CN111676204B

CN111676204B - Nicotinamide phosphoribosyl transferase for preparing nicotinamide mononucleotide, coding gene, vector and application

Info

Publication number: CN111676204B
Application number: CN202010621339.9A
Authority: CN
Inventors: 秦小波
Original assignee: Chengdu Jihe Biotechnology Co ltd
Current assignee: Chengdu Jihe Biotechnology Co ltd
Priority date: 2018-12-27
Filing date: 2018-12-27
Publication date: 2023-05-23
Anticipated expiration: 2038-12-27
Also published as: CN111676204A; CN109666658A; CN109666658B

Abstract

The invention discloses nicotinamide phosphoribosyl transferase for preparing nicotinamide mononucleotide, coding genes, a vector and application thereof, and belongs to the technical field of biology, wherein the enzyme is protein with an amino acid sequence shown as SEQ ID No.3 or SEQ ID No.4, and the genes for coding the protein are cloned to an escherichia coli expression vector to construct recombinant plasmids; then transforming the recombinant plasmid into competent cells of the escherichia coli, selecting positive clones to obtain recombinant escherichia coli expression strains, and performing liquid fermentation; in the fermentation process, the produced recombinant nicotinamide riboside phosphate transferase can produce beta-nicotinamide mononucleotide after adding a substrate; the preparation method of NMN is convenient and efficient, the fermentation process is simple, the time consumption is short, the cost is low, the cost for obtaining NMN is 0.25-1.0 yuan/mg, compared with the traditional method, the cost can be reduced by more than 90%, the yield is up to 51.75mg per g of protein, and the economic benefit is remarkable.

Description

Nicotinamide phosphoribosyl transferase for preparing nicotinamide mononucleotide, coding gene, vector and application

Technical Field

The invention relates to a divisional application with the application number of 201811606780.9, the application date of the original application is 2018.12.27, and the invention is named as nicotinamide phosphoribosyl transferase for preparing NMN, a coding gene, a recombinant vector and application. The invention relates to the technical field of biology, in particular to nicotinamide phosphoribosyl transferase for preparing nicotinamide mononucleotide, a coding gene, a vector and application thereof.

Background

Beta-nicotinamide mononucleotide (Nicotinamide mononucleotide, NMN) is the product of the reaction of nicotinamide riboside transferase (Nicotinamide phosphate ribose transferase, nampt) with nicotinamide and the like, and is also a key precursor for the in vivo nicotinamide adenine dinucleotide (Nicotinamide adenine dinucleotide, nad+) salvage synthesis pathway in mammals.

In mammals, NMN is produced by Nicotinamide (Nam) under catalysis of Nampt, followed by NMN to nad+ under catalysis of Nicotinamide mononucleotide adenyltransferase (Nicotinamide mononucleotide adenosine transferase, nmnat). That is, NMN exerts its physiological functions in humans by converting to nad+, such as activating nad+ substrate-dependent enzyme Sirt1 (histone deacetylase, also known as sirtuin), regulating cell survival and death, maintaining redox state, and the like.

Recent researches find that the NMN has better treatment and repair effects on cardiovascular and cerebrovascular diseases, neurodegenerative diseases, aging degenerative diseases and the like by regulating the level of NMN in organisms; in addition, NMN can play roles in protecting and repairing islet function, increasing insulin secretion and preventing and treating metabolic diseases such as diabetes, obesity and the like by participating in and regulating endocrine of organisms. Therefore, NMN has wide application prospect in medical treatment and functional food.

However, the in vitro preparation method of NMN is mainly based on chemical synthesis, for example, in 2002, tanimori et al, uses ribose protected by acetyl to carry out condensation reaction with nicotinamide under the catalysis of TMSOTF; for another example, palmarisa et al in 2004 silylated nicotinamide with a silylating agent and then reacted with acetylribose under the catalysis of TMSOTf; these chemical synthesis methods have problems of high cost, low yield, large pollution of chemical reagents, and the like.

The most environmentally-friendly method for preparing NMN at present is a biosynthesis method, namely Nampt is adopted to catalyze Nam to generate NMN; and generally the synthesis of NAD precursor NMN is achieved using yeast; the existing natural Nampt has the problems of low enzyme activity, long time consumption, high cost, low yield, difficulty in realizing industrial mass production and the like, and limits the large-scale application of NMN.

Disclosure of Invention

It is an object of the present invention to provide nicotinamide riboside transferase that solves the above-mentioned problems.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows: a nicotinamide riboside phosphate transferase for the preparation of NMN, which is a protein of (a) or (b) or (c) as follows:

(a) The amino acid sequence of the protein is shown as pSEQ ID No. 1;

(b) The amino acid sequence of the protein is shown as pSEQ ID No. 3;

(c) Protein derivatives having β -nicotinamide mononucleotide activity which are obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence defined in (a) or (b) and catalyzing nicotinamide.

As a preferable technical scheme: the protein of (c) has an amino acid sequence as pSEQ ID No.2 or pSEQ ID No. 4. That is, pSEQ ID No.2 is optimized based on pSEQ ID No. 1; pSEQ ID No.4 was optimized on the basis of pSEQ ID No. 3.

Another object of the present invention is to provide a gene encoding the aforementioned protein nicotinamide riboside transferase having the meanings indicated by pSEQ ID No.1, pSEQ ID No.2, pSEQ ID No.3 and pSEQ ID No. 4. I.e. all genes capable of encoding the above proteins are within the scope of the present invention.

As a preferred technical scheme, the nucleotide sequence of the gene encoding the protein shown in ID No.1 is shown as nSEQ ID No. l; the nucleotide sequence of the gene encoding the protein shown as ID No.2 is shown as nSEQ ID No. 2; the nucleotide sequence of the gene encoding the protein shown as ID No.3 is shown as nSEQ ID No. 3; the nucleotide sequence of the gene encoding the protein shown as ID No.4 is shown as nSEQ ID No. 4; these preferred nucleotide sequences have E.coli preferences, i.e.are more suitable for expression in E.coli.

The invention also provides a recombinant expression vector, which adopts the technical scheme that the recombinant expression vector contains any one of the genes for encoding nicotinamide riboside transferase for preparing NMN.

The fourth object of the present invention is to provide a genetically engineered host cell, which adopts the technical scheme that the host cell comprises the recombinant expression vector.

As a preferred embodiment, the host cell is E.coli.

As a further preferred embodiment, the host cell is E.coli BL21 (DE 3), BLR (DE 3), BL21 (DE 3) pLysS or M15, TB1 or DH 5. Alpha. Or Top10.

The fifth object of the present invention is to provide an application of a gene encoding nicotinamide riboside phosphate transferase, which adopts the technical scheme that the gene is used for heterologous recombinant expression.

As a preferred technical scheme, the method for heterologous recombinant expression is as follows:

the method comprises the following steps: (1) constructing the recombinant expression vector of claim 5; (2) Transforming a host cell with the recombinant expression vector of step (1) to obtain the genetically engineered host cell of claim 6; (3) Culturing the genetically engineered host cell of step (2), and inducing expression of the recombinant nicotinamide riboside transferase by addition of lactose or isopropylthiogalactose IPTG.

The invention aims at providing a method for preparing beta-nicotinamide mononucleotide, which adopts the technical scheme that the method comprises the following steps: (1) The recombinant expression of claim 10, wherein the substrate nicotinamide is added; (2) After the step (1) is finished, continuing to culture the bacterial liquid, and culturing by using a shake flask method or a fermentation tank; meanwhile, detecting the OD600 value of the bacterial liquid in each hour, and calculating the density of the escherichia coli; cultures were performed below od600=3.0.

As a preferable technical scheme, the method adopts an escherichia coli culture medium for culture, wherein the escherichia coli culture medium is LB or PYA, and the culture temperature is 35-38 ℃.

The theory of the method is realized by utilizing two main synthesis routes of NAD, namely a tryptophan de novo synthesis route and a salvage route, and the product is beta-Nicotinamide Mononucleotide (NMN); the invention is realized by using escherichia coli fermentation, and compared with the prior yeast, the invention has relatively simple flow and greatly reduces various investment and cost.

Compared with the prior art, the invention has the advantages that: the preparation method of the beta-nicotinamide mononucleotide NMN is convenient and efficient, the fermentation process is simple, the time consumption is short, the cost is low, and the yield is up to 51.75mg per g protein; and the cost for obtaining NMN is 0.25-1.0 yuan/mg, which can be reduced by 90% compared with the traditional method, and the economic benefit is obvious.

Drawings

FIG. 1 is a diagram showing the result of SDS-PAGE electrophoresis of the Nampt enzyme protein expressed by four pET-Nam vectors in the example of the present invention; "Control" in FIG. 1 is a Control with pET empty vector;

FIG. 2 is a diagram showing the result of SDS-PAGE electrophoresis of Nampt enzyme protein expressed by four pMal-Nam vectors in the example of the present invention; in FIG. 2, "control+empty vector" is a Control with pMal empty vector, and "Control-" is a non-transferred vector fungus sample;

FIG. 3 is a diagram showing the results of SDS-PAGE electrophoresis of the Nampt enzyme protein expressed by the four pQE-Nam vectors in the example of the present invention; "Control" in FIG. 3 is a Control with pQE empty vector;

FIG. 4 is a diagram showing the result of SDS-PAGE electrophoresis of four sequences for Western detection of Nampt enzyme protein in the example of the present invention; "Haemophilus ducreyi nadV" in FIG. 4 is a control of the expression of E.coli transformed with the native gene sequence of the enzyme nadV of Haemophilus ducreyi; "Control" is a Control for purified Nampt enzyme;

FIG. 5 is a flow chart of recombinant vector construction, screening and culture fermentation according to the present invention.

Detailed Description

The invention will be further described with reference to the accompanying drawings.

1. Materials and reagents

1.1 Strain and plasmid vector

Strains: coli strains DH 5. Alpha., top10, M15, BL21, TB1, commercially available.

Plasmid vector: vectors pET-28 (a), pMal and pQE-30, commercially available.

1.2. Reagent, kit and enzyme

Reagents and kits: phosphatase-labeled goat anti-rabbit IgG (h+l) and NBT/BCIP staining kit. Luciferase assay system (Luciferase Assay System) was purchased from promega company. The remaining reagents were all analytically pure.

Enzyme: restriction enzymes BamHI, hindIII, T4DNA ligase, rTaq enzyme and pFU enzyme.

1.3 Medium

LB liquid Medium (1L): tryptone 10g, yeast extract 5g, naCl:10g, 5 mol.L ^-1 Adjusting pH to 7.0, and sterilizing at high temperature.

LB solid Medium (1L): LB liquid medium+agar powder 15g.

PYA Medium (1L): na (Na) ₂ HPO ₄ 16.1g，KH ₂ PO ₄ 1.36g, naCl 0.5g, yeast extract 5.0g, CH ₃ COONa 10.0g with 0.1mol/LNaOH or 5%H ₂ SO ₄ Regulating pH, adding a PYA culture medium with a corresponding pH value after the PYA name according to the pH value, and if the pH value is regulated to 8, then the PYA culture medium is named as PYA8; and (5) sterilizing at high temperature.

1.4 Main reagent formulation

1.4.1DNA extraction of relevant reagents:

extraction medium I: tris 0.2mol/L, EDTA-Na ₂ 50mmol/L，NaCl 0.25mol/L，pH 8.0

Extraction medium II: tris 0.1mol/L, EDTA-Na ₂ 20mmol/L，NaCl 1.4mol/L，2％(m/V)CTAB，pH 8.0。

1.4.2SDS polyacrylamide gel electrophoresis (SDS-PAGE) related reagents:

30% acrylamide stock solution 29% acrylamide, 1% bisacrylamide

29g of acrylamide, lg of bisacrylamide

Adding distilled water to 100ml, stirring in a kitchen until completely dissolved, filtering, and storing at 4deg.C

The gel buffer was separated from l.5M Tris-HCI (pH 8.8).

Concentrated gel buffer, l.0M Tris-HCI (pH 6.8).

10% of ammonium persulfate:

1g of ammonium persulfate, and distilled water was added to a constant volume of 10mL.

10％SDS:

10g SDS was added to distilled water to a volume of 100mL.

10x running buffer (Tris-Gly running buffer):

30g Tris,144g Gly,10g SDS；

respectively dissolving in distilled water, and fixing volume to 1000mL.

2xSDS gel loading buffer (loading buffer) 1M Tris-HCI (pH 6.8); 0.2M DTT;4% (W/V) SDS;0.2% (W/V) bromophenol blue; 20% (V/V) glycerol.

Polyacrylamide gel staining solution:

polyacrylamide gel decolorization solution:

methanol 450mL

Acetic acid 100mL

Distilled water was added to volume 1000mL.

Separating gel 15mL

Concentrated gum 5mL

1.4.3 plasmid extraction related reagents:

solution I: 50mM glucose, 25mM Tris-HCl (pH 8.0), 10mM EDTA (pH 8.0).

1M Tris-HCl (pH 8.0) 12.5mL,0.5M EDTA (pH 8.0) 10mL, glucose 4.730g, ddH added ₂ O to 500mL. Autoclaving for 15min and storing at 4deg.C.

Solution II: 0.2N NaOH,1% SDS.

2N NaOH 1mL,10%SDS 1mL add ddH ₂ O to 10mL. Temporarily configured before use.

Solution III: potassium acetate (KAc) buffer, pH 4.8.

5M KAc 300mL, glacial acetic acid 57.5mL, ddH is added ₂ O to 500mL. Preserving at 4 ℃ for standby.

Phenol/chloroform/isoamyl alcohol (25:24:1).

PCR amplification and recovery of target fragment:

designing primer pairs for the artificially synthesized gene fragments, and adding BamHI and HindIII enzyme cutting sites to the primer pairs respectively, wherein the sequences of the primer pairs are shown in Table 1; PCR amplification was performed using the synthesized Nampt gene as template, and the PCR conditions were as shown in Table 2.1. Reaction parameters: pre-denaturation at 95 ℃ for 5min; then 30 cycles (94 ℃ C. 30sec,58 ℃ C. 30sec,72 ℃ C. 1.5 min); and extended for a further 10min at 72 ℃. The reaction was performed on a GeneAmp PCR System2400 thermocycler. Adding A to the tail end of the PCR product: 30. Mu.L of PCR product; 30. Mu.L 10 XPCR Buffer (MgCl free) ₂ )；2μL MgCl ₂ The method comprises the steps of carrying out a first treatment on the surface of the 0.8. Mu.L of pFU enzyme; 1 μl dATP,95 ℃ C: 5min;72 ℃ C:: 30min; preserving at 4 ℃.

TABLE 1 primer pair list for amplifying Nampt Gene

* The primer needs to be added with an enzyme cutting site sequence: 5' -GCGGGATCC(BamHI)；5'-GCGAAGCTT(HindIII)

The glue was then recovered according to the glue recovery kit instructions of the company Tiangen.

TABLE 2 reaction System for PCR amplification of Nampt coding region

3. Double cleavage of the fragment of interest

And BamHI, hindIII double enzyme digestion is carried out on the Nampt gene fragment obtained by amplification in the step 2 and the extracted plasmids pET-28 (a), pMal and pQE-30 respectively. The cleavage system is shown in Table 3:

table 3 double enzyme digestion test system

After the cut fragments were separated by 1% agarose electrophoresis, the corresponding fragments were recovered using a gel recovery kit to obtain the target fragments with the cut sites BamHI and HindIII.

4. Ligation and transformation of expression fragments

The expression fragments cut by the Nampt gene double enzyme obtained in the step 3 are respectively connected with expression plasmids pET-28 (a), pMal and pQE-30 after the double enzyme cutting at the same temperature by using T4DNA ligase for overnight at 16 ℃ to construct recombinant expression vectors pET-Nam, pMal-Nam and pQE-Nam. And the two recombinant expression vectors are respectively transferred into competent cells of escherichia coli BL21 (DE 3), TB1 and M15, or transferred into DH5 alpha and Top10 competent cells to be screened and then used as preservation strains for preserving the recombinant vectors.

5. Screening of recombinant plasmids

The white transformed colony is selected as colony PCR, the amplified reaction system and parameters see the amplification of Nampt gene fragment, but the template is changed into colony.

The colony which is positive is detected by colony PCR and is proliferated and cultured on LB liquid medium, and plasmid is extracted. The method adopts the existing commercial plasmid extraction kits such as Sigma or Omega. The recombinant plasmid was subjected to double restriction identification and sequencing with BamHI and HindIII.

Inducible expression of Nampt enzyme

6.1 Induction of enzyme expression, sampling

And (3) absorbing 10 mu L of each of BL21 (DE 3), TB1 and M15 bacterial liquid transformed with the recombinant plasmid, respectively adding 20mL of LB liquid culture medium containing corresponding antibiotics, respectively carrying out shaking culture at 37 ℃ and 25 ℃ until the OD600 value is 0.4-0.8, taking out 1mL of culture, collecting bacterial cells, and preserving at 4 ℃ to obtain a sample before induction. IPTG (final concentration: 0.5 mM) was added to the remaining culture, and 1mL was sampled after 4-8 hours of induction, and the cells were collected and stored at 4 ℃.

6.2Nampt enzyme sample treatment

After the completion of the sampling, if the total bacterial proteins were produced, 100. Mu.L of lysis buffer (50 mM Tris-HCl (pH 8.5-9.0), 2mM EDTA,100mM NaCl,0.5%Triton X-100,1 mg/mL) was added to the cells obtained by each sampling, and then 100. Mu.L of 2 Xprotein loading buffer was added. After being blown evenly by a pipettor, the mixture is put into a boiling water bath for boiling for 10 to 15 minutes, and after boiling, the mixture is centrifuged at 12000rpm for 5 minutes. The supernatant can be loaded.

If the total protein of bacteria is required to be divided into two parts of soluble and insoluble (inclusion bodies) for detection, 100 mu L of PBS is added into the thalli obtained by sampling each time, the thalli are uniformly blown by a pipettor, PBS heavy suspension of the thalli is subjected to ultrasonic disruption by a water tank type ultrasonic disruptor under the ice bath condition until the solution is clear, and the solution is continuously cooled to avoid the change of solubility caused by denaturation of released protein due to heat accumulated during disruption. After the crushing, the mixture was centrifuged at 13000rpm at 4℃for 20 minutes. The supernatant was then carefully transferred to a new centrifuge tube. Adding 100 μl of 2×protein loading buffer, mixing, and decocting in boiling water bath for 10-15 min to obtain soluble protein sample. And (5) centrifuging at 12000rpm for 5 minutes, and loading the supernatant. And adding 100 mu L of lysis buffer and 100 mu L of 2 Xprotein loading buffer into the precipitation part, blowing uniformly by a pipettor, boiling in a boiling water bath for 10-15 minutes, obtaining a protein sample of an insoluble part after boiling, and loading the supernatant after centrifuging at 12000rpm for 5 minutes.

After sample preparation, 12% SDS-PAGE was performed and Coomassie brilliant blue R-250 was stained overnight. After dyeing, decoloring with a decoloring liquid.

SDS-PAGE electrophoresis detection results of Nampt enzyme expressed by different expression vectors are shown in figures 1-3; from the figures 1-3, the 4 nicotinamide riboside phosphate transferase provided by the invention can be well expressed in escherichia coli, and provides a stable biosynthesis basis for the production of beta-nicotinamide mononucleotide; simultaneously, the optimized pSEQ ID No.2 is better expressed relative to pSEQ ID No.1, and the optimized pSEQ ID No.4 is better expressed relative to pSEQ ID No. 3.

7. Western detection of expression products

Western blot analysis was performed with reference to existing methods. Proteins on SDS-PAGE gels were electrotransferred to nitrocellulose membranes (100V steady transfer for 2 h). And (3) taking Nampt enzyme antiserum extracted from the mice as a primary antibody, taking phosphatase-labeled goat anti-rabbit IgG (H+L) as a secondary antibody, and carrying out Western detection by using an NBT/BCIP staining kit. The specific method comprises the following steps:

transferring: soaking nitrocellulose filter membrane, glue and filter paper respectively with transfer buffer solution for 10-20min, soaking sponge and sandwich device with transfer solution, and assembling the electrotransfer device. The film is at the positive electrode and the glue is at the negative electrode. Voltage 98u,2.5h.

Blocking the protein binding site of the nitrocellulose filter: the membrane was removed, washed 2 times/10 min with TBS (100 mM Tris-HCl (pH 7.5), 0.9% NaCl), 40mL of blocking solution (the "blocking solution" of the present invention, unless specified otherwise, refers to 3g bovine serum albumin dissolved in 100mL TBS) was added, and the membrane was placed on a rotary shaker and incubated at room temperature for 1 hour to block the protein binding site of the filter membrane. After removal of the membrane, the membrane was washed 2 times/5 min. TTBS (100 mM Tris-HCl (pH 7.5), 0.9%NaCl,0.1%Tween 20) 2 times/10 min, TBS 1 time/10 min

Reaction of nitrocellulose filters with primary antibodies: primary antibody (rabbit antiserum diluted 1:600, the diluent is blocking solution) was added. Placed on a rotary shaker and incubated at room temperature for 1h. TTBS was washed 2 times/10 min and TBS was washed 1 time/10 min.

Reaction of nitrocellulose filters with secondary antibodies: sheep anti-rabbit IgG at 1:1500 with a blocking solution. The nitrocellulose filter was placed in a petri dish, and 30ml of secondary antibody was added. Incubate with shaking at room temperature for 1h. TTBS is washed by shaking for 15min at room temperature and 4 times.

Color reaction of nitrocellulose filter: a chromogenic substrate solution for Alkaline Phosphatase (AP) was prepared according to the NBT/BCIP staining kit instructions. Dyeing in dark place for 2-3min, ddH ₂ Terminating the reaction by O, drying, and photographing for storage. The results are shown in figure 4, and from figure 4, it can be seen that the 4 nicotinamide riboside transferase provided by the invention has similar molecular weights with the Duke haemophilus nadV enzyme and the natural nadV enzyme, has better expression in escherichia coli, and provides a high-efficiency biosynthesis basis for the production of beta-nicotinamide mononucleotide.

8. Escherichia coli fermentation culture

10mL of escherichia coli BL21 (DE 3) bacterial liquid containing pET-Nam recombinant plasmid is taken and added into 10L of LB culture medium for culture, a shaking table is set to 250rpm, the temperature is 37 ℃, antibiotics are added, 50 mug/mL of kanamycin is added, and an OD600 luminosity value is detected to record an escherichia coli growth curve. When od600=0.5, 0.5% nam and 1% lactose were added and the culture continued.

Taking 1mL of escherichia coli TB1 bacterial liquid containing pMal-Nam recombinant plasmid, adding the escherichia coli TB1 bacterial liquid into 1L of LB culture medium for culturing, setting a shaking table at 250rpm and a temperature of 37 ℃, adding 50 mug/mL of antibiotic, and detecting OD600 luminosity value to record an escherichia coli growth curve. Culture was continued by adding 0.2% NAM and 0.5mM IPTG with 0.5% glucose when OD600 = 0.55.

Taking 10mL of escherichia coli M15 bacterial liquid containing pQE-Nam recombinant plasmid, adding the solution into 10L of PYA culture medium for culture, setting a pH value of 8.0, setting a shaking table at 200rpm and a temperature of 37 ℃, adding antibiotics and 50 mug/mL of ampicillin, detecting OD600 luminosity value and recording an escherichia coli growth curve. Culture was continued by adding 0.5% NAM and 1.0mM IPTG with 0.5% glucose when OD600 = 0.4.

50mL of E.coli M15 bacterial liquid containing pQE-Nam recombinant plasmid is taken and added into 50L of LB culture medium for culture, a shaking table is set at 200rpm and the temperature is 37 ℃, antibiotics are added, 50 mug/mL of ampicillin is added, and an OD600 photometry value is detected to record an E.coli growth curve. When OD600 = 0.45, 1.0% nam and 1.5% lactose were added and the culture continued.

NMN fluorescence analysis

Culturing for 4-12 hr, centrifuging for 20min, and collecting supernatant and Escherichia coli cells. E.coli cells were resuspended in the same volume of distilled water and disrupted by 3 replicates using an ultrasonic cell disrupter. Fluorescence derived assays refer to existing methods. The main steps are that E.coli heavy suspension, namely 69 mu L of sample, 27.7 mu L of dimethyl sulfoxide containing 20% acetophenone and 27.7 mu L of 2mol/L potassium hydroxide are added on a 96-well plate, and after 2min of incubation on ice, 125 mu L of 88% formic acid is added; then incubated at 37℃for 10min. The emitted light at a wavelength of 445nm was measured with an ultraviolet photometer at 382 nm. Concentration range of standard curve 0.0625×10 ^-2 ～4×10 ^-2 Correlation coefficient 0.99 was obtained by 8 standard dilutions of standard NMN (Sigma N3501-25 MG). Control samples were prepared using E.coli which was not inducedThe bacterial liquid was obtained by the same analysis treatment. Protein concentration determination was performed using Bradford method using bovine serum albumin as standard. NMN production data are expressed in milligrams NMN per gram of protein, mg NMN per g of protein, and the results are shown in Table 4.

The traditional chemical synthesis method can only be generally produced in a laboratory at present, and the cost of produced NMN per milligram (mg) is 1.0-50.0 yuan/mg; according to the fermentation method of the invention, the input per liter (L) of fermentation liquor is about 5.0-20.0 yuan/L according to the size of the production scale; the cost of natural NMN obtained is 0.25-1.0 yuan/mg at a yield of at least about 20mg per L, if at a cost of 5.0 yuan/L at a yield of at most 45mg/L, the cost of NMN is only about 0.1 yuan/mg; therefore, compared with the traditional method, the method has the advantages that the cost can be reduced by more than 90 percent, and the economic benefit is obvious.

TABLE 4 NMN yield statistics of the Nampt enzyme recombinant vectors in E.coli fermentation

/>

/>

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

Sequence listing

pSEQ ID No.1

MDNLLNYSSRASAIPSLLCDFYKTSHRIQYPEGTQILYSTFTPRSNKQAPYLTRVVSFGFQAFITKYLIHYFNDNFFSRDKDEVVSEYSAFIKKTLQLEDTGEHIAQLHELGYLPIRIKAIPEGKSVAIKVPVMTIENTHPDFFWLTNYLETLINVSLWQPMTSASIAFAYRTILVKFANETCDNQDHVPFQSHDFSMRGMSSLESAETSGAGHLTSFLGTDTIPAISFIEAYYGSKSLIGTSIPASEHSVMSAHGVDELPTFRYLMAKYPHNMLSIVSDTTDFWHNITVNLPLLKQEIMARPENAKVVIRPDSGDFFAIICGDPTADTEHERKGLIECLWDIFGGTVNQKGYKVLDPHIGAIYGDGVTYEKMFKILEGLQAKGFASSNIVFGVGAQTYQRNTRDTLGFAIKATSITINGEEKAIFKNPKTDDGLKKSQKGRVKVLSRDTYIDGLTAADDFSDDLLEVVFEDGKLVRQTDFDEIRQNLLVSRTTL

pSEQ ID No.2

MDSLLNHYSRASAIPSLLCDFYKTSHRIMYPEGSQIIYSTFTPRSNEQAPYLTQVVSFGFQAFIIKYLIHYFNDNFFSRDKHDVVTEYSAFIEKTLQLEDTGEHIAKLHELGYLPIRIKAIPEGKTVAIKVPVMTIENTHPDFCWLTNYLETLINVSLWQPMTSASIAFAYRTALIKFANETCDNQEHVPFQSHDFSMRGMSSLESAETSGAGHLTSFLGTDTIPALSFVEAYYGSSSLIGTSIPASEHSVMSSHGVDELSTFRYLMAKFPNSMLSIVSDTTDFWHNITVNLPLLKQEIIARPENARLVIRPDSGNFFAIICGDPTADTEHERKGLIECLWDIFGGTVNQKGYKVINPHIGAIYGDGVTYEKMVKILEGLKAKGFASSNIVFGVGAQTYQRNTRDTLGFALKATSITINGEEKAIFKNPKTDNGLKKSQKGRVKLLSYDTYLDGLTAKDDFSDDLLELLFENGKLLRRTDFDQIRQNL

pSEQ ID No.3

MYMNPLLLTDGYKVDHRRQYPDNTTLVYSNWTPRKSRIEYVDQMVFFGLQYFIKKYIIEDFNRNFFNQPKEQVIKKYARRINNYLGPNNVGTQHIEDLHDLGYLPMVIKALPEGSVYPLRVPMFTMYNTDERFFWLTNYFETLLSAVVWLPCTSATIAKQYRKILETYALETSSDIAFVDWQGHDFSMRGMGGIEAAVMSGAGHLLSFTGTDTIPAIDFLEQYYNADSDKELVGGSVAATEHSVMCMGGMEGELETFKRLIEDIYPSGIVSIVSDTWDLWKVLTEYLPALKERILARDGKVVIRPDSGDPVKIICGNPNGKIGSPEYKGVIELLWDVFGGTTNAKGYKELDPHIGAIYGDSITIERAEAICERLKAKGFASTNVVLGIGSFTYQYNTRDTFGFAMKATYGEVDGEGREIFKDPITDDGTKKSAKGLVAVFKDEQGQFYLKDQASWQDVNNCEFVPVFADGELLTEYSLADIRARLAASRR

pSEQ ID No.4

MYLNPVTAIDGYKVDHRRQYPDNTQVIFSNLTARKSRRGYTDQMVFFGLQYFIKHYLIDSWNRDFFQQPKEQVICQFSRRINNYLGPNNVGTQHIEELHDLGYLPIKIMALPEGSVYPLKVPCLILYNTDERFFWLTNYLETILSANVWGMCTSATTALQYRKIFEAYALETDGDIAFVDWQGHDFSFRGMYGVEAAIMSGAAHLLSFTGTDTIPAIDFLEQYYNADSDKELVGGSVAATEHSVMCMGGMEGELETFKRLIEDIYPSGIVSIVSDTWDLWKVLTEYLPALKERILARDGKVVFRPDTGCPVKIICGDPQAPIGSPEYKGAIECLWDVFGGSTTAKGYKLLDSHVGLIYGDSITIERAEAICAGLKAKGFASTNIVFGIGSFTYQHVTRDTDGYAVKATFAKVDGKDREIFKDPKTDDGTKKSAKGLVAVFKDEQGQFYLKDQASWQDVNNCEFVPVFADGKLLNEVSLTEIRARL

nSEQ ID No.1

ATGGATAACCTGTTAAATTATAGTAGTCGTGCTAGTGCTATTCCATCATTATTATGCGATTTTTACAAAACATCTCATCGTATCCAGTATCCGGAAGGTACACAAATTCTGTATAGTACATTTACACCTCGTAGCAATAAACAAGCGCCTTATTTAACACGTGTTGTGTCATTTGGTTTTCAAGCCTTTATCACCAAATATTTAATTCATTATTTTAATGATAACTTTTTTTCTCGTGATAAAGATGAAGTTGTGAGCGAATACTCTGCATTTATTAAGAAAACCTTACAGTTAGAGGATACGGGTGAACACATTGCACAGTTACATGAGTTGGGTTATTTGCCTATCCGTATTAAAGCTATTCCTGAAGGAAAAAGCGTGGCAATTAAAGTTCCGGTGATGACGATTGAAAATACGCATCCTGATTTCTTTTGGCTGACTAACTATTTAGAAACATTAATTAATGTATCACTGTGGCAGCCGATGACTTCTGCCTCGATTGCTTTTGCTTATCGTACAATTTTAGTTAAATTTGCTAATGAAACTTGTGATAATCAAGATCATGTGCCATTTCAATCGCATGATTTTTCAATGCGTGGTATGAGTTCTTTAGAATCCGCAGAAACTTCAGGTGCTGGCCATTTAACTTCTTTTTTAGGTACAGACACTATTCCTGCAATTTCTTTTATTGAAGCGTATTATGGTTCAAAGAGTCTGATTGGCACGTCTATTCCGGCTTCTGAGCATTCAGTAATGAGTGCACATGGTGTCGATGAATTACCGACATTTCGTTATTTAATGGCAAAATATCCGCATAATATGTTGTCAATTGTGTCAGATACTACAGACTTTTGGCATAACATTACCGTTAATTTGCCGTTATTAAAGCAAGAAATTATGGCACGTCCAGAAAATGCCAAAGTTGTCATTCGTCCAGATAGCGGTGACTTTTTTGCGATTATTTGTGGTGATCCAACCGCTGATACTGAGCATGAACGTAAAGGACTGATTGAATGTTTATGGGATATTTTTGGTGGTACAGTTAATCAGAAAGGTTATAAAGTGTTAGATCCACATATTGGGGCAATTTATGGTGATGGCGTGACTTATGAAAAAATGTTTAAGATCTTAGAAGGATTACAAGCCAAAGGATTTGCCTCAAGTAATATTGTGTTTGGCGTTGGTGCACAAACCTATCAACGTAATACACGTGATACGTTGGGCTTTGCGATTAAAGCGACATCTATCACTATTAATGGCGAAGAAAAAGCTATTTTCAAAAATCCTAAAACCGATGATGGTCTGAAAAAATCGCAAAAAGGTCGTGTTAAAGTGCTGTCTCGTGATACTTACATTGATGGTTTAACTGCAGCGGATGATTTTAGTGATGATTTATTAGAGGTGGTTTTTGAAGATGGTAAGTTAGTTCGCCAAACAGACTTTGATGAAATTCGTCAAAACTTGTTAGTTAGTCGCACTACGCTGTAA

nSEQ ID No.2

ATGGATAGCCTGTTAAATCATTATAGTCGTGCTAGTGCTATTCCATCATTATTATGCGATTTTTACAAAACATCTCATCGTATCATGTATCCGGAAGGTTCACAAATTATTTATAGTACATTTACACCTCGTAGCAATGAACAAGCGCCTTATTTAACACAAGTTGTGTCATTTGGTTTTCAAGCCTTTATCATTAAATATTTAATTCATTATTTTAATGATAACTTTTTTTCTCGTGATAAACATGATGTTGTGACTGAATACTCTGCATTTATTGAGAAAACCTTACAGTTAGAGGATACGGGTGAACACATTGCAAAATTACATGAGTTGGGTTATTTGCCTATCCGTATTAAAGCTATTCCTGAAGGAAAAACGGTGGCAATTAAAGTTCCGGTGATGACGATTGAAAATACGCATCCGGATTTCTGTTGGCTGACTAACTATTTAGAAACATTAATTAATGTATCACTGTGGCAGCCGATGACTTCTGCCTCGATTGCTTTTGCTTATCGTACAGCATTAATTAAATTTGCTAATGAAACTTGTGATAATCAAGAACATGTGCCATTTCAATCGCATGATTTTTCAATGCGTGGTATGAGTTCTTTAGAATCCGCAGAAACTTCAGGTGCTGGCCATTTAACTTCTTTTTTAGGTACAGACACTATTCCTGCACTGTCTTTTGTTGAAGCGTATTATGGTTCAAGCAGTCTGATTGGCACGTCTATTCCGGCTTCTGAGCATTCAGTAATGAGTTCACATGGTGTCGATGAATTATCAACATTTCGTTATTTAATGGCAAAATTTCCGAATAGTATGTTGTCAATTGTGTCAGATACTACAGACTTTTGGCATAACATTACCGTTAATTTGCCGTTATTAAAGCAAGAAATTATTGCACGTCCAGAAAATGCCCGTTTAGTCATTCGTCCAGATAGCGGTAACTTTTTTGCGATTATTTGTGGTGATCCAACCGCTGATACTGAGCATGAACGTAAAGGACTGATTGAATGTTTATGGGATATTTTTGGTGGTACAGTTAATCAGAAAGGTTATAAAGTGATCAATCCACATATTGGGGCAATTTATGGTGATGGCGTGACTTATGAAAAAATGGTTAAGATCTTAGAAGGATTAAAAGCCAAAGGATTTGCCTCAAGTAATATTGTGTTTGGCGTTGGTGCACAAACCTATCAACGTAATACACGTGATACGTTGGGCTTTGCGCTGAAAGCGACATCTATCACTATTAATGGCGAAGAAAAAGCTATTTTCAAAAATCCTAAAACCGATAATGGTCTGAAAAAATCGCAAAAAGGTCGTGTTAAACTGCTGTCTTATGATACTTACCTTGATGGTTTAACTGCAAAGGATGATTTTAGTGATGATTTATTAGAGCTGTTATTTGAAAATGGTAAGTTATTACGCCGTACAGACTTTGATCAGATTCGTCAAAACTTGTAA

nSEQ ID No.3

ATGTACATGAATCCGCTGCTGCTGACCGATGGCTACAAAGTCGACCACCGTCGTCAATATCCGGATAATACTACACTGGTTTATAGTAACTGGACCCCGCGTAAATCCCGTATTGAATATGTTGACCAAATGGTATTTTTTGGCTTGCAGTATTTTATCAAGAAATACATTATTGAAGATTTTAACCGTAATTTCTTTAATCAGCCGAAAGAGCAAGTGATCAAGAAATATGCCCGCCGCATTAATAACTATCTGGGACCGAATAATGTCGGCACTCAGCATATTGAGGACTTGCATGATTTAGGCTATTTACCAATGGTTATCAAGGCATTGCCTGAAGGCTCAGTATATCCATTACGTGTGCCTATGTTTACCATGTACAATACCGATGAGCGCTTCTTTTGGCTGACCAATTATTTTGAAACCCTGCTGTCCGCTGTTGTGTGGCTTCCGTGTACTAGTGCTACTATTGCGAAACAATACCGCAAAATCTTAGAGACCTATGCGTTAGAAACCAGCAGTGACATCGCTTTTGTTGATTGGCAGGGTCACGATTTTAGTATGCGTGGCATGGGTGGTATTGAGGCCGCGGTCATGAGCGGCGCCGGTCATTTACTGAGTTTTACTGGGACAGATACCATTCCGGCCATTGATTTTCTGGAGCAATATTACAATGCTGATAGTGATAAAGAACTGGTCGGTGGCAGTGTGGCTGCAACGGAGCACAGCGTGATGTGCATGGGTGGCATGGAGGGTGAATTAGAGACGTTCAAACGTCTGATTGAAGATATTTACCCTAGTGGCATTGTGAGTATCGTTTCTGATACATGGGATCTGTGGAAGGTGCTGACAGAATATCTGCCAGCGTTAAAAGAACGCATTCTGGCCCGCGATGGCAAAGTGGTGATTCGTCCTGATAGCGGTGATCCTGTGAAGATCATTTGTGGCAATCCAAATGGTAAAATCGGTAGCCCTGAGTATAAAGGCGTTATCGAGCTGTTGTGGGATGTCTTTGGTGGCACCACAAATGCCAAAGGTTACAAAGAATTAGATCCGCATATCGGAGCAATTTATGGCGATTCAATTACGATTGAACGTGCTGAAGCCATTTGTGAACGTTTGAAGGCCAAAGGTTTTGCATCAACCAATGTTGTGCTTGGAATTGGCAGTTTTACCTATCAATACAATACCCGTGATACTTTCGGTTTTGCCATGAAAGCGACCTATGGTGAAGTTGATGGTGAAGGTCGTGAAATCTTTAAAGATCCTATTACTGATGATGGCACTAAAAAATCCGCTAAGGGTTTAGTAGCGGTATTTAAAGATGAGCAGGGTCAATTTTATCTGAAAGATCAAGCCAGCTGGCAAGATGTTAACAATTGCGAGTTTGTCCCGGTATTTGCCGATGGTGAATTATTAACGGAATATTCTTTGGCTGATATTCGCGCACGTCTGGCAGCGTCTCGTCGCTAA

nSEQ ID No.4

ATGTACTTGAATCCGGTTACTGCTATTGATGGCTACAAAGTCGACCACCGTCGTCAATATCCGGATAATACTCAAGTGATTTTTAGTAACTTGACCGCCCGTAAATCCCGTCGTGGTTATACAGACCAAATGGTATTTTTTGGCTTGCAGTATTTTATCAAGCATTACTTAATTGACAGTTGGAACCGTGATTTCTTTCAACAGCCGAAAGAGCAAGTGATCTGCCAATTCTCCCGCCGCATTAATAACTATCTGGGACCGAATAATGTCGGCACTCAGCATATTGAGGAGTTGCATGATTTAGGCTATTTACCAATTAAAATCATGGCATTGCCTGAAGGCTCAGTATATCCATTAAAAGTGCCTTGCTTGATTTTGTACAATACCGATGAGCGCTTCTTTTGGCTGACCAATTATCTGGAAACCATCCTGTCCGCTAATGTGTGGGGTATGTGTACTAGTGCTACTACCGCGCTGCAATACCGCAAAATCTTTGAGGCTTATGCGTTAGAAACCGATGGTGACATCGCTTTTGTTGATTGGCAGGGTCACGATTTTAGTTTCCGTGGCATGTATGGTGTAGAGGCCGCGATCATGAGCGGCGCCGCCCATTTACTGAGTTTTACTGGGACAGATACCATTCCGGCCATTGATTTTCTGGAGCAATATTACAATGCTGATAGTGATAAAGAACTGGTCGGTGGCAGTGTGGCAGCAACGGAGCACAGCGTGATGTGCATGGGTGGCATGGAGGGTGAATTAGAGACGTTCAAACGTCTGATTGAAGATATTTACCCTAGCGGCATTGTGAGTATCGTTTCTGATACCTGGGATCTGTGGAAAGTGCTGACAGAATATCTGCCGGCGTTAAAAGAACGCATTCTGGCCCGCGATGGCAAAGTGGTGTTTCGTCCTGATACGGGTTGCCCTGTGAAGATCATTTGTGGCGATCCACAAGCACCAATCGGTAGCCCTGAGTATAAAGGCGCTATCGAGTGTTTGTGGGATGTCTTTGGTGGCAGCACAACTGCCAAAGGTTACAAATTACTGGATAGCCATGTCGGACTGATTTATGGCGATTCAATTACGATTGAACGTGCTGAAGCCATTTGTGCCGGTTTGAAGGCCAAAGGTTTTGCATCAACCAATATTGTGTTTGGAATTGGCAGTTTTACCTATCAACACGTGACCCGTGATACTGACGGTTATGCCGTGAAAGCGACCTTTGCGAAAGTTGATGGTAAAGACCGTGAAATCTTTAAAGATCCTAAAACTGATGATGGCACTAAAAAATCCGCTAAGGGTTTAGTAGCGGTATTTAAAGATGAGCAGGGTCAATTTTATCTGAAAGATCAAGCCAGCTGGCAAGATGTTAACAATTGCGAGTTTGTCCCGGTATTTGCCGATGGTAAATTATTAAATGAAGTTTCTTTGACCGAAATTCGCGCACGTCTGTAA

Sequence listing

<110> Chengdu and He Biotech Co., ltd

<120> nicotinamide phosphoribosyl transferase for preparing nicotinamide mononucleotide, coding gene, vector and application

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 495

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Asp Asn Leu Leu Asn Tyr Ser Ser Arg Ala Ser Ala Ile Pro Ser

1 5 10 15

Leu Leu Cys Asp Phe Tyr Lys Thr Ser His Arg Ile Gln Tyr Pro Glu

20 25 30

Gly Thr Gln Ile Leu Tyr Ser Thr Phe Thr Pro Arg Ser Asn Lys Gln

35 40 45

Ala Pro Tyr Leu Thr Arg Val Val Ser Phe Gly Phe Gln Ala Phe Ile

50 55 60

Thr Lys Tyr Leu Ile His Tyr Phe Asn Asp Asn Phe Phe Ser Arg Asp

65 70 75 80

Lys Asp Glu Val Val Ser Glu Tyr Ser Ala Phe Ile Lys Lys Thr Leu

85 90 95

Gln Leu Glu Asp Thr Gly Glu His Ile Ala Gln Leu His Glu Leu Gly

100 105 110

Tyr Leu Pro Ile Arg Ile Lys Ala Ile Pro Glu Gly Lys Ser Val Ala

115 120 125

Ile Lys Val Pro Val Met Thr Ile Glu Asn Thr His Pro Asp Phe Phe

130 135 140

Trp Leu Thr Asn Tyr Leu Glu Thr Leu Ile Asn Val Ser Leu Trp Gln

145 150 155 160

Pro Met Thr Ser Ala Ser Ile Ala Phe Ala Tyr Arg Thr Ile Leu Val

165 170 175

Lys Phe Ala Asn Glu Thr Cys Asp Asn Gln Asp His Val Pro Phe Gln

180 185 190

Ser His Asp Phe Ser Met Arg Gly Met Ser Ser Leu Glu Ser Ala Glu

195 200 205

Thr Ser Gly Ala Gly His Leu Thr Ser Phe Leu Gly Thr Asp Thr Ile

210 215 220

Pro Ala Ile Ser Phe Ile Glu Ala Tyr Tyr Gly Ser Lys Ser Leu Ile

225 230 235 240

Gly Thr Ser Ile Pro Ala Ser Glu His Ser Val Met Ser Ala His Gly

245 250 255

Val Asp Glu Leu Pro Thr Phe Arg Tyr Leu Met Ala Lys Tyr Pro His

260 265 270

Asn Met Leu Ser Ile Val Ser Asp Thr Thr Asp Phe Trp His Asn Ile

275 280 285

Thr Val Asn Leu Pro Leu Leu Lys Gln Glu Ile Met Ala Arg Pro Glu

290 295 300

Asn Ala Lys Val Val Ile Arg Pro Asp Ser Gly Asp Phe Phe Ala Ile

305 310 315 320

Ile Cys Gly Asp Pro Thr Ala Asp Thr Glu His Glu Arg Lys Gly Leu

325 330 335

Ile Glu Cys Leu Trp Asp Ile Phe Gly Gly Thr Val Asn Gln Lys Gly

340 345 350

Tyr Lys Val Leu Asp Pro His Ile Gly Ala Ile Tyr Gly Asp Gly Val

355 360 365

Thr Tyr Glu Lys Met Phe Lys Ile Leu Glu Gly Leu Gln Ala Lys Gly

370 375 380

Phe Ala Ser Ser Asn Ile Val Phe Gly Val Gly Ala Gln Thr Tyr Gln

385 390 395 400

Arg Asn Thr Arg Asp Thr Leu Gly Phe Ala Ile Lys Ala Thr Ser Ile

405 410 415

Thr Ile Asn Gly Glu Glu Lys Ala Ile Phe Lys Asn Pro Lys Thr Asp

420 425 430

Asp Gly Leu Lys Lys Ser Gln Lys Gly Arg Val Lys Val Leu Ser Arg

435 440 445

Asp Thr Tyr Ile Asp Gly Leu Thr Ala Ala Asp Asp Phe Ser Asp Asp

450 455 460

Leu Leu Glu Val Val Phe Glu Asp Gly Lys Leu Val Arg Gln Thr Asp

465 470 475 480

Phe Asp Glu Ile Arg Gln Asn Leu Leu Val Ser Arg Thr Thr Leu

485 490 495

<210> 2

<211> 488

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Asp Ser Leu Leu Asn His Tyr Ser Arg Ala Ser Ala Ile Pro Ser

1 5 10 15

Leu Leu Cys Asp Phe Tyr Lys Thr Ser His Arg Ile Met Tyr Pro Glu

20 25 30

Gly Ser Gln Ile Ile Tyr Ser Thr Phe Thr Pro Arg Ser Asn Glu Gln

35 40 45

Ala Pro Tyr Leu Thr Gln Val Val Ser Phe Gly Phe Gln Ala Phe Ile

50 55 60

Ile Lys Tyr Leu Ile His Tyr Phe Asn Asp Asn Phe Phe Ser Arg Asp

65 70 75 80

Lys His Asp Val Val Thr Glu Tyr Ser Ala Phe Ile Glu Lys Thr Leu

85 90 95

Gln Leu Glu Asp Thr Gly Glu His Ile Ala Lys Leu His Glu Leu Gly

100 105 110

Tyr Leu Pro Ile Arg Ile Lys Ala Ile Pro Glu Gly Lys Thr Val Ala

115 120 125

Ile Lys Val Pro Val Met Thr Ile Glu Asn Thr His Pro Asp Phe Cys

130 135 140

Trp Leu Thr Asn Tyr Leu Glu Thr Leu Ile Asn Val Ser Leu Trp Gln

145 150 155 160

Pro Met Thr Ser Ala Ser Ile Ala Phe Ala Tyr Arg Thr Ala Leu Ile

165 170 175

Lys Phe Ala Asn Glu Thr Cys Asp Asn Gln Glu His Val Pro Phe Gln

180 185 190

Ser His Asp Phe Ser Met Arg Gly Met Ser Ser Leu Glu Ser Ala Glu

195 200 205

Thr Ser Gly Ala Gly His Leu Thr Ser Phe Leu Gly Thr Asp Thr Ile

210 215 220

Pro Ala Leu Ser Phe Val Glu Ala Tyr Tyr Gly Ser Ser Ser Leu Ile

225 230 235 240

Gly Thr Ser Ile Pro Ala Ser Glu His Ser Val Met Ser Ser His Gly

245 250 255

Val Asp Glu Leu Ser Thr Phe Arg Tyr Leu Met Ala Lys Phe Pro Asn

260 265 270

Ser Met Leu Ser Ile Val Ser Asp Thr Thr Asp Phe Trp His Asn Ile

275 280 285

Thr Val Asn Leu Pro Leu Leu Lys Gln Glu Ile Ile Ala Arg Pro Glu

290 295 300

Asn Ala Arg Leu Val Ile Arg Pro Asp Ser Gly Asn Phe Phe Ala Ile

305 310 315 320

Ile Cys Gly Asp Pro Thr Ala Asp Thr Glu His Glu Arg Lys Gly Leu

325 330 335

Ile Glu Cys Leu Trp Asp Ile Phe Gly Gly Thr Val Asn Gln Lys Gly

340 345 350

Tyr Lys Val Ile Asn Pro His Ile Gly Ala Ile Tyr Gly Asp Gly Val

355 360 365

Thr Tyr Glu Lys Met Val Lys Ile Leu Glu Gly Leu Lys Ala Lys Gly

370 375 380

Phe Ala Ser Ser Asn Ile Val Phe Gly Val Gly Ala Gln Thr Tyr Gln

385 390 395 400

Arg Asn Thr Arg Asp Thr Leu Gly Phe Ala Leu Lys Ala Thr Ser Ile

405 410 415

Thr Ile Asn Gly Glu Glu Lys Ala Ile Phe Lys Asn Pro Lys Thr Asp

420 425 430

Asn Gly Leu Lys Lys Ser Gln Lys Gly Arg Val Lys Leu Leu Ser Tyr

435 440 445

Asp Thr Tyr Leu Asp Gly Leu Thr Ala Lys Asp Asp Phe Ser Asp Asp

450 455 460

Leu Leu Glu Leu Leu Phe Glu Asn Gly Lys Leu Leu Arg Arg Thr Asp

465 470 475 480

Phe Asp Gln Ile Arg Gln Asn Leu

485

<210> 3

<211> 490

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Met Tyr Met Asn Pro Leu Leu Leu Thr Asp Gly Tyr Lys Val Asp His

1 5 10 15

Arg Arg Gln Tyr Pro Asp Asn Thr Thr Leu Val Tyr Ser Asn Trp Thr

20 25 30

Pro Arg Lys Ser Arg Ile Glu Tyr Val Asp Gln Met Val Phe Phe Gly

35 40 45

Leu Gln Tyr Phe Ile Lys Lys Tyr Ile Ile Glu Asp Phe Asn Arg Asn

50 55 60

Phe Phe Asn Gln Pro Lys Glu Gln Val Ile Lys Lys Tyr Ala Arg Arg

65 70 75 80

Ile Asn Asn Tyr Leu Gly Pro Asn Asn Val Gly Thr Gln His Ile Glu

85 90 95

Asp Leu His Asp Leu Gly Tyr Leu Pro Met Val Ile Lys Ala Leu Pro

100 105 110

Glu Gly Ser Val Tyr Pro Leu Arg Val Pro Met Phe Thr Met Tyr Asn

115 120 125

Thr Asp Glu Arg Phe Phe Trp Leu Thr Asn Tyr Phe Glu Thr Leu Leu

130 135 140

Ser Ala Val Val Trp Leu Pro Cys Thr Ser Ala Thr Ile Ala Lys Gln

145 150 155 160

Tyr Arg Lys Ile Leu Glu Thr Tyr Ala Leu Glu Thr Ser Ser Asp Ile

165 170 175

Ala Phe Val Asp Trp Gln Gly His Asp Phe Ser Met Arg Gly Met Gly

180 185 190

Gly Ile Glu Ala Ala Val Met Ser Gly Ala Gly His Leu Leu Ser Phe

195 200 205

Thr Gly Thr Asp Thr Ile Pro Ala Ile Asp Phe Leu Glu Gln Tyr Tyr

210 215 220

Asn Ala Asp Ser Asp Lys Glu Leu Val Gly Gly Ser Val Ala Ala Thr

225 230 235 240

Glu His Ser Val Met Cys Met Gly Gly Met Glu Gly Glu Leu Glu Thr

245 250 255

Phe Lys Arg Leu Ile Glu Asp Ile Tyr Pro Ser Gly Ile Val Ser Ile

260 265 270

Val Ser Asp Thr Trp Asp Leu Trp Lys Val Leu Thr Glu Tyr Leu Pro

275 280 285

Ala Leu Lys Glu Arg Ile Leu Ala Arg Asp Gly Lys Val Val Ile Arg

290 295 300

Pro Asp Ser Gly Asp Pro Val Lys Ile Ile Cys Gly Asn Pro Asn Gly

305 310 315 320

Lys Ile Gly Ser Pro Glu Tyr Lys Gly Val Ile Glu Leu Leu Trp Asp

325 330 335

Val Phe Gly Gly Thr Thr Asn Ala Lys Gly Tyr Lys Glu Leu Asp Pro

340 345 350

His Ile Gly Ala Ile Tyr Gly Asp Ser Ile Thr Ile Glu Arg Ala Glu

355 360 365

Ala Ile Cys Glu Arg Leu Lys Ala Lys Gly Phe Ala Ser Thr Asn Val

370 375 380

Val Leu Gly Ile Gly Ser Phe Thr Tyr Gln Tyr Asn Thr Arg Asp Thr

385 390 395 400

Phe Gly Phe Ala Met Lys Ala Thr Tyr Gly Glu Val Asp Gly Glu Gly

405 410 415

Arg Glu Ile Phe Lys Asp Pro Ile Thr Asp Asp Gly Thr Lys Lys Ser

420 425 430

Ala Lys Gly Leu Val Ala Val Phe Lys Asp Glu Gln Gly Gln Phe Tyr

435 440 445

Leu Lys Asp Gln Ala Ser Trp Gln Asp Val Asn Asn Cys Glu Phe Val

450 455 460

Pro Val Phe Ala Asp Gly Glu Leu Leu Thr Glu Tyr Ser Leu Ala Asp

465 470 475 480

Ile Arg Ala Arg Leu Ala Ala Ser Arg Arg

485 490

<210> 4

<211> 485

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Met Tyr Leu Asn Pro Val Thr Ala Ile Asp Gly Tyr Lys Val Asp His

1 5 10 15

Arg Arg Gln Tyr Pro Asp Asn Thr Gln Val Ile Phe Ser Asn Leu Thr

20 25 30

Ala Arg Lys Ser Arg Arg Gly Tyr Thr Asp Gln Met Val Phe Phe Gly

35 40 45

Leu Gln Tyr Phe Ile Lys His Tyr Leu Ile Asp Ser Trp Asn Arg Asp

50 55 60

Phe Phe Gln Gln Pro Lys Glu Gln Val Ile Cys Gln Phe Ser Arg Arg

65 70 75 80

Ile Asn Asn Tyr Leu Gly Pro Asn Asn Val Gly Thr Gln His Ile Glu

85 90 95

Glu Leu His Asp Leu Gly Tyr Leu Pro Ile Lys Ile Met Ala Leu Pro

100 105 110

Glu Gly Ser Val Tyr Pro Leu Lys Val Pro Cys Leu Ile Leu Tyr Asn

115 120 125

Thr Asp Glu Arg Phe Phe Trp Leu Thr Asn Tyr Leu Glu Thr Ile Leu

130 135 140

Ser Ala Asn Val Trp Gly Met Cys Thr Ser Ala Thr Thr Ala Leu Gln

145 150 155 160

Tyr Arg Lys Ile Phe Glu Ala Tyr Ala Leu Glu Thr Asp Gly Asp Ile

165 170 175

Ala Phe Val Asp Trp Gln Gly His Asp Phe Ser Phe Arg Gly Met Tyr

180 185 190

Gly Val Glu Ala Ala Ile Met Ser Gly Ala Ala His Leu Leu Ser Phe

195 200 205

Thr Gly Thr Asp Thr Ile Pro Ala Ile Asp Phe Leu Glu Gln Tyr Tyr

210 215 220

Asn Ala Asp Ser Asp Lys Glu Leu Val Gly Gly Ser Val Ala Ala Thr

225 230 235 240

Glu His Ser Val Met Cys Met Gly Gly Met Glu Gly Glu Leu Glu Thr

245 250 255

Phe Lys Arg Leu Ile Glu Asp Ile Tyr Pro Ser Gly Ile Val Ser Ile

260 265 270

Val Ser Asp Thr Trp Asp Leu Trp Lys Val Leu Thr Glu Tyr Leu Pro

275 280 285

Ala Leu Lys Glu Arg Ile Leu Ala Arg Asp Gly Lys Val Val Phe Arg

290 295 300

Pro Asp Thr Gly Cys Pro Val Lys Ile Ile Cys Gly Asp Pro Gln Ala

305 310 315 320

Pro Ile Gly Ser Pro Glu Tyr Lys Gly Ala Ile Glu Cys Leu Trp Asp

325 330 335

Val Phe Gly Gly Ser Thr Thr Ala Lys Gly Tyr Lys Leu Leu Asp Ser

340 345 350

His Val Gly Leu Ile Tyr Gly Asp Ser Ile Thr Ile Glu Arg Ala Glu

355 360 365

Ala Ile Cys Ala Gly Leu Lys Ala Lys Gly Phe Ala Ser Thr Asn Ile

370 375 380

Val Phe Gly Ile Gly Ser Phe Thr Tyr Gln His Val Thr Arg Asp Thr

385 390 395 400

Asp Gly Tyr Ala Val Lys Ala Thr Phe Ala Lys Val Asp Gly Lys Asp

405 410 415

Arg Glu Ile Phe Lys Asp Pro Lys Thr Asp Asp Gly Thr Lys Lys Ser

420 425 430

Ala Lys Gly Leu Val Ala Val Phe Lys Asp Glu Gln Gly Gln Phe Tyr

435 440 445

Leu Lys Asp Gln Ala Ser Trp Gln Asp Val Asn Asn Cys Glu Phe Val

450 455 460

Pro Val Phe Ala Asp Gly Lys Leu Leu Asn Glu Val Ser Leu Thr Glu

465 470 475 480

Ile Arg Ala Arg Leu

485

<210> 5

<211> 1488

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atggataacc tgttaaatta tagtagtcgt gctagtgcta ttccatcatt attatgcgat 60

ttttacaaaa catctcatcg tatccagtat ccggaaggta cacaaattct gtatagtaca 120

tttacacctc gtagcaataa acaagcgcct tatttaacac gtgttgtgtc atttggtttt 180

caagccttta tcaccaaata tttaattcat tattttaatg ataacttttt ttctcgtgat 240

aaagatgaag ttgtgagcga atactctgca tttattaaga aaaccttaca gttagaggat 300

acgggtgaac acattgcaca gttacatgag ttgggttatt tgcctatccg tattaaagct 360

attcctgaag gaaaaagcgt ggcaattaaa gttccggtga tgacgattga aaatacgcat 420

cctgatttct tttggctgac taactattta gaaacattaa ttaatgtatc actgtggcag 480

ccgatgactt ctgcctcgat tgcttttgct tatcgtacaa ttttagttaa atttgctaat 540

gaaacttgtg ataatcaaga tcatgtgcca tttcaatcgc atgatttttc aatgcgtggt 600

atgagttctt tagaatccgc agaaacttca ggtgctggcc atttaacttc ttttttaggt 660

acagacacta ttcctgcaat ttcttttatt gaagcgtatt atggttcaaa gagtctgatt 720

ggcacgtcta ttccggcttc tgagcattca gtaatgagtg cacatggtgt cgatgaatta 780

ccgacatttc gttatttaat ggcaaaatat ccgcataata tgttgtcaat tgtgtcagat 840

actacagact tttggcataa cattaccgtt aatttgccgt tattaaagca agaaattatg 900

gcacgtccag aaaatgccaa agttgtcatt cgtccagata gcggtgactt ttttgcgatt 960

atttgtggtg atccaaccgc tgatactgag catgaacgta aaggactgat tgaatgttta 1020

tgggatattt ttggtggtac agttaatcag aaaggttata aagtgttaga tccacatatt 1080

ggggcaattt atggtgatgg cgtgacttat gaaaaaatgt ttaagatctt agaaggatta 1140

caagccaaag gatttgcctc aagtaatatt gtgtttggcg ttggtgcaca aacctatcaa 1200

cgtaatacac gtgatacgtt gggctttgcg attaaagcga catctatcac tattaatggc 1260

gaagaaaaag ctattttcaa aaatcctaaa accgatgatg gtctgaaaaa atcgcaaaaa 1320

ggtcgtgtta aagtgctgtc tcgtgatact tacattgatg gtttaactgc agcggatgat 1380

tttagtgatg atttattaga ggtggttttt gaagatggta agttagttcg ccaaacagac 1440

tttgatgaaa ttcgtcaaaa cttgttagtt agtcgcacta cgctgtaa 1488

<210> 6

<211> 1467

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atggatagcc tgttaaatca ttatagtcgt gctagtgcta ttccatcatt attatgcgat 60

ttttacaaaa catctcatcg tatcatgtat ccggaaggtt cacaaattat ttatagtaca 120

tttacacctc gtagcaatga acaagcgcct tatttaacac aagttgtgtc atttggtttt 180

caagccttta tcattaaata tttaattcat tattttaatg ataacttttt ttctcgtgat 240

aaacatgatg ttgtgactga atactctgca tttattgaga aaaccttaca gttagaggat 300

acgggtgaac acattgcaaa attacatgag ttgggttatt tgcctatccg tattaaagct 360

attcctgaag gaaaaacggt ggcaattaaa gttccggtga tgacgattga aaatacgcat 420

ccggatttct gttggctgac taactattta gaaacattaa ttaatgtatc actgtggcag 480

ccgatgactt ctgcctcgat tgcttttgct tatcgtacag cattaattaa atttgctaat 540

gaaacttgtg ataatcaaga acatgtgcca tttcaatcgc atgatttttc aatgcgtggt 600

atgagttctt tagaatccgc agaaacttca ggtgctggcc atttaacttc ttttttaggt 660

acagacacta ttcctgcact gtcttttgtt gaagcgtatt atggttcaag cagtctgatt 720

ggcacgtcta ttccggcttc tgagcattca gtaatgagtt cacatggtgt cgatgaatta 780

tcaacatttc gttatttaat ggcaaaattt ccgaatagta tgttgtcaat tgtgtcagat 840

actacagact tttggcataa cattaccgtt aatttgccgt tattaaagca agaaattatt 900

gcacgtccag aaaatgcccg tttagtcatt cgtccagata gcggtaactt ttttgcgatt 960

atttgtggtg atccaaccgc tgatactgag catgaacgta aaggactgat tgaatgttta 1020

tgggatattt ttggtggtac agttaatcag aaaggttata aagtgatcaa tccacatatt 1080

ggggcaattt atggtgatgg cgtgacttat gaaaaaatgg ttaagatctt agaaggatta 1140

aaagccaaag gatttgcctc aagtaatatt gtgtttggcg ttggtgcaca aacctatcaa 1200

cgtaatacac gtgatacgtt gggctttgcg ctgaaagcga catctatcac tattaatggc 1260

gaagaaaaag ctattttcaa aaatcctaaa accgataatg gtctgaaaaa atcgcaaaaa 1320

ggtcgtgtta aactgctgtc ttatgatact taccttgatg gtttaactgc aaaggatgat 1380

tttagtgatg atttattaga gctgttattt gaaaatggta agttattacg ccgtacagac 1440

tttgatcaga ttcgtcaaaa cttgtaa 1467

<210> 7

<211> 1473

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atgtacatga atccgctgct gctgaccgat ggctacaaag tcgaccaccg tcgtcaatat 60

ccggataata ctacactggt ttatagtaac tggaccccgc gtaaatcccg tattgaatat 120

gttgaccaaa tggtattttt tggcttgcag tattttatca agaaatacat tattgaagat 180

tttaaccgta atttctttaa tcagccgaaa gagcaagtga tcaagaaata tgcccgccgc 240

attaataact atctgggacc gaataatgtc ggcactcagc atattgagga cttgcatgat 300

ttaggctatt taccaatggt tatcaaggca ttgcctgaag gctcagtata tccattacgt 360

gtgcctatgt ttaccatgta caataccgat gagcgcttct tttggctgac caattatttt 420

gaaaccctgc tgtccgctgt tgtgtggctt ccgtgtacta gtgctactat tgcgaaacaa 480

taccgcaaaa tcttagagac ctatgcgtta gaaaccagca gtgacatcgc ttttgttgat 540

tggcagggtc acgattttag tatgcgtggc atgggtggta ttgaggccgc ggtcatgagc 600

ggcgccggtc atttactgag ttttactggg acagatacca ttccggccat tgattttctg 660

gagcaatatt acaatgctga tagtgataaa gaactggtcg gtggcagtgt ggctgcaacg 720

gagcacagcg tgatgtgcat gggtggcatg gagggtgaat tagagacgtt caaacgtctg 780

attgaagata tttaccctag tggcattgtg agtatcgttt ctgatacatg ggatctgtgg 840

aaggtgctga cagaatatct gccagcgtta aaagaacgca ttctggcccg cgatggcaaa 900

gtggtgattc gtcctgatag cggtgatcct gtgaagatca tttgtggcaa tccaaatggt 960

aaaatcggta gccctgagta taaaggcgtt atcgagctgt tgtgggatgt ctttggtggc 1020

accacaaatg ccaaaggtta caaagaatta gatccgcata tcggagcaat ttatggcgat 1080

tcaattacga ttgaacgtgc tgaagccatt tgtgaacgtt tgaaggccaa aggttttgca 1140

tcaaccaatg ttgtgcttgg aattggcagt tttacctatc aatacaatac ccgtgatact 1200

ttcggttttg ccatgaaagc gacctatggt gaagttgatg gtgaaggtcg tgaaatcttt 1260

aaagatccta ttactgatga tggcactaaa aaatccgcta agggtttagt agcggtattt 1320

aaagatgagc agggtcaatt ttatctgaaa gatcaagcca gctggcaaga tgttaacaat 1380

tgcgagtttg tcccggtatt tgccgatggt gaattattaa cggaatattc tttggctgat 1440

attcgcgcac gtctggcagc gtctcgtcgc taa 1473

<210> 8

<211> 1458

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atgtacttga atccggttac tgctattgat ggctacaaag tcgaccaccg tcgtcaatat 60

ccggataata ctcaagtgat ttttagtaac ttgaccgccc gtaaatcccg tcgtggttat 120

acagaccaaa tggtattttt tggcttgcag tattttatca agcattactt aattgacagt 180

tggaaccgtg atttctttca acagccgaaa gagcaagtga tctgccaatt ctcccgccgc 240

attaataact atctgggacc gaataatgtc ggcactcagc atattgagga gttgcatgat 300

ttaggctatt taccaattaa aatcatggca ttgcctgaag gctcagtata tccattaaaa 360

gtgccttgct tgattttgta caataccgat gagcgcttct tttggctgac caattatctg 420

gaaaccatcc tgtccgctaa tgtgtggggt atgtgtacta gtgctactac cgcgctgcaa 480

taccgcaaaa tctttgaggc ttatgcgtta gaaaccgatg gtgacatcgc ttttgttgat 540

tggcagggtc acgattttag tttccgtggc atgtatggtg tagaggccgc gatcatgagc 600

ggcgccgccc atttactgag ttttactggg acagatacca ttccggccat tgattttctg 660

gagcaatatt acaatgctga tagtgataaa gaactggtcg gtggcagtgt ggcagcaacg 720

gagcacagcg tgatgtgcat gggtggcatg gagggtgaat tagagacgtt caaacgtctg 780

attgaagata tttaccctag cggcattgtg agtatcgttt ctgatacctg ggatctgtgg 840

aaagtgctga cagaatatct gccggcgtta aaagaacgca ttctggcccg cgatggcaaa 900

gtggtgtttc gtcctgatac gggttgccct gtgaagatca tttgtggcga tccacaagca 960

ccaatcggta gccctgagta taaaggcgct atcgagtgtt tgtgggatgt ctttggtggc 1020

agcacaactg ccaaaggtta caaattactg gatagccatg tcggactgat ttatggcgat 1080

tcaattacga ttgaacgtgc tgaagccatt tgtgccggtt tgaaggccaa aggttttgca 1140

tcaaccaata ttgtgtttgg aattggcagt tttacctatc aacacgtgac ccgtgatact 1200

gacggttatg ccgtgaaagc gacctttgcg aaagttgatg gtaaagaccg tgaaatcttt 1260

aaagatccta aaactgatga tggcactaaa aaatccgcta agggtttagt agcggtattt 1320

aaagatgagc agggtcaatt ttatctgaaa gatcaagcca gctggcaaga tgttaacaat 1380

tgcgagtttg tcccggtatt tgccgatggt aaattattaa atgaagtttc tttgaccgaa 1440

attcgcgcac gtctgtaa 1458

Claims

1. A nicotinamide riboside phosphate transferase for use in the preparation of nicotinamide mononucleotide, wherein the enzyme is a protein of (a) or (b) as follows:

(a) The amino acid sequence of the protein is shown as SEQ ID No. 3;

(b) The amino acid sequence of the protein is shown as SEQ ID No. 4.

2. A gene encoding nicotinamide riboside phosphate transferase that produces nicotinamide mononucleotide according to claim 1.

3. The gene according to claim 2, wherein the nucleotide sequence of the gene encoding the protein shown in SEQ ID No.3 is shown in SEQ ID No. 7; the nucleotide sequence of the gene encoding the protein shown in SEQ ID No.4 is shown in SEQ ID No. 8.

4. A recombinant expression vector comprising the gene encoding nicotinamide riboside transferase for use in the preparation of nicotinamide mononucleotide of claim 2.

5. A genetically engineered host cell comprising the recombinant expression vector of claim 4.

6. The genetically engineered host cell of claim 5, wherein the host cell is e.

7. The genetically engineered host cell of claim 6, wherein the host cell is e.coli BL21 (DE 3), BLR (DE 3), BL21 (DE 3) pLysS, M15, TB1, DH5 a, or Top10.

8. The application of the gene for encoding nicotinamide riboside phosphate transferase for preparing nicotinamide mononucleotide is characterized in that the nucleotide sequence of the gene is shown as SEQ ID No.7 or SEQ ID No.8, and the gene is used for heterologous recombinant expression.

9. The use according to claim 8, wherein the method of heterologous recombinant expression comprises the steps of: (1) constructing the recombinant expression vector of claim 4; (2) Transforming a host cell with the recombinant expression vector of step (1) to obtain a genetically engineered host cell of claim 5; (3) Culturing the genetically engineered host cell of step (2), and inducing expression of the recombinant nicotinamide riboside transferase by addition of lactose or IPTG.

10. A method for preparing a β -nicotinamide mononucleotide comprising the steps of: (1) constructing the recombinant expression vector of claim 4; (2) Transforming a host cell with the recombinant expression vector of step (1) to obtain a genetically engineered host cell of claim 5; (3) Culturing the genetically engineered host cell of step (2), inducing expression of the recombinant nicotinamide riboside transferase by addition of lactose or IPTG; (4) adding a substrate nicotinamide; (5) After the step (4) is finished, continuing to culture the bacterial liquid, and culturing by using a shake flask method or a fermentation tank; meanwhile, detecting the OD600 value of the bacterial liquid in each hour, and calculating the density of the escherichia coli; culturing below od600=3.0; culturing by adopting an escherichia coli culture medium, wherein the escherichia coli culture medium is LB or PYA, and the culture temperature is 35-38 ℃.