CN114262681A

CN114262681A - Berberine producing strain, and establishing method and application thereof

Info

Publication number: CN114262681A
Application number: CN202010976017.6A
Authority: CN
Inventors: 王勇; 刘海利; 张前; 李建华; 孙雨伟
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2020-09-16
Filing date: 2020-09-16
Publication date: 2022-04-01
Anticipated expiration: 2040-09-16
Also published as: CN114262681B

Abstract

The invention provides a berberine production strain, an establishing method and application thereof. The invention establishes a prokaryotic host cell for fermentation production of berberine compounds by gene recombination technology, and realizes the synthesis of berberine compounds by taking prokaryotes as a chassis for the first time. The expression system established by the invention has low metabolic background, strong heterologous expression capability and low cost, and provides a new way for industrially producing berberine compounds.

Description

Berberine producing strain, and establishing method and application thereof

Technical Field

The invention belongs to the technical field of synthetic biology and industrial biology; more specifically, the invention relates to the production of plant natural products by fermentation using prokaryotes.

Background

Plant secondary metabolites have long been noticed by people due to potential advantages, but the plant secondary metabolites face the problems of high production difficulty and high cost. As one of plant metabolites, the content of alkaloid in plants is strictly regulated and controlled, and the plant metabolite shows species and genus specificity.

Berberine is a benzylisoquinoline quaternary ammonium alkaloid of the protoberberine group, and is mainly present in roots, stems and barks of Berberidaceae (Berberidaceae), Ranunculaceae (Ranunculaceae), Papaveraceae (Papaveraceae) and Rutaceae (Rutaceae) plants. As the main component of traditional Chinese medicine plant coptis, it has the functions of antibiosis and antiphlogosis. However, a great deal of research in recent years shows that berberine has therapeutic potential for various tumors, cardiovascular diseases and the like, and has high drug-forming property.

The preparation method of berberine comprises plant extraction, chemical synthesis and biosynthesis, and because berberine is similar to artemisinin and has high content in native plant (berberine in Coptidis rhizoma can be up to 7-13% and accounts for about 70% of total alkaloids), it is mainly prepared by separating and purifying from plant. However, the way of extracting bioactive ingredients from plants is limited by: 1. the planting area of the plants is small; 2. the time required for the growth of the plants is long; 3. the content of bioactive components is low; 4. large loss of extraction mode and the like. Meanwhile, although the technology of chemical synthesis is mature, there are many problems in synthesizing complex natural products, including the complexity of synthesizing some racemic compounds, and the pollution of chemical synthesis routes. Therefore, a new preparation method is needed to be found, which is a short plate for complementing plant extraction and chemical synthesis and increasing the supply of berberine.

Although higher yield can theoretically be obtained by directly metabolic engineering the original plant, the approach is often limited in practical application, including difficulties in genetic manipulation of plants and tight and complex metabolic regulation of the plant itself. With the development of metabolic engineering and synthetic biology technologies, the methods for obtaining alkaloids by biosynthesis, especially methods relying on microorganisms, have attracted extensive attention of researchers due to the rapid rise of advantages of rapid microbial propagation, high yield, environmental friendliness and the like. And the synthetic biology breaks through the limitation of species, and provides a solution for the problems.

Although the technicians in this field pay attention to the utilization of synthetic biology to synthesize berberine, more technical improvements are still needed to realize better matching and production of exogenous genes in hosts.

Disclosure of Invention

The invention aims to provide a berberine production strain, an establishing method and application thereof.

In a first aspect of the invention, there is provided a recombinant prokaryotic cell for the production of tetrahydroberberine or berberine, comprising: (a) a tyrosine hydroxylase and coenzyme tetrahydrobiopterin recycling module which generates levodopa from L-tyrosine; (b) a reticuline synthesis module that generates reticuline from levodopa; and, (c) a berberine synthesis module that generates tetrahydroberberine or berberine from reticuline.

In a preferred embodiment, (a) includes: a tyrosine hydroxylase; and, an enzyme for producing tetrahydrobiopterin from 4 α -hydroxytetrahydrobiopterin, preferably comprising: 4 alpha-hydroxy tetrahydropterin dehydratase and dihydropterin reductase.

In another preferred example, (b) includes: enzymes for synthesizing norlapatine from levodopa, preferably including dopa decarboxylase, monoamine oxidase, norcoclaurine synthase 2; and, an enzyme for the synthesis of reticuline from norlaundrine, preferably comprising: higenamine 6-oxygen methyltransferase, higenamine nitrogen methyltransferase, and 3' -hydroxy nitrogen methyl higenamine 4-oxygen methyltransferase.

In another preferred embodiment, (c) includes: an enzyme for the synthesis of tetrahydroberberine or berberine from reticuline; preferably comprising: berberine bridge enzyme 1, aureovioline 9-oxygen methyltransferase, tetrahydroberberine oxidase, cytochrome P450 oxidoreductase or cytochrome P450 oxidoreductase 2.

In another alternative, the step (c) further comprises: tetrahydroprotoberberine Oxidase (STOX).

In another preferred embodiment, the berberine bridge enzyme 1 is a truncation, wherein 10-30 (such as 12, 15, 18, 20, 25) amino acid residues at the N-terminal of the amino acid sequence are deleted.

In another preferred embodiment, the tyrosine hydroxylase is a mutant, wherein the 37 th position of the mutant is mutated into Glu, the 38 th position of the mutant is mutated into Glu, and the 166 th position of the mutant is mutated into Tyr.

In another preferred embodiment, the higenamine synthase 2 is a truncation, and 5-20 (e.g. 6, 8, 11, 13, 15, 18) amino acid residues at the N-terminal of the amino acid sequence are deleted.

In another preferred embodiment, the tetrahydroprotoberberine oxidase is a truncation, and 3-25 (e.g. 3, 6, 11, 15, 18, 24) amino acid residues at the N-terminal of the amino acid sequence are deleted.

In another preferred example, the cytochrome P450 oxidoreductase 2 is selected from among cytochrome P450 oxidoreductase and cytochrome P450 oxidoreductase 2.

In another preferred embodiment, in (a), the tyrosine hydroxylase is murine, the 4 α -hydroxytetrahydropterin dehydratase is murine, or the dihydropterin reductase is murine.

In another preferred embodiment, (b) the dopa decarboxylase is from pseudomonas putida, the monoamine oxidase is from micrococcus luteus, higenamine synthase 2 is from coptidis rhizoma, higenamine 6-oxygen methyltransferase is from poppy, higenamine nitrogen methyltransferase is from poppy, or 3' hydroxy nitrogen methyl higenamine 4-oxygen methyltransferase is from coptidis rhizoma.

In another preferred embodiment, (c) berberine bridge enzyme 1 is from poppy, aureovioline oxygen methyltransferase from coptidis japonica, tetrahydroberberine oxidase from coptidis japonica, cytochrome P450 oxidoreductase 2 from arabidopsis thaliana, cytochrome P450 oxidoreductase from poppy, or tetrahydroprotoberberine oxidase from berberis manihot.

In another preferred embodiment, in (a), the genes encoding tyrosine hydroxylase and the enzyme for producing tetrahydrobiopterin from 4 α -hydroxytetrahydrobiopterin are introduced into the cell after being operably linked to a construct, preferably a construct based on pACYC.

In another preferred embodiment, in (b), the gene encoding the enzyme for synthesizing norlapatine from levodopa and the gene encoding the enzyme for synthesizing reticuline from norlapatine are introduced into the cell after being operably linked to the same construct, preferably the construct is based on pET21 a; or the gene encoding the enzyme for synthesizing norlapatine from levodopa is co-introduced into the cell after being operably linked to one construct and the gene encoding the enzyme for synthesizing reticuline from norlapatine is operably linked to another construct; preferably the construct is based on pHJ352 or pET21 a.

In another preferred embodiment, (c) the gene encoding the enzyme for the synthesis of tetrahydroberberine or berberine from reticuline is introduced into the cell after being operably linked to the same construct, preferably the construct is based on a His-tag containing vector, more preferably pET28a or pACYC-duet.

In another preferred embodiment, the expression of the construct is controlled by the T7 promoter or the T7 terminator.

In another preferred embodiment, the recombinant prokaryotic cell comprises escherichia coli, bacillus subtilis, streptomyces; more preferably, the recombinant prokaryotic cell is Escherichia coli.

In another preferred embodiment, the cell further comprises an upstream pathway for L-tyrosine synthesis; preferably, it comprises: l-tyrosine is produced from glucose or glycerol through glycolysis, the pentose phosphate pathway, and the shikimate pathway.

In another preferred embodiment, the cells are cultured by adding exogenous L-tyrosine to the medium.

In another preferred embodiment, when the gene encoding the enzyme is expressed, the expressed gene is operably linked to the same expression cassette and is expressed by a promoter; or the expression genes are respectively connected with the promoters to form an expression cassette and are operably connected with the construction body.

In another preferred example, the synthetic route of L-tyrosine is an endogenous route of Escherichia coli, or a route which is artificially modified on the basis of the endogenous route to enhance the synthesis of L-tyrosine.

In another preferred embodiment, the gene encoding the enzyme may be a gene codon-optimized for prokaryotic cells such as E.coli.

In another aspect of the invention, there is provided the use of said recombinant prokaryotic cell for the production of tetrahydroberberine or berberine; preferably, for converting L-tyrosine or its upstream substrates (e.g. glucose, shikimate pathway products) into tetrahydroberberine or berberine.

In another aspect of the present invention, there is provided a method for producing tetrahydroberberine or berberine, the method comprising: (1) providing a recombinant prokaryotic cell as described in any of the preceding paragraphs; and, (2) culturing the recombinant prokaryotic cell of (1) to produce tetrahydroberberine or berberine.

In a preferred embodiment, (2) the cells are cultured in a system in which L-tyrosine or a synthetic L-tyrosine upstream substrate is added; preferably, the synthetic L-tyrosine upstream substrate comprises: glucose, glycerol.

In another preferred embodiment, the recombinant prokaryotic cell produces glycerol as a carbon source.

In another preferred embodiment, the fermentation time of the recombinant prokaryotic cell is 1 to 20 days, preferably 2 to 15 days, and more preferably 2.5 to 10 days (e.g., 3,4, 5, 6, 7, 8, 9 days).

In another preferred embodiment, the concentration of L-tyrosine in the culture system is: 0.05 to 50g/L, preferably 0.1 to 40g/L, more preferably 0.2 to 20 g/L. The concentration in the culture system is, for example, 0.3g/L, 0.5g/L, 0.8g/L, 1g/L, 1.2g/L, 1.5g/L, 2g/L, 3g/L, 5g/L, 10g/L, 15g/L, 30g/L, etc.

In another preferred example, the method further comprises: separating the hydrogenated berberine or berberine from the reaction product.

In another aspect of the invention, there is provided a kit for producing tetrahydroberberine or berberine, comprising a recombinant prokaryotic cell as defined in any one of the preceding claims.

In another aspect of the present invention, there is provided a kit for producing tetrahydroberberine or berberine, comprising an expression construct of the group consisting of:

construct 1 comprising, operably linked, a tyrosine hydroxylase and a gene encoding an enzyme that produces tetrahydrobiopterin from 4 α -hydroxytetrahydropterin; preferably comprising: coding genes of tyrosine hydroxylase, 4 alpha-hydroxy tetrahydropterin dehydratase and dihydropterin reductase; preferably, it is based on pACYC;

construct 2, comprising genes encoding an enzyme that synthesizes norloratadine from levodopa and an enzyme for synthesizing reticuline from norloratadine; preferably includes coding genes of dopa decarboxylase, monoamine oxidase, higenamine synthase 2, higenamine 6-oxygen methyltransferase, higenamine nitrogen methyltransferase, and 3' -hydroxyl nitrogen methyl higenamine 4-oxygen methyltransferase; preferably the construct is based on pET21 a;

construct 3, comprising a gene encoding an enzyme that synthesizes tetrahydroberberine or berberine from reticuline; preferably comprises berberine bridge enzyme 1, aureovioline-9-O-methyltransferase, tetrahydroberberine oxidase, cytochrome P450 oxidoreductase or cytochrome P450 oxidoreductase 2; optionally, a gene encoding tetrahydroprotoberberine oxidase is also included; preferably the construct is based on pET28a or pACYC-duet.

In another preferred embodiment, the kit further comprises: prokaryotic cells or cell cultures; preferably, the prokaryotic cell comprises escherichia coli, bacillus subtilis and streptomyces; more preferably, the prokaryotic cell is E.coli.

In another preferred embodiment, the kit further comprises: l-tyrosine or an upstream substrate capable of producing L-tyrosine.

In another preferred embodiment, the kit further comprises: an expression inducer.

In another preferred embodiment, the kit further comprises: and (3) a basic culture medium.

In another aspect of the invention, the use of said kit is provided for the production of tetrahydroberberine or berberine.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1 shows the construction of plasmids involved in berberine synthesis.

FIG. 2 shows a standard curve of reticuline and downstream metabolites plotted based on liquid chromatography detection.

FIG. 3 shows the anabolic pathway of berberine in E.coli.

FIG. 4 shows SDS-PAGE gels and WesternBlot profiles of reticuline synthesis-related enzymes.

Figure 5 shows the engineering of berberine bridge enzyme BBE.

FIG. 6 shows SDS-PAGE gels and WesternBlot profiles of berberine downstream biosynthetic pathway enzymes.

FIG. 7 shows the qualitative analysis result of the fermentation liquid components of the engineering bacteria based on mass spectrometric detection.

Figure 8 shows standard curves for tetrahydroberberine and berberine based on mass spectrometric detection.

FIG. 9 shows the yield (mg/L) of reticuline produced by fermentation of the engineered bacterium SQZ 07.

FIG. 10 shows the chromatographic detection result of the fermentation liquid components of the engineering bacteria SQZ 09.

FIG. 11 shows the mass spectrometric detection results of fermentation broth components of berberine-producing engineering bacteria.

Detailed Description

Through intensive research, the inventor establishes a prokaryotic host cell for fermentation production of berberine compounds by a gene recombination technology, and realizes the synthesis of berberine compounds by taking prokaryotes as a chassis for the first time. The expression system established by the invention has low metabolic background, strong heterologous expression capability and low cost, and provides a new way for industrially producing berberine compounds.

Term(s) for

As used herein, the term "operably linked" or "operably linked" refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: the promoter region is placed in a specific position relative to the nucleic acid sequence of the gene of interest such that transcription of the nucleic acid sequence is directed by the promoter region, whereby the promoter region is "operably linked" to the nucleic acid sequence.

As used herein, the term "expression cassette" or "gene expression cassette" refers to a gene expression system that contains all the necessary elements required for expression of a polypeptide of interest, typically including the following elements: a promoter, a gene sequence encoding a polypeptide, a terminator; in addition, the protein also can selectively comprise a signal peptide coding sequence and the like; these elements are operatively connected.

As used herein, the term "expression construct" or "expression construct" refers to a recombinant DNA molecule comprising a desired nucleic acid coding sequence, which may comprise one or more gene expression cassettes. The "construct" is typically contained in an expression vector.

As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein (polypeptide) sequences from different sources, or the relationship between a nucleic acid or protein from different sources and a host cell. For example, a nucleic acid is foreign to a host cell if the combination of the nucleic acid/protein and the host cell is not normally naturally occurring. A particular sequence is "foreign" to the cell or organism into which it is inserted.

As used herein, berberine also includes berberine compounds. The berberine compounds may also be variations on the berberine compounds disclosed herein, including precursors thereof such as tetrahydroberberine, or derivatives thereof. For example, the parent nuclear structure of the compound remains unchanged, but substitution of groups (e.g., aliphatic hydrocarbon groups containing 1 to 4 carbon atoms, preferably 1 to 2 carbon atoms) occurs at individual (e.g., 1 to 3, 1 to 2) positions.

Enzyme combination and expression system thereof

The main principle of the technical scheme of the invention is as follows: by integrating: tyrosine hydroxylase and coenzyme tetrahydro single pterin circulating regeneration module, reticular annonaceous acetogenins synthesis module and berberine synthesis module, to produce berberine compounds. The synthetic route of berberine is shown in figure 3. In a preferred manner, the inventors have optimized some enzymes and processes so that the three large modules are well compatible, fit and work within the host.

As one of three major modules established by the inventor, the circulating regeneration module of tyrosine hydroxylase and coenzyme tetrahydrobiopterin is used for generating levodopa from L-tyrosine and comprises the following components: tyrosine hydroxylase (TyrH); and, an enzyme for producing tetrahydrobiopterin from 4 α -hydroxytetrahydrobiopterin, preferably comprising: 4 alpha-hydroxy tetrahydropterin dehydratase (Pcbd1), dihydropterin reductase (QDHPR).

As a second of the three modules established by the present inventors, the reticuline synthesis module is used to generate reticuline from levodopa, comprising: enzymes for the synthesis of norlapatine from levodopa: dopa decarboxylase (DODC), monoamine oxidase (MAO), higenamine synthase 2 (NCS); and, an enzyme for the synthesis of reticuline from norlaundrine: higenamine 6-oxygen methyltransferase (6OMT), higenamine N-methyltransferase (CNMT), and 3 '-hydroxy N-methyl higenamine 4-oxygen methyltransferase (4' OMT).

As a third of the three major modules established by the inventor, the berberine synthesis module is used for generating berberine from reticuline, and comprises: enzymes for the synthesis of berberine from reticuline: berberine bridge 1(BBE), corydaline-9-O-methyltransferase (9' OMT), tetrahydroberberine oxidase (CAS), cytochrome P450 oxidoreductase (CPR) or cytochrome P450 oxidoreductase 2(CPR 2).

In the berberine synthesis module, after the hydrogenated berberine is generated, the berberine can be formed endogenously based on the redox characteristics of the hydrogenated berberine; an enzyme promoting the formation of berberine by hydrogenating berberine can also be further introduced, and is tetrahydroprotoberberine oxidase. Therefore, as an alternative mode of the invention, the berberine synthesis module can further comprise tetrahydroprotoberberine oxidase (STOX).

The inventor finds in research that although the synthesis of reticuline can be realized in escherichia coli, the synthesis of berberine in escherichia coli is seriously hindered due to the obvious expression obstacle of cytochrome P450 oxidase and flavoprotein oxidase in prokaryotes. On the basis, the inventor optimally selects cytochrome P450 oxidase and optimally modifies flavoprotein oxidase.

Therefore, in a preferred embodiment of the present invention, the flavoprotein oxidase is berberine bridge enzyme 1, which is a truncated form, and at least 10-30 (e.g., 12, 15, 18, 20, 25) amino acid residues are deleted from the N-terminus of the amino acid sequence. In a preferred embodiment of the present invention, cytochrome P450 oxidoreductase 2 is selected for the reaction.

In a preferred embodiment of the invention, other enzymes are optimized, including but not limited to: the tyrosine hydroxylase is a mutant, wherein the 37 th position of the tyrosine hydroxylase is mutated into Glu, the 38 th position of the tyrosine hydroxylase is mutated into Glu, and the 166 th position of the tyrosine hydroxylase is mutated into Tyr; the higenamine synthase 2 is a truncation, 5-20 amino acid residues at the N end of the amino acid sequence of the higenamine synthase are deleted, and 3-25 amino acid residues at the N end of the amino acid sequence of the higenamine oxidase are deleted.

In the invention, the efficient production of the berberine compounds in the engineering bacteria is realized by converting the series of modules into the engineering cells (engineering bacteria).

The gene encoding the enzyme of the invention may be naturally occurring, e.g. it may be isolated or purified from a plant or microorganism. In addition, the gene can also be artificially prepared, for example, the gene can be obtained according to the conventional genetic engineering recombination technology, or the gene can be obtained by an artificial synthesis method.

The sequence information of the enzymes or nucleic acids encoding them of the present invention may be the same as that provided in tables 1 to 3 of the examples of the present invention, or may be variants or degenerate sequences thereof. "degenerate sequence" means in the present invention a nucleic acid sequence which encodes a protein having the same function but differs from the sequence information provided in Table 2 in the examples of the invention. In the present invention, a natural sequence encoding the enzyme may be used, or a sequence subjected to codon optimization may be used. The nucleic acid encoding the enzyme may comprise: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The invention also relates to variants of said enzymes which differ in amino acid sequence from their corresponding wild-type polypeptide, being single-site or multi-site variants, fragments, analogues or derivatives of the wild-type polypeptide. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

It is understood that the yield of berberine compounds can be further improved by optimizing and establishing optimized engineering bacteria by using some codon optimization methods, protein variant screening methods, enzyme activity promoting methods and the like which are well known in the art. These further optimization techniques based on the solution of the present invention should also be covered in the solution of the present invention.

In a preferred form of the invention, the tyrosine hydroxylase is murine, the 4 α -hydroxytetrahydropterin dehydratase is murine, or the dihydropterin reductase is murine; DOPAdecarboxylase is derived from Pseudomonas putida, monoamine oxidase is derived from Micrococcus luteus, higenamine synthase 2 is derived from Coptis japonica, higenamine 6-O-methyltransferase is derived from Papaver somniferum, higenamine N-methyltransferase is derived from Papaver somniferum, and 3' -hydroxy N-methyl-higenamine 4-O-methyltransferase is derived from Coptis japonica; or berberine bridge enzyme 1 is derived from poppy, corydalis violacea 9-O-methyltransferase is derived from Coptis japonica, tetrahydroberberine oxidase is derived from Coptis japonica, cytochrome P450 oxidoreductase 2 is derived from Arabidopsis thaliana, cytochrome P450 oxidoreductase is derived from poppy, or tetrahydroprotoberberine oxidase is derived from berberis thunbergii. The invention may also encompass the use of such enzymes from other microorganisms, animals or plants, provided that they are highly homologous (e.g., have greater than 80%, such as 85%, 90%, 95%, or even 98% sequence identity) to the enzymes exemplified in the examples. Methods and means for aligning sequence identity are also well known in the art, for example BLAST. "identity" refers to the level of similarity (i.e., sequence homology, similarity, or identity) between two or more nucleic acids in terms of percentage positional identity. However, it is understood that the corresponding sequence positions of the corresponding enzymes specifically optimized for overcoming the technical deficiencies of the present invention should be conserved, for example, the truncation of berberine bridge enzyme 1 is selected.

The full-length sequence of the nucleic acid encoding each enzyme of the present invention or a fragment thereof can be obtained by a PCR amplification method, a recombinant method, or an artificial synthesis method. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly the open reading frame sequences, and the sequences can be amplified. When the sequence is longer, two or more PCR amplifications can be carried out, and then the amplified fragments are spliced together according to the correct sequence.

The invention also relates to a vector containing the coding nucleic acid and a host cell produced by genetic engineering by using the vector.

In the present invention, the sequence of the nucleic acid encoding each enzyme may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector well known in the art. In general, any plasmid or vector can be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

The sequences of the coding nucleic acids of the enzymes can be respectively inserted into recombinant expression vectors, and a plurality of the recombinant expression vectors are co-transferred into host cells; the expression cassettes of multiple genes can also be inserted into the same recombinant expression vector in tandem and transferred into host cells. The recombinant expression vector may further comprise an expression control sequence operably linked to the sequence of the gene to facilitate expression of the protein. It is understood that recombinant expression vectors can be conveniently constructed by those skilled in the art having the benefit of the teachings of the present invention. The obtained recombinant expression vector is also included in the present invention.

In the expression regulation sequence or the expression cassette, an inducible or constitutive promoter can be applied according to different requirements, and the inducible promoter can realize more controllable protein expression and compound production, thereby being beneficial to industrial application.

As a preferred form of the invention, there is provided an expression cassette or recombinant construct (e.g., an expression vector) comprising the three major modules of the invention and their corresponding enzymes.

The expression vector (expression construct) can be established using techniques familiar to those skilled in the art. The establishment of the expression construct can be carried out by the person skilled in the art after knowing the enzyme of choice desired and the cell system to be expressed. The gene sequences may be inserted into different expression constructs (e.g., expression vectors) or into the same expression construct, so long as the encoded polypeptide is efficiently expressed and active after transfer into a cell.

Vectors containing the appropriate gene sequences and appropriate promoter or control sequences described above may be used to transform appropriate host cells to enable expression of the protein. In the present invention, the host cell may include a prokaryotic cell or a eukaryotic cell; preferably, the prokaryotic cell comprises Escherichia coli, Bacillus subtilis, or Streptomyces, or the eukaryotic cell comprises a fungal cell, a yeast cell, an insect cell, or a mammalian cell. In a more preferred form, the host cell is E.coli, for example E.coli BL21(DE 3).

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. The obtained transformant can be cultured by a conventional method, and the medium used in the culture can be a medium well known in the art, and cultured under conditions suitable for cell growth. In a preferred embodiment, the medium of the cells contains the reaction precursor L-tyrosine.

The present invention also provides a kit for the biosynthesis of berberine compounds comprising: the recombinant cell (engineering bacterium) constructed by the invention. Or, including: the expression cassette or recombinant construct constructed according to the invention, in this case preferably also comprises a host cell in a kit, in order to facilitate the manipulation by the person skilled in the art.

In a more preferred embodiment, the kit further comprises instructions for use of the method for performing biosynthesis.

The recombinant cells obtained by the gene recombination technology have the characteristics of low metabolic background, strong heterologous expression capacity, low cost, easy separation and the like, can synthesize end products by relatively simple steps, solve the problems of the traditional biological and chemical synthesis methods to a great extent, and provide a new way for the industrial production of berberine drugs.

The recombinant engineering bacteria constructed in the invention have good adaptability and compatibility with each exogenously introduced enzyme, good expression activity and catalytic activity, and development and application potential. It is understood that the technical solutions obtained by further improving the structure or function of the enzyme on the basis of the present invention are also included in the present invention.

In the field, saccharomyces cerevisiae is taken as a base plate, people synthesize tetrahydroberberine and berberine by taking norlapatine as a substrate, synthesize 1.8mg/L tetrahydroberberine by shake flask culture in a 12.5mL system by taking 1mM (about 287mg/L) norlapatine as the substrate, and simultaneously detect 6.5 mug/L of spontaneously formed berberine. However, in the actual production process, the cost of taking the norlapatine as a substrate is relatively high, and the norlapatine is easily oxidized in the alkaline environment of fermentation liquor due to the presence of catechol groups. The invention uses tyrosine as a substrate, so that the cost can be greatly reduced and the method is relatively stable. In the small-scale fermentation verification of the invention, the fermentation system of 10mL and the shake flask fermentation with 500mg/L tyrosine as the substrate obtain 5.36mg/L tetrahydroberberine, and the berberine of 0.59mg/L, which is obviously superior to the yield of the tetrahydroberberine and berberine synthesized in yeast.

Method for synthesizing berberine

Based on the new discovery of the inventor, the invention discloses a method for heterologously synthesizing berberine by using microorganisms. The method comprises the following steps: culturing the recombinant cell constructed by the invention to produce berberine. In the technical scheme of the invention, the synthetic route of the berberine compounds can be shown in figure 3.

In the synthetic route, L-tyrosine is used as a reaction precursor, and the concentration of the L-tyrosine in a culture system is as follows: 0.05 to 50g/L, preferably 0.1 to 40g/L, more preferably 0.2 to 20 g/L. Depending on the scale of fermentation and the fermentation conditions, the amount of the precursor may be adjusted by those skilled in the art, and this is also included in the present invention.

In addition, in prokaryotic cells, there are also included upstream production pathways for L-tyrosine, including, for example: l-tyrosine is produced from glucose or glycerol through glycolysis, pentose phosphate pathway, shikimate pathway. It is understood that schemes based on such pathways to form L-tyrosine are also encompassed by the present invention. Methods for enhancing the formation of the L-tyrosine pathway by means known in the art may be included in the present invention.

On the basis of establishing the strain and expressing, the technicians in the field can also systematically research a series of factors for improving the yield of the berberine, including the efficiency and the suitability of genes, the gene dosage and the culture medium. In addition, the production scale can be enlarged to improve the yield of berberine. For example, on the basis of the yield under shake flask scale, simple culture conditions, the yield can be increased by 2-1000 times when further scaling up the production scale, performing medium feeding schemes (which can continuously provide abundant substrates) or giving good fermenter level production conditions (such as optimal control of temperature, optimal control of dissolved oxygen, etc.). These modes of operation and optimization are also intended to be encompassed by the present invention. It is expected that the recombinant prokaryotic cells of the present invention will have a substantial increase in the amount of the desired product in some optimized equipment and procedures.

In another preferred mode of the present invention, glycerol is used as a carbon source; more preferably, the culture of the engineered bacteria is performed at a glycerol concentration of 1.5 to 4% by volume, more particularly about 2%. The basal medium used for fermentation may be a commercial medium such as, but not limited to: M9Y medium, M9 medium, TB medium, LB medium, etc.

After obtaining the fermentation product, extraction of berberine from the fermentation product may employ techniques known in the present invention. The product may be analytically identified using well known techniques such as high performance liquid chromatography to confirm that the desired compound is obtained.

The main advantages of the invention are:

the method for producing the berberine compounds by using the prokaryotic cells, particularly the escherichia coli, for the first time solves the problems that the berberine compounds extracted by plants consume a large amount of plant raw materials, are limited by seasonal regional factors, have low extraction efficiency and the like; and adverse factors such as more byproducts, low activity of target products, large environmental pollution and the like in the chemical synthesis method are avoided. Although the invention uses the prokaryotic cell, the invention avoids the problem of low activity when the enzyme is expressed in the prokaryotic cell in a heterologous way, is particularly suitable for the large-scale synthesis of the berberine compounds, and opens up a new way for the industrial production of the compounds.

The invention skillfully utilizes endogenous coenzyme of prokaryotic hosts, particularly escherichia coli to replace tetrahydrobiopterin for the first time, and realizes the active expression of tyrosine hydroxylase by means of an exogenous coenzyme regeneration system.

Although the inventor does not successfully utilize prokaryotic hosts to produce berberine at the beginning of research, the inventor finds the reason after intensive research, and builds a truncation body by modifying the first enzyme of a berberine synthesis module, thereby overcoming the problem of incapability of expression.

The invention can produce berberine compounds from low-cost substrates, overcomes the defects of high cost, environmental pollution and single product in the prior art, and provides a production method of berberine with low cost, environmental protection and single product.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

1. The invention relates to a strain and a plasmid

Escherichia coli DH10B was used as cloning host for plasmid construction process, Escherichia coli BL21(DE3) as expression host for detecting expression of single gene plasmid, and as original strain for fermentation: the fermentation product is detected by the co-transformation of a plurality of modular plasmids. Vector backbone selection, 3 different resistances, respectively ampicillin resistant plasmid pET21a, kanamycin resistant plasmid pET28a, chloramphenicol resistant plasmid pACYC-Duet, and apramycin resistant plasmid from this laboratory modified plasmid pHJ 352.

pHJ352 construction of plasmid: a replicon-deleted 3.1kb fragment was obtained by PCR using pJF25 (prepared by replacing the ampicillin resistance gene of the conventional pET21c plasmid with an apramycin resistance gene) as a template and HJ335-VF/R as a primer. PCR was performed using pACYC184 as a template and HJ335-inF/R as primers to obtain a 1.1kb fragment containing the p15a replicon. The two fragments are connected by a seamless splicing kit to construct a plasmid.

HJ335-VF：GCCAATCGACTGGCGAGC(SEQ ID NO:1)；

HJ335-VR：TCACTGCCCGCTTTCCAG(SEQ ID NO:2)；

HJ352-inF：GAAAGCGGGCAGTGAGTTTTTGAGGTGCTCCAG(SEQ ID NO:3)；

HJ352-inR：CGCCAGTCGATTGGCAGCTCACTCATTAGGCAC(SEQ ID NO:4)。

2. Selection of enzymes

(1) Enzyme gene related to reticuline synthesis

The enzyme catalyzing hydroxylation of L-tyrosine to produce levodopa (L-DOPA) was originally selected using Tyrosinase from Ralstonia solanacearum, Tyrosinase of Ralstonia solanacearum (TYR, GenBank access number: AL 646052). The enzyme is easy to oxidize compounds containing catechol groups, such as downstream L-DOPA, Dopamine (Dopamine), 3, 4-dihydroxyphenylacetaldehyde (3,4-DHPAA) and the like in the pathway to generate phenolic compounds, and the accumulation of downstream metabolites is influenced. Therefore, in the synthesis of berberine, the tyrosine hydroxylase from Rattus norvegicus, Rattus norvegicus tyrosine hydroxylase (TyrH, UniProtKB: P04177) is selected, and the feedback inhibition of the amino acid mutation (mu) of three sites (R37E, R38E and W166Y) is released, so that the activity of the tyrosine hydroxylase is improved. However, tyrosine hydroxylase activity in mammals often requires the involvement of the coenzyme tetrahydrobiopterin (BH 4), and the same effect can be achieved by the coenzyme tetrahydrobiopterin (MH4) endogenous to Escherichia coli, so the inventors introduced the MH4 regeneration pathway only in Escherichia coli. MH4 formed 4 α -hydroxytetrahydropterin during the hydroxylation of tyrosine, followed by murine 4 α -hydroxytetrahydropterin dehydratase, Rattus norvegicus pterin-4 alpha-carbonolamine dehydratase 1(Pcbd1, NCBI access: NP-001007602), which catalyzed the dehydration of 4 α -hydroxytetrahydropterin to dihydrobiopterin. Subsequently, the murine dihydropterin reductase, Rattus norvegicus quinaldine reductase (QDHPR, UniProtKB: P11348), was used to catalyze the formation of dihydromonoterpin from dihydromonoterpin. Through the participation of the enzymes, the hydroxylation of tyrosine and the coenzyme regeneration are realized.

An enzyme catalyzing decarboxylation of L-DOPA to Dopamine (Dopamine) is selected from DOPA decarboxylase derived from Pseudomonas putida, DOPA decaxylase from Pseudomonas putida KT2440(DODC, GenBank accession BK 006920.1). An enzyme catalyzing the production of 3, 4-dihydroxybenzaldehyde (3,4-DHPAA) from dopamine, Monoamine oxidase derived from Micrococcus luteus, Monoamine oxidase of Micrococcus luteus (MAO, UniProtKB: C5CB11), was selected. To this end, L-tyrosine can catalyze the formation of two precursors of reticuline synthesis, dopamine and 3, 4-DHPAA.

Noruramine synthase 2, which catalyzes the condensation of dopamine and 3, 4-dihydroxyphenylacetaldehyde to norlaudanine, is derived from Coptis japonica, Norcoclaurine synthase 2of CjPR10A from Coptis japonica (NCS, UniprotKB: A2A1A 1). Enzymes catalyzing the production of 3' hydroxylinderane from norlappaconitine, an oxymethyltransferase at the 6-position of norlinderane from opium poppy, Norcoclaurine 6-O-methyl ransferase of Papaver somniferum (6OMT, UniprotKB: Q6WUC1), were selected. The enzyme catalyzing 3 'hydroxyadenine to produce 3' hydroxyaminomethyluranine is selected from the group consisting of the alkaloid azamethyltransferase from Papaver somniferum, Coclaurine N-methylistransferase of Papaver sodium (CNMT, UniprotKB: Q7XB 08). An enzyme catalyzing 3 ' hydroxyaminomethyluranine to generate reticuline is selected from the 3 ' hydroxyaminomethyluranine-4-position oxymethyltransferase, 3 ' -hydroxy-N-methylclavine-4 ' -O-methylransferae of Coptis japonica (4 ' OMT, UniProtKB: Q9LEL5) derived from Coptis japonica. Thus, the colibacillus takes tyrosine as a substrate, and under the participation of the enzyme, reticular annonaceous acetogenins can be obtained through fermentation. The enzymes used in the examples and their sources are summarized in tables 1 to 2.

TABLE 1 tyrosine hydroxylase and MH4 circulating modular enzyme

TABLE 2 reticuline Synthesis Module enzyme

(2) Enzyme gene related to berberine synthesis

Enzymes catalyzing reticuline to produce aureovioline are selected from papaverine-derived berberine bridge enzyme 1, reticuline oxidase: BBE1 of Papaver somniferum (BBE, GenBank: AF 025430).

An enzyme catalyzing the formation of tetrahydroafrican tetrandrine from corydaline is selected from (S) -scoulerine 9-O-methytranferase of Coptis japonica (9' OMT, GenBank: D29809) from corydalis aurantiacae 9-O-methytranferae.

An enzyme catalyzing tetrahydroAfrican tetrandrine to generate tetrahydroberberine, is selected from Coptis japonica tetrahydroberberine oxidase, Canadine synthase (CYP719A1) of Coptis japonica (CAS, GenBank: AB 026122).

Enzymes for reducing cytochrome P450 in the oxidized state, selected from cytochrome P450 oxidoreductase 2of Arabidopsis thaliana or cytochrome P450 oxidoreductase of Papave origin, Arabidopsis thaliana P450 reductase 2(AtCPR2, NCBI: NM-179141.2), Papaver somniferum NADPH: ferribioprotein oxidase (PsCPR, GenBank: U67185.1).

The enzyme gene is utilized to catalyze the reticuline to generate the final product berberine. The enzymes used in the examples and their sources are summarized in Table 3.

TABLE 3 Berberine Synthesis Module enzymes

3. Construction of plasmids

Construction of plasmids containing a single Gene: firstly, NdeI restriction sites are added at the nitrogen end of the synthesized gene, SpeI and BamHI sites are added at the carbon end, pET21a is selected as a vector framework, and the plasmid and the gene are connected after being cut by NdeI and BamHI. In the early stage of plasmid construction, the present inventors initially constructed all genes in pET21a vector, and then judged the expression of the genes as a result of polyacrylamide gel electrophoresis and Coomassie blue staining. However, the inventors found that it is difficult to see whether the gene is expressed by ordinary staining for some proteins that are difficult to express or have low expression levels, and after comparing the analysis of some candidate vectors, the inventors replaced the vectors for some genes with vectors containing His tags, such as pET28a or pACYC-Duet vectors, and determined whether the protein is expressed by hybridizing the antibody with the protein containing histidine tags by immunoblotting experiments.

When a plasmid containing a plurality of genes connected in series is established, the genes are connected in series in a BioBrick mode, and the genes are connected in series based on BglII and BamHI isocaudarner enzyme combination to construct a plasmid, a norlaudane module pQZ21 and a methyltransferase module pQZ16, wherein each gene is preceded by a T7 promoter. Then, genes are connected in series by utilizing the combination of homologous enzymes of SpeI and XhoI, and the plasmids are constructed into an operator mode: norlaudanine module pQZ23 and methyltransferase module pQZ 22. Genes involved in the berberine synthesis module are all in an operator mode and are constructed by utilizing the combination of the isocaudarner enzymes of SpeI and XhoI. The details of the plasmids are shown in tables 4 to 5; the plasmid construction is shown in FIG. 1.

TABLE 4 plasmid information containing Individual genes for protein expression

Table 5 plasmids referred to in the examples

In the table, "opt" is a sequence optimized by codon preference of escherichia coli; "trun" means truncation; "mu" is an abbreviation for "mutation".

4. Protein expression and Western Blot detection

BL21(DE3) was transformed with the expression vector containing the single gene, cultured at 37 ℃ for 12 hours, and then the single clone was picked from the plate and cultured in 2mL of LB resistant medium at 37 ℃ for 10 hours with shaking at 250rpm as seed liquid. Inoculating the seed liquid 2% in LB resistant culture medium 10mL, 37 deg.C, 250rpm to OD₆₀₀After cooling sufficiently, 0.6 was induced with 0.1mM IPTG at 22 ℃ and 250rpm, and cultured with shaking for 16 to 20 hours.

1mL of E.coli fermentation broth containing the reticuline upstream gene was harvested, and 1mL of bufferA A (20mM Tris-HCl (pH 8.0), 100mM NaCl) was added thereto to resuspend and mix the mixture.

And (2) adding 1mL of bufferA to 10mL of escherichia coli fermentation liquor containing the reticuline downstream gene for synthesizing, completely collecting bacteria from 10mL of bacterial liquid, then adding 1% of 100mM PMSF (protease inhibitor), uniformly mixing, standing on ice for 30min, performing ultrasonic treatment for 2-3 times for 5 s/time, sampling for 50 mu L, and temporarily placing on ice to mark as a whole cell sample.

The sample after ultrasonic bacteria breaking is centrifuged at 12000rpm for 10min at 4 ℃, and the supernatant is taken and placed on 80 mu L of ice to be marked as a soluble protein sample. Adding 20 mu L of 5 xSDS loading buffer solution into a soluble sample, mixing uniformly, adding 50 mu L of 5 xSDS loading buffer solution into a whole cell sample, mixing uniformly, boiling in boiling water for 10min, 12000rpm, centrifuging for 3min, loading a marker: 5. mu.L, 5. mu.L whole cell sample, 10. mu.L supernatant sample. Electrophoresis for 100v and 20 min; 160v, after 60min, the expression of the gene was examined by Coomassie blue staining or WesternBlot.

5. Production of berberine by fermentation of escherichia coli

Preparation of fermentation strains: the constructed plasmid is transformed into escherichia coli BL21(DE3), after 12h of inverted culture at 37 ℃, positive clones are selected and cloned in 2mL of LB resistant culture medium, and the culture is carried out at 37 ℃ and 250rpm for 10h to prepare fermentation seed bacteria, and the detailed information of the fermentation engineering bacteria is shown in Table 6.

TABLE 6 strains involved in the present invention

Transferring 5% of the seed solution into 10mL of TB (TerrificBroth) culture medium containing 2% of glycerol (corresponding antibiotics, 0.1mM IPTG and 0.5mg/mL L-tyrosine are added into the culture medium firstly), fermenting for 5 days at 22 ℃ and 250rpm, sampling for 1mL, ultrasonically crushing the bacterial solution for 3 times, uniformly mixing and extracting twice by using equal volume of n-butyl alcohol, carrying out 12000rpm for 2min, centrifugally transferring an organic phase to a new tube at room temperature or 30 ℃, adding 100 mu L of methanol for redissolution (concentrating by 10 times), fully mixing uniformly, carrying out 12000rpm, and transferring supernatant UPLC and UPLC-QTOF/MS for detection after 2 min.

6. Detection analysis of samples

UPLC detection, column: c18 (250X 4.6mm, 5 μm), detection conditions: the column temperature is 30 ℃, and the flow rate is 1 mL/min; UV 235&280 nm. The mobile phase composition is B: deionized water (0.1% formic acid), C: acetonitrile (0.1% formic acid), mobile phase gradient setup: 0-10min, 5-40% C; 10-16min, 40-65% C; 16-16.1min, 65-95% C; 16.1-19.0min, 95% C; 19.0-19.1min, 95-5% C; 19.1-22.0min, 5% C. The sample loading of the fermentation broth was 10. mu.L. Drawing a standard curve, preparing 500mg/L standard substance mixed solution, and diluting step by step to prepare the following concentrations: 250mg/L, 100mg/L, 50mg/L, 20mg/L, 10mg/L, 5mg/L and 1mg/L, and drawing a standard curve according to the relation between the peak area of ultraviolet absorption and the sample loading amount by using 2 mu L of the standard sample. The standard curve is shown in fig. 2.

LC-MS/MS detection is used for qualitative and quantitative analysis of compounds with lower content in fermentation liquor. Instrument Agilent LC1260&1290-MS/QTOF6545, chromatographic column Agilent infinitityLab poroshell120EC-C18 (3X 150mm, 2.7 μm), test conditions: the column temperature is 30 ℃, the flow rate is 0.3mL/min, and the UV 235 is more than 280 nm. Mobile phase setting: a: (0.1% formic acid) water; b: (0.1% formic acid) acetonitrile, mobile phase gradient: 5% B (0-0.8 min); 5-98% B (0.8-12 min); 98% B (12-15 min); 98-5% B (15-15.5 min). The loading was 1.2. mu.L. And (3) setting other parameters: positive ion mode, ion source: GasTemp 300 ℃, flow rate: 6 l/min; pressure: 30 psig; shear GasTemp 320 deg.C; flow rate: 11L/min; pressure: 30 psig. Fragment 135V; skimmer 65V; oct1RFVpp: 750V; vcap 3500V; 1000V for Nozle Voltage; scan (m/z) 100-; 2-order mass spectrometry collision energy: 0eV, 10eV, 20eV, 40 eV.

Example 1 expression and optimization of genes involved in Berberine Synthesis

The process of synthesizing berberine by Escherichia coli with L-tyrosine as substrate requires 11 steps of reaction, and FIG. 3 provides a schematic diagram of metabolic pathway for synthesizing berberine by Escherichia coli. The whole reaction process can be divided into two stages, namely a synthesis stage of reticuline and a synthesis stage of downstream products, such as berberine and the like.

The present invention relates to a pathway in which 3 methyltransferases are present: 4OMT, 6OMT and CNMT, the coding genes of the three enzymes have the size of about 1000bp, the expression product is about 40kDa and has approximate size, and if the protein expression is directly detected from the fermentation liquor on the tandem plasmid, whether all the genes are expressed is not easy to judge; same as DODC and MAO expression; thus, the present inventors carried out plasmid construction of individual genes to carry out gene expression analysis.

The present inventors first synthesized the genes involved using de novo synthesis of reticuline in E.coli. The synthesized genes are respectively constructed in pET21a vectors, T7 is used as a promoter, and for genes of tyrosine hydroxylase and coenzyme regeneration pathways, pET28a or pACYC-duet vectors are used for detecting protein expression through an N-terminal His-tag label. Under the same culture conditions, the genes involved in reticuline synthesis were all expressed, and the results are shown in FIG. 4.

Then, the present inventors expressed proteins in the downstream pathway one by one, and introduced the coding gene of each protein one by one into pET28a for expression. The present inventors found that, in addition to BBE, genes encoding other proteins are expressed. Meanwhile, combining with experimental phenomena, the inventor finds that the full-length BBE protein is toxic to cells, inhibits the growth of thalli and has relatively low protein expression level.

Thus, the inventors decided to engineer the BBE. The specific engineering strategy is as follows: first, amino acid structural analysis was performed to find that the nitrogen terminal of the BBE gene has a hydrophobic signal peptide region. Subsequently, the N-terminal 25 amino acid truncation is carried out by combining the truncation strategy of BBE in Saccharomyces cerevisiae. The truncated BBE gene is induced to express under the same culture condition, and a remarkable band can be seen, which indicates that the truncation of the BBE can obviously improve the expression of the protein, and the result is shown in figure 5.

After BBE optimization, protein expression of the cells after induction and containing histidine tag at the nitrogen terminal was detected by histidine tag antibody, and all genes were expressed in E.coli, although the expression level was very different, and the results are shown in FIG. 6. Similar to BBE, the engineering modification (shortening of 3 amino acids at the N-terminal) of the STOX protein has the advantages that the protein expression amount after modification is obviously improved compared with that before modification, and the protein expression result is shown in figure 4.

Example 2 detection of metabolites by Gene tandem and fermentation engineering bacteria

After all genes were determined to be capable of expression in E.coli, these genes were modular and assembled in tandem, first dividing the tyrosine to reticuline synthesis into two modules: the norlapatine module and the methyltransferase module are connected in series to form the third module.

Because part of the tetrahydroberberine in the fermentation liquid can be spontaneously oxidized to form the berberine, the strain producing the tetrahydroberberine can theoretically detect the generation of the berberine. The strains SQZ05 and SQZ06 are strains for producing tetrahydroberberine, the main difference is that different cytochrome P450 reductase is used, AtCPR2 from arabidopsis is used as SQZ05, PsCPR from poppy is used as SQZ06, and after the two engineering bacteria are fermented for 5 days, the fermentation liquor is treated and then LC-MS/MS detection is carried out. The generation of tetrahydroberberine and berberine in fermentation broth of SQZ05 and SQZ06 was determined by extracting the molecular weight (EIC) of the target compound and comparing it with the retention time and fragment information of the standard (the molecular weight and fragment information of the intermediate metabolite involved in berberine synthesis are shown in Table 7). EIC results for SQZ05 and SQZ06 fermentation samples are shown in FIG. 7. Diluting the standard substance step by step to obtain 4 concentrations of standard substance solution (0.016mg/L, 0.08mg/L, 0.4mg/L and 2mg/L), drawing a standard curve of tetrahydroberberine and berberine according to the concentration and response peak area of the standard substance, and referring to FIG. 8, to quantitatively analyze the product in the fermentation liquid (the standard concentration is no more than 3mg/L at most when quantitative analysis is carried out, if the concentration is exceeded, the response value of LC-MS instrument reaches critical range, and the quantification is inaccurate), finding that SQZ05 has better effect than SQZ06 in producing tetrahydroberberine, and the quantification of the tetrahydroberberine in the fermentation liquid of SQZ05 is 1.08mg/L, and 0.14mg/L berberine can be detected, and then preferably pQZ64 is used as a tetrahydroberberine generation module.

TABLE 7 molecular weight and fragmentation information for berberine synthesis related compounds

Example 3 optimization of reticuline Synthesis Module to increase Tetrahydroberberine yield

The reticuline serving as an important intermediate for synthesizing the berberine has important significance for synthesizing a target product, and the improvement of the output of the reticuline needs to be considered firstly to improve the output of the berberine. In the case of the reticuline synthesis module in E.coli, the reticuline production was increased 4-fold by using tyrosine hydroxylase and incorporating a tetrahydrobiopterin synthesis module. However, the number of genes involved in the tetrahydrobiopterin synthesis module is high and the regeneration pathway is lacking. The present inventors considered that Escherichia coli could use its own coenzyme instead of tetrahydrobiopterin, while achieving the expression of tyrosine hydroxylase activity by means of an exogenous coenzyme regeneration system. Based on this, the inventors deleted tyrosine hydroxylase (optrstYR) in plasmid pQZ23 to convert pQZ23 into pQZ89 on the basis of strain SQZ02 (containing pQZ22+ pQZ23), and introduced plasmid pQZ79 (tyrosine hydroxylase and coenzyme regeneration module) to form strain SQZ07 (containing pQZ22+ pQZ79+ pQZ89), and the formation of reticuline was detected by fermentation, as shown in FIG. 9. The inventors have found that reticuline production is unexpectedly improved by about 10-fold over SQZ02, reaching 11.14 mg/L.

On the basis, the inventor combines two modules (a norlaundrine module and a methyltransferase module) at the upstream to construct a plasmid pQZ90, transforms a constructed strain SQZ08 together with a tyrosine hydroxylase and coenzyme regeneration module (pQZ79), compares the difference of fermentation production of reticuline by SQZ08 and SQZ07, and finds that the potential of the SQZ08 and the SQZ07 for producing reticuline is equivalent by HPLC detection.

Further, downstream modules can be introduced on the basis of SQZ08, and engineering bacteria are constructed to ferment and detect downstream metabolites. Thus, the present inventors obtained SQZ09 by introducing the pQZ64 plasmid into SQZ 08. The fermentation result shows that the engineering bacteria SQZ09 are fermented to produce tetrahydroberberine at 5.36mg/L and berberine at 0.59 mg/L. The HPLC results are shown in FIG. 10.

Plasmid pQZ77 is introduced on the basis of SQZ09 to obtain 2.37mg/L of tetrahydroberberine and 0.41mg/L of berberine, LC-MS/MS detection results are shown in figure 11, after the tetrahydroprotoberberine oxidase is added, the yield of the tetrahydroberberine and the berberine is relatively lower than that before the increase (SQZ09), and therefore, the tetrahydroprotoberberine oxidase is unnecessary to improve the yield.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> China academy of sciences molecular plant science remarkable innovation center

<120> berberine production strain, its establishing method and application

<130> 206314

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(18)

<223> primer

<400> 1

gccaatcgac tggcgagc 18

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(18)

<223> primer

<400> 2

tcactgcccg ctttccag 18

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(33)

<223> primer

<400> 3

gaaagcgggc agtgagtttt tgaggtgctc cag 33

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(33)

<223> primer

<400> 4

cgccagtcga ttggcagctc actcattagg cac 33

Claims

1. Recombinant prokaryotic cell for the production of tetrahydroberberine or berberine, comprising:

(a) a tyrosine hydroxylase and coenzyme tetrahydrobiopterin recycling module which generates levodopa from L-tyrosine;

(b) a reticuline synthesis module that generates reticuline from levodopa; and

(c) a berberine synthesis module that generates tetrahydroberberine or berberine from reticuline.

2. The recombinant prokaryotic cell according to claim 1,

(a) comprises the following steps: a tyrosine hydroxylase; and, an enzyme for producing tetrahydrobiopterin from 4 α -hydroxytetrahydrobiopterin, preferably comprising: 4 alpha-hydroxy tetrahydropterin dehydratase and dihydropterin reductase;

(b) comprises the following steps: enzymes for synthesizing norlapatine from levodopa, preferably including dopa decarboxylase, monoamine oxidase, norcoclaurine synthase 2; and, an enzyme for the synthesis of reticuline from norlaundrine, preferably comprising: higenamine 6-oxygen methyltransferase, higenamine nitrogen methyltransferase, and 3' -hydroxy nitrogen methyl higenamine 4-oxygen methyltransferase; or

(c) Comprises the following steps: an enzyme for the synthesis of tetrahydroberberine or berberine from reticuline; preferably comprising: berberine bridge enzyme 1, aureovioline 9-oxygen methyltransferase, tetrahydroberberine oxidase, cytochrome P450 oxidoreductase or cytochrome P450 oxidoreductase 2.

3. The recombinant prokaryotic cell according to claim 2, further comprising in (c): tetrahydroprotoberberine oxidase.

4. The recombinant prokaryotic cell according to claim 2 or 3, characterised in that the berberine bridge enzyme 1 is a truncation from which 10 to 30 amino acid residues from the N-terminus of the amino acid sequence have been deleted;

the tyrosine hydroxylase is a mutant, wherein the 37 th position of the tyrosine hydroxylase is mutated into Glu, the 38 th position of the tyrosine hydroxylase is mutated into Glu, and the 166 th position of the tyrosine hydroxylase is mutated into Tyr;

the higenamine synthase 2 is a truncation, and 5-20 amino acid residues at the N end of the amino acid sequence are deleted;

the tetrahydroprotoberberine oxidase is a truncation, and 3-25 amino acid residues at the N end of the amino acid sequence of the tetrahydroprotoberberine oxidase are deleted; and/or

Of the cytochrome P450 oxidoreductase and the cytochrome P450 oxidoreductase 2, the cytochrome P450 oxidoreductase 2 is selected.

5. The recombinant prokaryotic cell according to claim 2 or 3, wherein in (a) the tyrosine hydroxylase is murine, the 4 α -hydroxytetrahydropterin dehydratase is murine or the dihydropterin reductase is murine;

(b) wherein the dopa decarboxylase is from Pseudomonas putida, the monoamine oxidase is from Micrococcus luteus, higenamine synthase 2 is from Coptis japonica, higenamine 6-O-methyltransferase is from Papaveris, higenamine N-methyltransferase is from Papaveris, or 3' -hydroxy N-methyl-higenamine 4-O-methyltransferase is from Coptis japonica; or

(c) In the formula, berberine bridge enzyme 1 is derived from poppy, corydalis violacea 9-O-methyltransferase is derived from Coptis japonica, tetrahydroberberine oxidase is derived from Coptis japonica, cytochrome P450 oxidoreductase 2 is derived from Arabidopsis thaliana, cytochrome P450 oxidoreductase is derived from poppy, or tetrahydroprotoberberine oxidase is derived from berberis thunbergii.

6. The recombinant prokaryotic cell according to claim 2 or 3,

(a) wherein the tyrosine hydroxylase and the gene encoding an enzyme for producing tetrahydrobiopterin from 4 α -hydroxytetrahydrobiopterin are introduced into the cell after being operably linked to a construct, preferably a construct based on pACYC;

(b) wherein the gene encoding an enzyme for synthesizing norlapatine from levodopa and the gene encoding an enzyme for synthesizing reticuline from norlapatine are introduced into the cell after being operably linked to the same construct, preferably the construct is based on pET21 a; or the gene encoding the enzyme for synthesizing norlapatine from levodopa is co-introduced into the cell after being operably linked to one construct and the gene encoding the enzyme for synthesizing reticuline from norlapatine is operably linked to another construct; preferably the construct is based on pHJ352 or pET21 a;

(c) wherein the gene encoding the enzyme for the synthesis of tetrahydroberberine or berberine from reticuline is introduced into the cell after being operably linked to the same construct, preferably the construct is based on a His-tag containing vector, more preferably pET28a or pACYC-duet;

preferably, in the construct, the T7 promoter or T7 terminator is used for regulation of expression.

7. The recombinant prokaryotic cell according to claim 1, wherein the recombinant prokaryotic cell comprises escherichia coli, bacillus subtilis, streptomyces; more preferably, the recombinant prokaryotic cell is Escherichia coli.

8. The recombinant prokaryotic cell according to claim 1, further comprising an upstream pathway for the synthesis of L-tyrosine; preferably, it comprises: producing L-tyrosine from glucose or glycerol through glycolysis, pentose phosphate pathway, shikimate pathway; or

When the cells are cultured, exogenous L-tyrosine is added to the culture medium.

9. Use of a recombinant prokaryotic cell according to any one of claims 1 to 8 for the production of tetrahydroberberine or berberine; preferably, for converting L-tyrosine or its upstream substrate to tetrahydroberberine or berberine.

10. A method of producing tetrahydroberberine or berberine, the method comprising:

(1) providing a recombinant prokaryotic cell according to any one of claims 1-8; and

(2) culturing the recombinant prokaryotic cell of (1) to produce tetrahydroberberine or berberine.

11. The method according to claim 10, wherein in (2), the cells are cultured in a system in which an L-tyrosine or a synthetic L-tyrosine upstream substrate is added; preferably, the synthetic L-tyrosine upstream substrate comprises: glucose, glycerol.

12. The method of claim 10, wherein the recombinant prokaryotic cell produces glycerol as a carbon source.

13. A kit for producing tetrahydroberberine or berberine comprising the recombinant prokaryotic cell of any one of claims 1-8.

14. A kit for the production of tetrahydroberberine or berberine, comprising an expression construct of the group consisting of:

construct 3, comprising a gene encoding an enzyme that synthesizes tetrahydroberberine or berberine from reticuline; preferably comprises berberine bridge enzyme 1, aureovioline-9-O-methyltransferase, tetrahydroberberine oxidase, cytochrome P450 oxidoreductase or cytochrome P450 oxidoreductase 2; preferably, the gene also comprises a coding gene of tetrahydroprotoberberine oxidase; preferably the construct is based on pET28a or pACYC-duet;

15. The kit according to claim 14, wherein the berberine bridge enzyme 1 is a truncation in which 10 to 30 amino acid residues from the N-terminus of the amino acid sequence are deleted;

the higenamine synthase 2 is a truncation, and 5-20 amino acid residues at the N end of the amino acid sequence are deleted; and/or

16. The kit of claim 14, further comprising:

prokaryotic cells or cell cultures; preferably, the prokaryotic cell comprises escherichia coli, bacillus subtilis and streptomyces; more preferably, the prokaryotic cell is escherichia coli;

l-tyrosine or an upstream substrate capable of producing L-tyrosine;

an expression-inducing agent; and/or

And (3) a basic culture medium.

17. Use of a kit according to any one of claims 13 to 16 for the production of tetrahydroberberine or berberine.