CN116559441A - Application of TGME49_229320 protein in preparation of toxoplasmosis diagnosis kit - Google Patents

Abstract

The invention discloses an application of toxoplasma TGME49_229320 protein in preparing a toxoplasmosis diagnosis kit, wherein the nucleotide sequence of a coding gene of the toxoplasma TGME49_229320 protein is shown as SEQ ID NO:1, the invention also discloses a toxoplasmosis diagnosis kit and an indirect ELISA method for detecting toxoplasmosis without diagnosis purpose, belonging to the field of molecular biology. The invention provides more candidate antigens for pathogen detection and prevention and control of toxoplasma, and the established method can specifically detect the antibody serum infected by toxoplasma oocysts and has the advantages of good accuracy, strong sensitivity and the like.

Description

Application of TGME49_229320 protein in preparation of toxoplasmosis diagnosis kit

Technical Field

The invention relates to application of toxoplasmosis TGME49_229320 protein in preparation of a toxoplasmosis diagnosis kit, and also relates to the toxoplasmosis diagnosis kit established by utilizing TGME49_229320 protein and an indirect ELISA method, belonging to the field of molecular biology.

Background

Toxoplasma gondii (Toxoplasma gondii) (nicole & Mancea 1908) is abbreviated as toxoplasma gondii. Belonging to the class Sporidae, order Eucoccidia, family Toxoplasma, and is the causative agent of Toxoplasma disease (Toxoplasma). Toxoplasma is capable of infecting 140 animals, including humans, whose end host is a feline, and is subject to merozoite reproduction in cat small intestine epithelial cells to form merozoites, portions of which are converted to gametophytes of size which combine to form oocysts which are expelled from the body through the intestine along with fecal material, and which, under appropriate conditions, are converted to infectious oocysts after 2-4 days. The pig is used as a large host for toxoplasmosis infection, and clinical symptoms are mainly represented by the symptoms of short-term body temperature rise, appetite reduction, dyspnea, dry excrement, yellow urine, purple abdomen of the sick pig, severe vomiting, diarrhea and the like, and abortion of pregnant sows. There are two main ways of infection of swine with toxoplasma, the first is to infect toxoplasma by eating food, feed, water, etc. contaminated with oocysts, and the second is to infect toxoplasma by eating mice infected with toxoplasma. In the intermediate host, toxoplasma is present in encapsulated form, and the host is lifelong with the parasite. In addition, the method has a less probable infection mode, the sows are infected with toxoplasma gondii in gestation period, and the piglets are congenital with the toxoplasma gondii. The pig toxoplasmosis in China is common, and the average infection rate of the pig toxoplasmosis in China is about 40 percent according to statistics, and the infection rate of pigs bred by scattered households is higher than that of pigs bred in large scale on the aspect of the breeding environment, and the pig embryo number of the sow produced in the past is more and more easy to infect the toxoplasmosis. The difference of the ages, the sexes and the feeding modes of the pigs and the number of cats in the surrounding environment have great influence on the positive rate.

The main methods for detecting toxoplasmosis at present are etiology detection, molecular biological detection and serology methods. The etiology diagnosis is the most intuitive diagnosis method, and the toxoplasma oocysts in feces, water and soil and insect bodies or eggs in disease tissues can be directly observed through an optical microscope. The molecular biological method mainly comprises PCR, designing toxoplasma specific primers and amplifying toxoplasma fragments, and is sensitive and specific, and is an important means for diagnosing toxoplasmosis in a laboratory. Serological methods are to detect toxoplasma antibodies or antigens by immunological reactions, and are mainly classified into MAT (modified agglutination assay), WB (western blot assay), IFA (indirect immunofluorescence assay), ELISA (enzyme-linked immunosorbent assay) and the like. The ELISA method has high sensitivity and strong specificity, can realize mass detection of samples in a short time, is easy to realize automatic operation, is quick and simple, has no special requirement on operators, is suitable for epidemiological investigation and field investigation, and is therefore widely focused.

ELISA method relies on specific antibody or antigen, and has been reported to use toxoplasmosis microwires, rods, membrane surface, compact granule proteins as candidate antigen for resisting toxoplasmosis, such as white ice, etc., to prepare polyclonal antibody by TGME 49-209950 protein and realize specific detection of target antigen; zhao Xu et al constructed TGME49_229480 recombinant protein and detected the difference in transcription and expression levels of the protein in different insect strains. In general, the number of antigens currently available for toxoplasmosis diagnosis and pathogen detection is still small, the actual use requirements cannot be met, and most of antigens reported in the prior literature only can detect whether sample serum is toxoplasmosis positive or not and cannot be used for identifying the infection way of toxoplasmosis.

TGME49_229320 protein, annotated as having phosphoglycolate phosphatase activity in ToxoDB, belongs to the subfamily of hydrolases of the Cof family (https:// ToxoDB. Org/toxo/app /), which has not been studied for related functions in the toxoplasma field. TGME49_229320 is a protein which is highly expressed in toxoplasmosis oocyst period, and can be used for identifying oocyst infection paths of toxoplasmosis.

Disclosure of Invention

The primary purpose of the invention is to provide an application of toxoplasma TGME 49-229320 protein in preparing a toxoplasmosis diagnosis kit.

A second object of the present invention is to provide a toxoplasmosis diagnostic kit.

A third object of the present invention is to provide an indirect ELISA method for toxoplasmosis which can identify the source of infection.

To achieve the above object, the applicant extracts Totala RNA of Toxoplasma gondii, reverse transcribes it to obtain cDNA, designs related primers according to TGME 49-229320 gene sequence, amplifies target fragment by PCR method, connects target fragment to pET28a carrier by homologous recombination method, and transfers constructed pET28a-229320 plasmid to E.coli BL21 (DE 3) for expression after PCR identification and sequencing verification. Expanding and culturing the pET28a-229320 expression strain, and obtaining toxoplasma gondii Cof family hydrolase subfamily protein TGME 49-229320 after induction and purification, wherein the nucleotide sequence of the protein coding gene is shown as SEQ ID NO: 1.

Western blot tests show that TGME49_229320 protein can react with pig serum positive for toxoplasma oocyst infection to generate a target strip, and does not react with pig serum positive for toxoplasma tachyzoite infection, so that the protein can be used for preparing an indirect enzyme-linked immunosorbent assay kit for toxoplasma oocyst infection and for enzyme-linked immunosorbent assay of toxoplasma oocyst infection IgG antibodies.

Optimizing ELISA conditions by taking TGME49_229320 protein as a candidate antigen to obtain an indirect ELISA method for detecting toxoplasma gondii IgG antibodies, wherein the method comprises the following steps:

1) The toxoplasma TGME49_229320 protein is diluted and then coated on an ELISA plate;

2) Sealing the ELISA plate by using a sealing liquid;

3) Diluting the serum sample, adding an ELISA plate, and incubating at 37 ℃ for 30-90min;

4) Adding the enzyme-labeled secondary antibody into an enzyme-labeled plate after dilution, and incubating for 30-90min at 37 ℃;

5) The color-developing solution was added to carry out a light-shielding color-developing reaction at 37℃and the reaction was terminated and read at a wavelength of 630 nm.

Preferably, the final dilution concentration of the toxoplasma TGME 49-229320 protein is 2 μg/mL; the dilution factor of the serum sample was 200-fold.

Preferably, the blocking solution is 1% bovine serum albumin and the blocking time is 60min.

Preferably, the enzyme-labeled secondary antibody is HRP-labeled goat anti-pig IgG.

The beneficial effects of the invention are as follows:

the invention realizes pathogen detection of toxoplasmosis by utilizing the toxoplasmosis TGME 49-229320 protein for the first time, and successfully establishes an indirect ELISA method. The invention provides more candidate antigens for pathogen detection and prevention and control of toxoplasma, and the established method can specifically detect the antibody serum infected by toxoplasma oocysts, and has the advantages of strong sensitivity, rapidness, convenience and the like, and is concretely as follows:

in terms of sensitivity, the sensitivity of the detection method established by the invention is greater than 1:400, meets the requirements of field detection.

In the aspect of specificity, the detection method established by the method has no cross reaction with the positive serum of swine fever, porcine reproductive and respiratory syndrome, porcine pseudorabies, porcine circovirus disease, porcine foot-and-mouth disease and porcine toxoplasma tachyzoite.

The invention can process a large amount of samples in a short time, can directly judge the toxoplasma gondii positive/negative according to the reading size (ratio), and has the advantages of rapidness, simplicity and the like.

See the specific examples for more details. Of course, the technical solution of the present invention is not limited to the examples, and according to the functional properties of the TGME49_229320 protein reported in the present invention, the skilled person can use the protein for other studies without creative efforts, for example, to prepare antibodies by using the protein and to perform direct ELISA detection of antigens, and all such modifications without creative efforts are within the scope of the present invention.

Drawings

FIG. 1 shows the PCR amplification of the coding sequence of toxoplasma 229320, in which: lane M, DNA molecular mass standard; 1:229320 coding sequence amplification product.

FIG. 2 is a graph showing the identification result of recombinant plasmid pET28a-229320, wherein: lane M, protein standard; 1-5 pET28a-229320 plasmid cleavage products; 6 negative control.

FIG. 3 shows the result of SDS-PAGE analysis of pET28a-229320 expression products, wherein: lane M, molecular mass standard; 1, uninduced; inducing for 4 hours at the temperature of 2:37 ℃; inducing for 4 hours at the temperature of 3:16 ℃; induction was carried out for 16h at 4:16 ℃.

FIG. 4 shows the result of SDS-PAGE analysis of pET28a-229320 expression products, wherein: lane M, protein molecular mass standard; 1, supernatant; 2, inclusion body.

FIG. 5 shows the result of Western blot purification of pET28a-229320 expression products, in which: lane M, protein molecular mass standard; 1 purification of His-229320.

FIG. 6 is a Western blot results of the availability identification of pET28a-229320, in which: lane M, protein molecular mass standard; 1, oocyst-positive pig serum; 2, tachyzoite positive pig serum.

Detailed Description

Example 1: preparation of TGME49_229320 protein

Extracting Total RNA of toxoplasma ME49 insect tachyzoite, obtaining cDNA by using a reverse transcription kit of TransGen company, designing related primers according to a required target fragment by using Snap Gene molecular cloning software, amplifying the target fragment by a PCR method, connecting the target fragment to a pET28a vector by using a homologous recombination method, and transferring the constructed pET28a-229320 plasmid into escherichia coli BL21 (DE 3) for expression after PCR identification and sequencing verification.

Acquisition of TGME49_229320 fragment

(1) Extraction of Total RNA of Toxoplasma gondii

Centrifuging the collected insects, discarding the supernatant, adding 1mL of Trizol to carry out heavy suspension precipitation, repeatedly blowing and uniformly mixing, transferring the sample into a 1.5mL RNase-free centrifuge tube, vigorously shaking and vortexing for 3min to enable the insects to be fully cracked, and standing for 10min at room temperature; adding chloroform according to 200 mu L chloroform/mL Trizol, shaking for 15sec with force, and standing at room temperature for 2-3 min; centrifuging at 12000r/min for 15min at 4 ℃; carefully sucking the upper water phase, placing the upper water phase into a new 1.5mL RNase-free centrifuge tube, adding equal volume of isopropanol, fully mixing, and placing the mixture at room temperature for precipitation for 10min; centrifuging at 12000r/min for 10min at 4deg.C, discarding supernatant, and precipitating RNA at the bottom of the tube in the form of white precipitate; adding 1mL of 75% ethanol prepared by DEPC water, turning over a centrifuge tube, and washing precipitate; centrifuging at 4deg.C and 7500r/min for 5min, discarding supernatant, and air drying in an ultra clean bench; adding 30 mu L of RNase-free DEPC water to dissolve RNA precipitate; the quality of the extracted Total RNA was identified by 1.5% agarose gel electrophoresis and Total RNA concentration and purity were determined by UV spectrophotometry.

(2) Preparation of Toxoplasma gondii cDNA

1 μg Total RNA was taken and passed through a TransGen reverse transcription kit to obtain cDNA, and the following reagents were added in order:

step 1: RNA template denaturation

Heating at 65deg.C for 5min, and rapidly standing on ice for 2min.

Step 2: removal of genomic DNA

Step 3: the first strand cDNA synthesis was performed by gentle pipetting using a pipette according to the following reaction

The product can be used for PCR reaction immediately or stored at-20deg.C for half a year, and long-term storage is recommended to sub-package at-80deg.C.

(3) PCR amplification of fragments of interest

The cDNA obtained by reverse transcription was used as a template for amplifying a target Gene (Gene ID: 7894331), the upstream and downstream primers of the Gene were designed by SnapGene molecular cloning software, and were 229320-F (AGCAAATGGGTCGCGGATCCATGAACGGTTTATTCTCGTGTTGCTTCGAC) and 229320-R (TGGTGGTGGTGGTGCTCGAGCGACTTGGAGCTGGAGTGTGCTTG), respectively, and a band of 942bp was obtained by PCR amplification, and the result was consistent with the predicted size, as shown in FIG. 1, and the fragment was recovered by a gel recovery kit. According to the sequence of commercial pET28a plasmid, the upstream primer pET28a-F and the downstream primer pET28a-R of the pET28a vector are designed and amplified by utilizing Snap Gene software, the pET28a plasmid is used as a template, a 5335bp band is obtained by PCR amplification, and the fragment is recovered by using a gel recovery kit.

The PCR reaction system is as follows:

the PCR conditions were as follows:

the second step to the fourth step, for a total of 35 cycles.

(4) Recovery of fragments of interest

Operating according to the description of the Northey DNA agarose gel recovery kit, performing gel cutting recovery on a target fragment of a single strip, and placing the target fragment into a 1.5mL centrifuge tube; adding an equal volume of sol liquid, performing water bath at 55 ℃ for 10min, and uniformly mixing the centrifuge tubes reversely every 5min to fully melt the gel; cooling the melted gel liquid to room temperature, adding the cooled gel liquid into a DNA recovery column, and standing at room temperature for 1min; centrifuging at 12000r/min at room temperature for 1min, and discarding the effluent in the collecting pipe; adding 300 mu L of GDP into the column, standing for one minute, centrifuging at the room temperature of 12000r/min for 1min, discarding the effluent in the collecting pipe, and discarding the effluent in the collecting pipe; adding 650 mu L GW washing liquid into the recovery column, centrifuging for 1min at room temperature of 12000r/min, discarding the effluent in the collecting pipe, and repeating for one time; centrifuging the empty recovery column 12000r/min for 2min, discarding the residual effluent in the collecting pipe, placing the recovery column in a new 1.5mL centrifuge tube, and placing an ultra clean bench for air drying to volatilize the residual ethanol; 10-30 mu L of sterilized water preheated at 55 ℃ is added to the middle membrane of the recovery column, the mixture is stood for 2min at room temperature, centrifuged for 2min at 12000r/min at room temperature, and effluent liquid is collected and stored at-20 ℃.

Construction of pET28a-229320 plasmid

The 229320-CDS fragment and pET28a carrier fragment are connected by utilizing a homologous recombination method, the connection product is transferred into an escherichia coli competent cell DH5 alpha by utilizing a heat shock method after connection, the transformation product is coated on a kana-resistant LB plate, the transformation product is grown upside down overnight, single colonies are picked up, PCR identification is carried out, and the result is consistent with the expected result, and the result is shown in figure 2. Extracting plasmids after the amplification culture, and carrying out sequencing verification. The sequencing result is compared with the CDS of TGME49_229320 gene in the database, the sequencing result and the CDS can be completely matched, and no frame shift or mutated base appears, so that the result proves that the recombinant expression plasmid pET28a-229320 is successfully constructed.

(1) Construction of plasmid by homologous recombination

Step 1: the recovered target fragment was ligated and operated according to the instructions of the nuezan multi-fragment cloning kit, the ligation system was as follows:

mixing the above liquids, reacting at 37deg.C for 30min in PCR instrument, taking competent and connecting product, ice-bathing at 4deg.C for 5min, and converting. Fragment optimum amount= [0.02×fragment base pair number ] ng (0.03 pmol).

Step 2: transformation of ligation products into E.coli DH 5. Alpha. Chemocompetent cells: adding the ligation product (or plasmid), mixing, and standing on ice for 5min;

step 3: carrying out heat shock in a water bath at 42 ℃ for 42s, rapidly taking out, and carrying out ice bath for 1min;

step 4: 400 mu L of LB liquid medium without antibiotics is added, and the culture is carried out for 45min at 37 ℃ at 180 r/min;

step 5: centrifuging at 5000r/min for 3min, discarding 300 μL supernatant, mixing the rest, spreading on LB plate with corresponding resistance, and culturing at 37deg.C for 12-16 hr.

(2) Plasmid transformation

Taking chemically competent cells of escherichia coli stored at-80 ℃, and melting on ice; adding the ligation product (or plasmid), mixing, and standing on ice for 30min; heat shock is carried out for 95sec in a water bath at 42 ℃, and the water is taken out rapidly and is subjected to ice bath for 2min;

400 mu L of LB liquid medium without antibiotics is added, and the culture is carried out for 60min at 37 ℃ at 180 r/min; 300 mu L of the culture medium is coated on LB plates with corresponding resistance, and the culture medium is inverted and cultured for 10 to 12 hours at 37 ℃.

3. Expression and purification of protein 229320

Converting the prokaryotic expression plasmid pET28a-229320 successfully constructed into an escherichia coli expression competent strain BL21 (DE 3), coating the converted bacterial liquid on a LB plate with kana resistance, culturing overnight at 37 ℃, picking single bacterial colony, performing expanded culture, setting four different expression conditions with the final concentration of 0.1mM IPTG, respectively at 37 ℃ and 180r/min, and inducing for 4 hours; inducing for 4h at 16 ℃ at 180 r/min; the induced group and the uninduced group after induction expression are collected at 16 ℃ for 16 r/min and 180r/min, the supernatant is discarded, SDS-PAGE analysis is carried out after sample treatment (precipitation is resuspended by 40 mu L of PBS, 50 mu L of loading buffer solution and 10 mu L of DTT are added and boiled for 10 min), the result is shown in FIG. 3, the induction is optimal at 16 ℃ for 180r/min and a thicker protein band is arranged at 38.8kDa, and the recombinant plasmid pET28a-229320 is smoothly expressed in competent strain BL21 (DE 3). pET28a-229320 expressing bacteria were cultured and induced under the same conditions as described above, then subjected to pressure disruption (1000 bar disruption 3 times at 4 ℃) and centrifuged at 9000r/min for 40min to separate the supernatant and inclusion bodies, and the supernatant and inclusion body samples were treated and then subjected to SDS-PAGE analysis, the results of which are shown in FIG. 4. The results of this analysis indicate that the vast majority of pET28a-229320 is expressed in the supernatant.

Expanding culture of pET28a-229320 expression strain, adding Inducer (IPTG) with final concentration of 0.1mM at 16deg.C for induction for 14h, centrifuging to collect thalli, crushing thalli with a pressure crusher, centrifuging at 4deg.C to obtain supernatant, filtering the supernatant with a 0.45um filter, combining with his-tag affinity chromatographic column for 1h, eluting protein from low to high concentration with imidazole, dialyzing the eluted protein with PBS for three days, performing Western blot analysis, concentrating with sucrose, and measuring protein concentration with BCA kit.

Availability WB identification of 4.229320 protein

The purified pET28a-229320 protein is run on two protein glues and transferred to a membrane, the standard positive pig serum infected by toxoplasma oocysts and the standard positive pig serum infected by toxoplasma tachyzoites are respectively incubated according to a ratio of 1:500 overnight, goat anti-pig HRP secondary antibody is 1:5000 normal temperature shaking table for 1h, and ECL chromogenic liquid is finally added, and as a result, as shown in figure 6, the positive pig serum infected by the oocysts has obvious target bands, while the positive pig serum infected by the toxoplasma tachyzoites does not.

Example 2: establishing a rapid and accurate porcine toxoplasmosis oocyst infection on-site diagnosis method (229320-iELISA)

1. Detection condition optimization

(1) Determination of antigen coating concentration and serum dilution: the 229320 protein was diluted in a gradient of 16. Mu.g/mL, 8. Mu.g/mL, 4. Mu.g/mL, 2. Mu.g/mL, 1. Mu.g/mL, 0.5. Mu.g/mL, 0.25. Mu.g/mL, respectively, to coat the ELISA plate, and each concentration was coated with a column of 7 wells. The negative and positive control sera were diluted with incubation solutions at 1:25, 1:50, 1:100, 1:200, 1:400, 1:800 volume ratio, respectively, with each dilution added to one row of 6 wells. The ELISA was performed according to the conventional procedure, and the OD was measured by using an ELISA reader ₆₃₀ And comparing the values of the P/N values corresponding to the antigens, and selecting the antigen coating concentration and the serum dilution multiple corresponding to the position with the maximum P/N value of the optimal antigen as the optimal condition.

(2) Optimization of optimal blocking concentration and optimal blocking time: and optimizing the blocking concentration and the blocking time according to the optimal conditions of the optimized antigen coating concentration and the optimal serum dilution. Fixing other test conditions, blocking with 0.1%, 0.5%, 1%, 2% BSA (bovine serum albumin) for 30min, 45min, 60min, 75min, performing ELISA conventional steps, reading with enzyme-labeled instrument, plotting line graph, and comparing OD ₆₃₀ The size of the P/N (positive serum/negative serum) value is selected, and the blocking concentration and the blocking time corresponding to the maximum P/N value are selected as the optimal conditions.

(3) Optimization of serum optimal action time: according to the determined conditions, fixing other test conditions, adding serum, and then respectively acting for 30min, 45min, 60min, 75min and 90min, operating according to ELISA conventional steps, and selecting serum acting time according to the P/N value.

(4) Optimization of secondary antibody optimal action concentration and time: fixing other test conditions according to the determined conditions, and respectively fixing the enzyme-labeled secondary antibodies according to the ratio of 1:1000, 1:2000 and 1: 3000. 1:4000, and the secondary antibody action concentration is selected according to the P/N value according to the conventional ELISA procedure. And similarly, fixing other test conditions, adding enzyme-labeled secondary antibodies, then respectively acting for 30min, 45min, 60min and 75min, operating according to ELISA conventional steps, and selecting the secondary antibody acting time according to the P/N value.

(5) Optimization of the optimal action time of the substrate: fixing other test conditions, respectively allowing the substrate to act for 10min, 15min, 20min, 25min and 30min, operating according to ELISA conventional steps, and selecting the substrate acting time according to the P/N value.

The final determination detection method is as follows:

1) Diluting 229320 protein to a final concentration of 2 mug/mL by using a diluent, and coating an ELISA plate;

2) Blocking the ELISA plate with 1% BSA blocking solution (optimal blocking time is 60 min);

3) Diluting pig serum by 200 times with diluent, adding an ELISA plate, and incubating at 37 ℃ for 75min;

4) Diluting the HRP-labeled goat anti-pig IgG by 2000 times with a diluent, adding an ELISA plate, and incubating at 37 ℃ for 1h;

5) Adding the color development liquid, developing at 37 ℃ in a dark place for 25min, and finally adding hydrofluoric acid to stop the reaction, and reading at the wavelength of 630 nm.

2. Determination of critical value of indirect ELISA detection kit for swine toxoplasmosis oocyst infection

20 pig serum samples which are detected as pig toxoplasma IgG antibody negative by GRA1-ELISA are detected, standard positive control and negative control are set at the same time, and OD is repeatedly detected for a plurality of times ₆₃₀ The value, and finally the critical value judgment standard of the method are determined as follows:

the Cut-off value calculating method comprises the following steps: S/N mean (X) +3 Standard Deviation (SD)

Negative-positive boundary judgment criterion: S/N is more than or equal to 2.822, and the positive result is judged; otherwise, the negative result is negative.

The detailed operation steps are as follows:

the 229320 protein was diluted with carbonate coating buffer (pH 9.6) to a final concentration of 2. Mu.g/mL, and the ELISA plate was coated overnight at 4 ℃. Each well was washed 3 times with 200ul PBS-T (0.01 mol/L PBS,0.05% Tween-20, pH 7.4) wash buffer, blocked with 1% BSA (bovine serum albumin) formulated at 37℃for 60min. Serum was diluted 1:200 with 0.1% BSA and 100uL per well was added, 3 replicates per sample, and incubated at 37℃for 75min. Then washed 3 times with PBS-T (0.01 mol/L PBS,0.05% Tween-20, pH 7.4) and HRP-labeled goat anti-pig IgG diluted 1:2000 was added at 100uL per well and incubated for 1h at 37 ℃. 100uL of color development solution (substrate buffer: TMB mother liquor=1:19, 0.2uL/mL 30% hydrogen peroxide) was added to each well and developed at 37℃in the absence of light for 25min. Finally 50ul0.25% hydrofluoric acid was added to each well to stop the reaction and read at 630nm wavelength. If sample S (sample OD ₆₃₀ ) N (negative serum OD) ₆₃₀ ) Judging positive if the ratio is more than or equal to 2.822; otherwise, the result is negative.

Example 3: sensitivity test and specificity test of pig toxoplasma oocyst infection indirect ELISA detection method

2 positive sera were each 1 according to the method of example 2: 25. 1:50, 1: 100. 1:200, 1:400, 1:800, 1:1600, 1:3200 dilutions were used for detection, and positive, negative, blank controls were set. The results are shown in Table 1. The results show that the sensitivity of the 229320-iELISA diagnosis method established by the invention is greater than 1:400. the results of the detection of swine fever positive serum, porcine reproductive and respiratory syndrome positive serum, porcine pseudorabies positive serum, porcine circovirus disease positive serum, porcine foot-and-mouth disease positive serum and porcine toxoplasma tachyzoite positive serum by the established method are shown in Table 2. The result shows that the method has good specificity, has no cross reaction with positive serum of swine fever, porcine reproductive and respiratory syndrome, porcine pseudorabies, porcine circovirus disease, porcine foot-and-mouth disease and porcine toxoplasma tachyzoite infection, and establishes positive control, negative control and blank control.

TABLE 1 sensitivity test results

TABLE 2 specificity test results

Claims (8)

1. Application of toxoplasma TGME 49-229320 protein in preparation of toxoplasmosis diagnosis kit, wherein the nucleotide sequence of the coding gene of toxoplasma TGME 49-229320 protein is shown in SEQ ID NO: 1.

2. A toxoplasmosis diagnostic kit comprising the toxoplasmosis TGME 49-229320 protein of claim 1.

3. The toxoplasmosis diagnostic kit of claim 2, which is an indirect ELISA kit for detecting toxoplasmosis oocyst infection IgG antibodies.

4. The toxoplasmosis diagnostic kit according to claim 3, further comprising a diluent, a blocking solution, a washing solution, a secondary enzyme-labeled antibody, a chromogenic solution, and a stop solution.

5. An indirect ELISA method for the detection of toxoplasma in a non-diagnostic manner, characterized in that it comprises the following steps:

1) Coating an ELISA plate after diluting toxoplasma TGME49_229320 protein in claim 1;

2) Sealing the ELISA plate by using a sealing liquid;

3) Diluting the serum sample, adding an ELISA plate, and incubating at 37 ℃ for 30-90min;

4) Adding the enzyme-labeled secondary antibody into an enzyme-labeled plate after dilution, and incubating for 30-90min at 37 ℃;

5) The color-developing solution was added to carry out a light-shielding color-developing reaction at 37℃and the reaction was terminated and read at a wavelength of 630 nm.

6. The method of detection according to claim 5, wherein: the final dilution concentration of the toxoplasma TGME49_229320 protein is 2 mug/mL; the dilution factor of the serum sample was 200-fold.

7. The method of detection according to claim 5, wherein: the blocking liquid is 1% bovine serum albumin, and the blocking time is 60min.

8. The method of detection according to claim 5, wherein: the enzyme-labeled secondary antibody is HRP-labeled goat anti-pig IgG.