriage preferendum Chlamydia MIP albumen containing His labels
Recombinant vector pET-30a (+) a-mip of code gene is transferred in e. coli bl21 respectively, and filtering out can stablize, efficiently respectively
MIP bacterial strain is expressed, goes out recombinant protein through derivant IPTG induced expressions, collects thalline, after ultrasonic degradation, in centrifuging and taking
Clearly, last supernatant purifies to obtain corresponding destination protein through 40% elution.
6th, miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to claim 5, its feature exist
In in step (1), the pcr amplification reaction system is 15 μ L MasterMix, corresponding each 1 μ L of upstream and downstream primer, the μ of template 3
L, the μ L of deionized water 10；The pcr amplification reaction condition is 95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；54 DEG C of annealing 45s；72
DEG C extension 1min；35 circulations；And 72 DEG C of extension eventually, 10min；4 DEG C of preservation 2h..
Further, in step (3), the final concentration of 0.8mM of the derivant IPTG, induction time is 4 hours；It is described to wash
De- liquid is made up of 200 μ L PB, 5.844g sodium chloride, 6.808g imidazoles liquid.
Envelope antigen of the present invention contains S marks, in order to the purifying of MIP albumen, that is, utilizes pET-30a (+) table
Up to the S labels on carrier, design primer limitation His labels；The MIP instruction antigens being related to carry His labels, on the one hand, are easy to
MIP albumen is purified, on the other hand, the His labels of MIP albumen and the corresponding antibody binding with enzyme mark, determines blood to be checked
Whether there are MIP protein antibodies clearly.
His labels that present invention miscarriage chlamydial antibody double antigens sandwich ELISA detection method marks HRP, anti-
Antibody is added in detection architecture, using the nonspecific binding properties of HRP marks, anti-His labels antibody, make its with
Other albumen or antibody in testing sample produce nonspecific combination, because this combination is by both space conformations
Have an impact, increase the steric hindrance that non-test antibodies produce non-specific binding with envelope antigen or labelled antigen, drop
The low probability combined, the vacation sun come so as to the interference fringe reduced due to non-specific binding.And for test antibodies, due to
Combination between antigen-antibody is specific, and HRP marks, anti-His labels antibody is right even with test antibodies
The influence of sensitivity is little.
Brief description of the drawings
Fig. 1 is mip gene magnification electrophoretograms, and M is 2000bp Marker.
Fig. 2 is mip gene double digestion qualification figures, and M1 is 2000bp Marker, and M2 is 10000bp Marker, and 1 is mip,
2,3 be pET-30a (+)-α-mip.
Fig. 3 is the SDS-PAGE figures of MIP expression, and M is albumen Marker, and 1 is control mycoprotein, 2,3,4,5,6,7 according to
Secondary is to induce 0.5h, 1h, 2h, 3h, 4h, and the mycoprotein after 5h, 8 be MIP after purification.
Fig. 4 is MIP antigenicity analysis figures, and Isosorbide-5-Nitrae is control mycoprotein, and 2 be that Chlamydia ox positive serum is primary antibody
Western blot results, 3 be the Western blot results that His tag antibodies are primary antibody.
Fig. 5 is the determination of optimal confining liquid and off-period.
Fig. 6 is the determination of serum the best use of time.
Fig. 7 is the determination of TMB the best use of times.
Fig. 8 is blocking test result.Wherein A：Not plus antigen positive serum；B：Add the positive serum of antigen；C：Not plus
The negative serum of antigen；D：Add the negative serum of antigen.
Embodiment
The present invention is further illustrated with reference to embodiment.
Embodiment 1：The preparation of instruction antigen MIP albumen containing His labels
1st, expand as follows for the envelope antigen MIP protein gene-specific primers containing S labels：
mip-F:AAAGAAACCGCTGCTAAATTCGAACGCCAGCACATGGACAGCCGCCCATATGAAAAAACAATG
GTA (NdeI restriction enzyme sites), i.e. SED ID NO：Shown in 1；
mip-R:CCGCTCGAGTGAAGCTGTGTTTTTGTCATT (restriction enzyme site containing XhoI), i.e. SED ID NO：2 institutes
Show.
2nd, the primer of instruction antigen MIP GFP of the amplification containing His labels is as follows：
mip-F:CGCCCATATGAAAAAACAATGGTA (restriction enzyme site containing NdeI), i.e. SED ID NO：Shown in 3；
mip-R:CCGCTCGAGTGAAGCTGTGTTTTTGTC (restriction enzyme site containing XhoI), i.e. SED ID NO：Shown in 4；
3rd, the amplification of MIP protein coding genes：The C.abortus bacterial strain SX5 that picking preserves a little, utilize Gram-negative
Bacterial genomes extracts kit extracts SX5 genomic DNA, in this, as pcr template, expands mip genes, wherein PCR is anti-
Answer system：React the μ L of cumulative volume 30, including 15 μ L MasterMix, corresponding each 1 μ L of upstream and downstream primer, the μ L of masterplate 3, deionization
The μ L of water 10；PCR reaction conditions are 95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；54 DEG C of annealing 45s；72 DEG C of extension 1min；35
Circulation；And 72 DEG C of extension eventually, 10min；4 DEG C of preservation 2h, the mip encoding genes of amplification are reclaimed with DNA glue reclaims kit.
4th, the structure of pET-30a (+)-mip expression vectors
XhoI, NdeI double digestion, 40 μ L digestion systems are carried out to pET-30a (+)：10 × H buffer solutions 4 μ L, NdeI, XhoI
Each 2 μ L, the μ L of carrier 20, the μ L of deionized water 12；Glue reclaim kit reclaims after the agarose electrophoresis of digestion products 1%, then builds
The μ L of linked system 25:T4DNA Ligase 1 μ L, mip encoding gene (the instruction antigenic protein gene containing His labels) glue returns
Receive the μ L of product 14, the μ L of deionized water 5.5；10×T4DNA Ligase Buffer 2.5μL.16 DEG C of connections overnight, are transformed into
Trans109 competent cells：Trans109 competent cell ice is put into freeze thawing in 5 minutes, ice puts 30 after adding the μ L of connection product 1
Minute, the rearmounted 2min on ice of 42 DEG C of thermal shock 90s, 800 μ L LB are added, are cultivated 1 hour in 37 DEG C of 200r/min incubators, after taking-up
4000r/min centrifuges 1min, abandons 600 μ L of supernatant, draws the culture plate that 100 μ L apply Kna resistances, after 37 DEG C are stayed overnight, picking Dan Ke
Grand bacterium colony carry out respectively bacterium solution PCR identifications, digestion identification, bacterium solution sequencing determine mip be successfully connected on pET-30a (+) carrier.
5th, the expression and purity of the MIP recombinant proteins containing His labels
(1) MIP expression：PET-30a (+)-α-mip containing His labels are transformed into E.coli BL21 respectively
(DE3) Host Strains, the difference corresponding monoclonal colony inoculation of picking shake bacterium and stayed overnight, press respectively in fresh 10mL LB culture mediums
1：100 ratios, which transfer to shake in fresh 10mLLB culture mediums, takes 1mL bacterium solutions to be used as non-induced samples when there is cloud to bacterium solution,
Final concentration 0.8mM 10 μ L IPTG induced expressions are then respectively adding, in 1h, 2h, 3h, 4h, 5h collect 1mL bacterium solution samples respectively
Product, SDS-PAGE determine optimal induction time, from the figure 3, it may be seen that expression quantity is maximum when inducing 4 hours, the size of destination protein
About 27kD.
(2) the PAGE gel electrophoresis of MIP expressing proteins
1. cleaning glass plate, it is fixed on electrophoresis tank, with 2.0% agarose edge sealing；Match somebody with somebody by the formula of molecular cloning
The separation gel 4.5mL of system 12%, rapid to inject between two glass plates, Jiao Ding covering 1.5mL distilled waters；The solid hypsokinesis of gelling to be separated
Go out coating liquid, with for several times, empty dry liquids are inverted at the top of deionized water rinsing gel, add 1.5mL 5% concentration peptization
Liquid, comb is plugged, being disposed vertically electrophoresis tank makes its solidification；Comb carefully is removed, Tris- is added between the upper and lower groove of electrophoretic apparatus
Glycine buffer, power cathode is connected with upper groove with irrigation with syringe well for several times.
2. the bacterium solution 12000rpm centrifugation 1min collected, are suspended with 50 μ L distilled waters, add isometric 2 × SDS loadings
Buffer, mix, water-bath is boiled 10min, with the μ L of microsyringe loading 10, turned on the power, and sets 80V electrophoresis to bromine phenol
Indigo plant enters separation gel, and voltage is adjusted to 120V, continues electrophoresis to bromophenol blue and reaches gel bottom.
3. dye：Gel distilled water flushing is removed, soaks gel with the coomassie brilliant blue staining liquid of 5 times of gel volumes,
Place 30min on shaking table.
4. decolourize：With 30% methanol, the mixed liquor of 10% glacial acetic acid, decolourize overnight, to change dye therebetween on decolorization swinging table
Color liquid 3~4 times；After blue background purifies completely, gel is immersed to terminate in distilled water and decolourized.
6th, a large amount of inductions and purifying of the instruction antigen MIP recombinant proteins containing His labels
(1) MIP a large amount of inductions：The corresponding bacterium solution of MIP recombinant proteins containing His labels is taken respectively by 1：100 ratios
Transferring to shake in fresh 1000mL LB culture mediums takes 1mL bacterium solutions to be used as non-induced samples, Ran Houfen when there is cloud to bacterium solution
Not Jia Ru final concentration 0.8mM 1mL IPTG induced expressions 4 hours.
(2) ultrasonic degradation：Ultrasonic probe first is wiped with alcohol swab, the centrifuge tube ice for filling 40mL bacterium solutions is placed in ultrasound
In instrument, ultrasonic 5s, 5s, 25 DEG C of 40min are spaced, 4 DEG C of 7000r/min centrifuge 10min after ultrasound, abandon precipitation and stay supernatant.
(3) MIP protein purifications
1. eluent A:1L PB+29.22g NaCl
Eluent B:200 μ L PB+5.844g NaCl+6.808g imidazoles
2. the determination of wash-out concentration：
A, 15mL A liquid balance pillar；
B, loading 5mL, collection flow through liquid；
C, 10mL A liquid washes pillar；
D, 10%B liquid 5mL washes pillar, collects liquid；
E, 20%B liquid 5mL washes pillar, collects liquid；
F, 40%B liquid 5mL washes pillar, collects liquid；
G, 60%B liquid 5mL washes pillar, collects liquid；
H, 80%B liquid 5mL washes pillar, collects liquid；
I, 100%B liquid 10mL washes pillar；
J, A liquid 10mL washes pillar；
K, 20% ethanol 5mL, pillar, 4 DEG C of preservations are added.
The μ L of liquid 50 of above-mentioned collection are taken respectively, are added 2 × SDS loading buffer, are boiled 10min in boiling water, take on 10 μ L
Sample, SDS-PAGE results show that optimal imidazoles wash-out concentration is 40%.
Embodiment 2：The immunocompetent detections of recombinant protein PET-30a (+) a-mip
1st, transfer：Cut 1 piece of pvdf membrane, size is equal with gel, pvdf membrane first in methyl alcohol soak 5 minutes, afterwards with 2 pieces
Filter membrane is put into buffer solution together soaks 1min, on positive plate by filter membrane, NC films, SDS-PAGE running gels, filter membrane it is suitable
Sequence is stacked neatly, and negative plate, 23V transferring films 25min are covered after driving bubble away with glass bar.
2nd, close：After the completion of transferring film, pvdf membrane is removed, is put into the 5% gelatin confining liquid that 10mL is prepared with PBS, shaking table
Upper room temperature places 1h.
3rd, antigen-antibody reaction：After closing terminates, add with 2% skimmed milk power 1:The miscarriage Chlamydia of 20 times of dilutions is positive
Sheep blood serum 4mL, 4 DEG C of combinations are stayed overnight, and are rinsed 4~5 times with PBST, are slowly shaken 10min in shaking table every time, after washing terminates, add
Enter with 2% skimmed milk power 1:The anti-sheep IgG (secondary antibody) of 10000 times of dilutions, jog incubation 1h, is rinsed after taking-up with PBST at room temperature
3-4 times, each 10min.
4th, substrate develops the color：After antigen-antibody reaction terminates, clean pvdf membrane once with deionized water, somewhat dry, by film
It is placed in plastic fresh-keeping membrane, A, B liquid in the moderate mixing ECL Color Appearance Systems of darkroom, is added dropwise on pvdf membrane, acts on 1min；
X- films are cut, are placed on film, cover plateholder, expose appropriate time, take out film development, are fixed, analysis.
Embodiment 3：The foundation of double antigens sandwich ELISA detection method：
1st, the most preferably selection of coating buffer solution and serum dilution
Coating buffer selects CB, and carbonate buffer solution, pH 9.6,50mmmol/L, serum dilution is 5% gelatin.
2nd, recombinant protein is most preferably coated with the determination of concentration and serum optimum dilution degree
By the antigen of purifying from 1:100 start 6 gradients of doubling dilution, by serum from 1:50 start 6 ladders of doubling dilution
Spend, OD values are read on ELIASA, positive serum OD450nm values are P, and negative serum OD450nm values are N, and antigen is determined with P/N values
Optimal coating concentration and serum optimum dilution degree, square formation titration results are shown in antigen with 1:800 dilutions, serum is with 1:100
During dilution, P/N reaches peak value 7.88, is shown in Table 1.
The determination of the most suitable coating concentration of the antigen of table 1 and serum optimal dilution
3rd, the determination of ELIAS secondary antibody working concentration and time
By enzyme-labelled antigen according to 1：2500,1:5000,1:10000,1:20000,1:40000 progress doubling dilutions, and
30min, 45min, 60min, 90min are stood in 37 DEG C of incubators respectively, carries out ELISA detections, reads OD450nmValue, according to P/N values
Select enzyme-labelled antigen optimum dilution degree and the best use of time, enzyme-labelled antigen 1：5000 times of dilutions, when being incubated 60min, P/N values are most
Greatly, 2 are shown in Table.
The determination of the enzyme-labelled antigen optimum dilution degree of table 2 and incubation time
4th, most suitable confining liquid and the determination of off-period
According to optimal coating condition coated elisa plate, washing, closed according to different confining liquid components and time,
OD is read in ELISA detections450nmValue, draws P/N values, as a result shows that the P/N values of 5% skimmed milk power are significantly lower than other confining liquids,
Mixed with 5% gelatin, 2.5% gelatin with 2.5%BSA, the P/N values for three kinds of conditions that 5%BSA is closed are suitable, and close
When time is 120min, P/N values are higher, it is contemplated that specificity, versatility, the rapidity of detection method, select the closing of 5% gelatin
120min, see Fig. 5.
5th, serum most suitable action time
It is coated with according to optimum condition, closes 4 pieces of ELISA Plates, serum is diluted according to optimum dilution degree and added, by 4 pieces of enzyme marks
Plate stands 30min, 45min, 60min, 90min in 37 DEG C of incubators respectively, reads OD450nmValue, serum is selected most according to P/N values
Good action time, during sera incubation 45min, P/N values are maximum, as a result see Fig. 6.
6th, optimal developing time
3 pieces of ELISA Plates are handled with the ELISA optimum conditions established, according to ELISA Programmable detection yin, yang serum, until
Substrate buffer solution step is added, after the substrate TMB in 50 μ L/ holes is added into above-mentioned 3 pieces of ELISA Plates, 3 pieces of ELISA Plates are respectively placed in
Darkroom 10min, 20min, 30min, the substrate the best use of time is determined according to P/N values, P/N values are maximum when being incubated 20min, as a result
See Fig. 7.
7th, the determination of yin and yang attribute critical value
With the ELISA optimum conditions of above-mentioned determination, the 51 parts of sheep negative serums preserved to this laboratory detect, each
Sample sets 2 repetitions, reads OD450nmValue, the OD average values X for calculating all negative samples is 0.133, and standard deviation S is
0.064, be positive and negative result judgement value according to formula X+2S=0.261, i.e. OD450nm＞ 0.261 is determined as positive findings,
OD450nm≤ 0.261 is determined as negative (the results are shown in Table 3).
The determination of the double antigens sandwich ELISA diagnostic method critical values of table 3
8th, sensitivity tests
With the ELISA Programmable detection Ovine abortion Chlamydia positive serums having determined, by positive serum with 1：40,1：80,
1：160,1：320,1：640,1：1280,1：2560 carry out doubling dilution, and remaining condition is entered according to ELISA optimum reaction conditions
OK.When positive serum is diluted to 1：When 1280, ELISA Plate hole color change is visually observed, it is difficult to judge positive and negative, but enzyme mark
Instrument can detect, when positive serum is diluted to 1：When 2560, ELIASA testing result is feminine gender, the results are shown in Table 4.
Table 4- sensitivity tests results
9th, specific test
(1) cross reaction is tested
With established ELISA optimum conditions detect respectively sheep mycoplasma, Brucella ovis, the type of sheep legionella pneumophilia 1,
Sheep legionella pneumophilia 2-18 types positive serum, sheep aftosa positive serum, and done pair with Ovine abortion Chlamydia positive and negative serum
According to according to the OD read on ELIASA450nmValue, it is feminine gender to sentence a section Virus monitory result, shows established double antigens sandwich
ELISA method specificity is good, is shown in Table 5.
Table 5- cross reaction result of the tests
(2) blocking test
Positive and negative serum through doubling dilution is divided into 2 groups, one group of addition antigen, one group does not add antigen, carries out
ELISA is detected, and adds the positive serum of antigen compared with not adding the positive serum of antigen, OD450nmValue is obvious to be reduced；Negative blood
Reset and add the OD for not adding antigen into antigen and450nmValue has no significant change, sees Fig. 8.
10th, in criticizing, batch between replica test
(1) replica test in criticizing：Choose and be detected as negative, positive, doubtful 6 parts positive of serum through IHA, with 1:100
Dilution, batch interior repetition is carried out on the coated different ELISA Plates of MIP albumen of same Batch purification and is tested, each sample sets 5
Hole is parallel, according to OD450nmValue calculates standard deviation, and the coefficient of variation is respectively less than 10%, the results are shown in Table 6.
6 batches, table is interior to be repeated to test
(2) replica test between criticizing：By on the MIP albumen coating same ELISA Plate of three different batches purifying, add
Above-mentioned serum carries out repeating to test between criticizing, and each sample sets 2 holes parallel, according to OD450nmValue calculates standard deviation, and the coefficient of variation is equal
Less than 11%, 7 are the results are shown in Table.
Repeat to test between 7 batches, table
11st, accordance is tested
Double antigens sandwich ELISA diagnostic methods and current domestic general IHA methods using foundation, are gathered to 103 parts
Sheep blood serum in Xishuangbanna is detected respectively, and IHA is tested with 1:128, to judge hole, detect 59 parts of positives, 44 parts of the moon
Property, positive rate is 57.3% (59/103)；Double antigens sandwich ELISA detects 70 parts of positives, 33 parts of feminine genders, and positive rate is
All positives, IHA detections are detected in 68.0% (70/103), wherein the 59 of IHA test positive part serum dual-antigen sandwich method
It is positive to measure 11 parts for 44 parts of negative serum double antigens sandwiches, and 33 parts are feminine gender, it follows that the two measures the positive
Serum has 59 parts, and all serum for feminine gender has 33 parts, then the coincidence rate of the two is 89.3% (92/103).
SEQUENCE LISTING
<110>Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120>One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method
<130> 2014
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 66
<212> DNA
<213>Artificial sequence
<400> 1
aaagaaaccg ctgctaaatt cgaacgccag cacatggaca gccgcccata tgaaaaaaca 60
atggta 66
<210> 2
<211> 30
<212> DNA
<213>Artificial sequence
<400> 2
ccgctcgagt gaagctgtgt ttttgtcatt 30
<210> 3
<211> 24
<212> DNA
<213>Artificial sequence
<400> 3
cgcccatatg aaaaaacaat ggta 24
<210> 4
<211> 27
<212> DNA
<213>Artificial sequence
<400> 4
ccgctcgagt gaagctgtgt ttttgtc 27
Claims (7)
1. one kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method, it is characterised in that marked using with S without His
The MIP recombinant proteins of label as envelope antigen, using with MIP recombinant protein of the His labels without S labels as instruction antigen and
The antibody of HRP marks, anti-His labels, carry out the double antigens sandwich ELISA detections of animal blood serum miscarriage chlamydial antibody.
2. miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to claim 1, it is characterised in that institute
It is that the coating concentration of MIP recombinant proteins with His labels is 0.2 μ g/ holes respectively to state double antigens sandwich ELISA reaction conditions,
Serum dilution is 1:The MIP recombinant proteins dilution factor with His labels of 100, HRP marks is 1:5000, confining liquid 5%
Gelatin, test serum and the MIP recombinant proteins with His labels react 45min in 37 DEG C, and substrate is in the color development at room temperature time
20min。
3. miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to claim 1 or 2, it is characterised in that
The MIP recombinant proteins of the His labels of the HRP marks are enzyme-labelled antigen.
4. miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to claim 1 or 2, it is characterised in that
The double antigens sandwich ELISA detects that negative and positive critical point is 0.261.
5. the miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to one of Claims 1 to 4, its feature
It is, the MIP recombinant proteins with His labels are built-up by following steps：
(1) the coding gene sequence amplification of miscarriage preferendum Chlamydia MIP albumen：Using Chlamydia SX5 genomes of miscarrying as template, if
The primer such as SED ID NO of instruction antigen MIP GFP of the meter containing His labels：3 and SED ID NO：Shown in 4；Amplify
Containing His label Macrophage infection potentiator genes, carry out the recovery of pcr amplification product and purifying obtains marking containing His
The encoding gene of the miscarriage preferendum Chlamydia MIP albumen of label；
(2) recombinant vector pET-30a (+)-mip structure：It will be contained by NdeI enzymes, XhoI enzymes double digestion, connection, conversion
The encoding gene of the miscarriage preferendum Chlamydia MIP albumen of His labels inserts expression vector pET-30a (+) a and obtained accordingly respectively
Recombinant expression carrier pET-30a (+) a-mip, corresponding pET-30a (+) a-mip is then converted into entrance respectively respectively
Trans109 competent cells, picking monoclonal bacterium colony carry out respectively bacterium solution PCR identifications, digestion identification, bacterium solution sequencing determination contain
The encoding gene for having the miscarriage preferendum Chlamydia MIP albumen of His labels is successfully connected on pET-30a (+) carrier；
(3) expression and purity of recombinant protein：By the coding base of the miscarriage preferendum Chlamydia MIP albumen containing His labels
Recombinant vector pET-30a (+) a-mip of cause is transferred in e. coli bl21 respectively, filter out respectively can stablize, high efficient expression
MIP bacterial strain, go out recombinant protein through derivant IPTG induced expressions, collect thalline, after ultrasonic degradation, centrifuging and taking supernatant, most
Supernatant purifies to obtain corresponding destination protein through 40% elution afterwards.
6. miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to claim 5, it is characterised in that step
Suddenly in (1), the pcr amplification reaction system is 15 μ L MasterMix, corresponding each 1 μ L of upstream and downstream primer, the μ L of template 3, is gone
The μ L of ionized water 10；The pcr amplification reaction condition is 95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；54 DEG C of annealing 45s；72 DEG C are prolonged
Stretch 1min；35 circulations；And 72 DEG C of extension eventually, 10min；4 DEG C of preservation 2h.
7. the miscarriage chlamydial antibody double antigens sandwich ELISA detection method according to claim 5 or 6, it is characterised in that
In step (3), the final concentration of 0.8mM of the derivant IPTG, induction time is 4 hours；The eluent by 200 μ L PB,
5.844g sodium chloride, 6.808g imidazoles liquid composition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710495241.1A CN107402304A (en) | 2017-06-26 | 2017-06-26 | One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710495241.1A CN107402304A (en) | 2017-06-26 | 2017-06-26 | One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107402304A true CN107402304A (en) | 2017-11-28 |
Family
ID=60405315
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710495241.1A Pending CN107402304A (en) | 2017-06-26 | 2017-06-26 | One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107402304A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110031621A (en) * | 2019-04-24 | 2019-07-19 | 北京新创生物工程有限公司 | A kind of HIV new infections detection kit and preparation method |
| CN110129278A (en) * | 2019-05-31 | 2019-08-16 | 湖北省农业科学院畜牧兽医研究所 | Hybridoma cell strain CMOMP-5D7 and its monoclonal antibody and application of secretion |
| CN113484522A (en) * | 2021-06-03 | 2021-10-08 | 上海捷诺生物科技有限公司 | SARS-CoV-2 neutralizing antibody detection kit and its preparation method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101135684A (en) * | 2006-09-01 | 2008-03-05 | 诺克斯科技有限公司 | Neoplasia specific tnox isoforms |
| CN101363848A (en) * | 2008-09-24 | 2009-02-11 | 深圳市菲鹏生物股份有限公司 | Sandwich method for detecting double antigen by antibody indirectly marked with nanometer granule and kit thereof |
| CN101287989B (en) * | 2005-02-02 | 2016-04-13 | 菲鹏生物股份有限公司 | A kind of detecting reagent kit for antibody of hepatitis C virus and preparation method thereof |
-
2017
- 2017-06-26 CN CN201710495241.1A patent/CN107402304A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101287989B (en) * | 2005-02-02 | 2016-04-13 | 菲鹏生物股份有限公司 | A kind of detecting reagent kit for antibody of hepatitis C virus and preparation method thereof |
| CN101135684A (en) * | 2006-09-01 | 2008-03-05 | 诺克斯科技有限公司 | Neoplasia specific tnox isoforms |
| CN101363848A (en) * | 2008-09-24 | 2009-02-11 | 深圳市菲鹏生物股份有限公司 | Sandwich method for detecting double antigen by antibody indirectly marked with nanometer granule and kit thereof |
Non-Patent Citations (1)
| Title |
|---|
| 蔺俊丽: "流产衣原体MIP蛋白的双抗原夹心ELISA诊断方法建立及单克隆抗体制备", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110031621A (en) * | 2019-04-24 | 2019-07-19 | 北京新创生物工程有限公司 | A kind of HIV new infections detection kit and preparation method |
| CN110031621B (en) * | 2019-04-24 | 2022-04-01 | 北京新创生物工程有限公司 | HIV new infection detection kit and preparation method thereof |
| CN110129278A (en) * | 2019-05-31 | 2019-08-16 | 湖北省农业科学院畜牧兽医研究所 | Hybridoma cell strain CMOMP-5D7 and its monoclonal antibody and application of secretion |
| CN113484522A (en) * | 2021-06-03 | 2021-10-08 | 上海捷诺生物科技有限公司 | SARS-CoV-2 neutralizing antibody detection kit and its preparation method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Major et al. | Exposure of cats to low doses of FeLV: seroconversion as the sole parameter of infection | |
| CN109709338B (en) | Enzyme linked immunosorbent assay kit for detecting skeletal muscle troponin I of cattle or sheep and preparation method and application thereof | |
| CN105906714B (en) | A kind of preparation and application of brucellosis specific fusion protein antigen | |
| CN103969450A (en) | ELISA (Enzyme Linked Immunosorbent Assay) kit for detecting porcine epidemic diarrhea virus antibody | |
| CN107402304A (en) | One kind miscarriage chlamydial antibody double antigens sandwich ELISA detection method | |
| CN106432440B (en) | PPA-ELISA (polymerase chain reaction-enzyme linked immunosorbent assay) detection kit for Brucella melitensis antibody and preparation method of PPA-ELISA detection kit | |
| CN105242043B (en) | A kind of several species general ELISA kit of antidiastole mouth disease virus infection | |
| CN109001450A (en) | A kind of kit and preparation method detecting chicken Mycoplasma synoviae antibody | |
| CN107573417A (en) | Mycoplasma pneumoniae chimeric antigen, the antigen detecting agent and both preparation methods | |
| CN107365364A (en) | A kind of quick detection kit of Adenovirus Antigen preparation method and the detection adenovirus antibody prepared using the antigen | |
| CN104725490A (en) | Porcine circovirus 2 type ELISA antibody detection kit | |
| CN104181297B (en) | A kind of ELISA kit detecting sheep Pseudorabies virus antibody | |
| CN105759030B (en) | A kind of colloidal gold strip for detecting toxoplasma antibody | |
| CN107759674A (en) | A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test | |
| CN106188248A (en) | A kind of Epstein-Barr virus antigen preparation procedure and utilize the quick detection kit of detection Epstein-Barr virus antibody prepared by this antigen | |
| CN107449915A (en) | A kind of method for detecting serum moderate resistance EV D68 antiviral antibodies | |
| CN103275194A (en) | Antigen of pig transmissible gastroenteritis virus or pig respiratory tract coronavirus antibody in pig serum and enzyme-linked immunosorbent assay (ELISA) detection method thereof | |
| CN116023506B (en) | ASFV nonstructural protein dominant antigen epitope fusion protein, kit and application thereof | |
| CN107860919A (en) | Detect porcine circovirus 2 type IgM antibody ELISA kit and detection method | |
| CN108893476A (en) | Babesiamicrofti 2D97 antigen protein and its application | |
| CN102590505A (en) | Reagent kit for detecting immunoglobulin m (IgM) AlphaLISA for resisting enterovirus71 capsid protein1 | |
| CN109799342A (en) | A kind of O-shaped antibodies against foot-and-mouth disease virus competitive ELISA detection kit | |
| CN108982849A (en) | The application of EG-TPx and the kit for diagnosing domestic animal echinococcosis granulosa | |
| CN107422117A (en) | A kind of kit for detecting Latex agglutination test antibody | |
| CN107356752A (en) | A kind of Riemerellosis Anatipestifer latex agglutination antibody assay kit and its detection method and store method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171128 |
|
| WD01 | Invention patent application deemed withdrawn after publication |