CN113652407A

CN113652407A - Carbonyl reductase mutant and application thereof in asymmetric synthesis of bi-chiral compound

Info

Publication number: CN113652407A
Application number: CN202110782079.8A
Authority: CN
Inventors: 王亚军; 程峰; 翟秋瑶; 邱帅; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2021-07-09
Filing date: 2021-07-09
Publication date: 2021-11-16
Anticipated expiration: 2041-07-09
Also published as: CN113652407B

Abstract

The invention discloses a carbonyl reductase mutant and application of asymmetric synthesis of a bi-chiral compound thereof, wherein the mutant is obtained by performing single mutation on the 100 th site of a wild carbonyl reductase KmCR-WT amino acid sequence shown in SEQ ID NO. 1. Compared with the wild type, the activity of the mutant A100S is improved by 0.8 times, and the mutant has strict S-configuration stereoselectivity. The catalytic activity of other aliphatic ketone compounds is improved, wherein the enzyme activity of isobutyryl ethyl acetate and butyryl ethyl acetate is higher than the level of the literature reported at present.

Description

Carbonyl reductase mutant and application thereof in asymmetric synthesis of bi-chiral compound

(I) technical field

The invention relates to a semi-rational modification strategy of carbonyl reductase KmCR belonging to short-chain dehydrogenase/reductase Superfamily (SDR), wherein a mutant catalyzes and synthesizes chiral diol 6-cyano- (3S,5R) -dihydroxyhexanoate tert-butyl ester, and particularly relates to error-prone PCR (polymerase chain reaction) by selecting a proper region with the assistance of a computer and establishing a proper screening method.

(II) background of the invention

Carbonyl reductases (EC 1.1.1.184) belong to the general class of oxidoreductases, are very common in nature and are widely present in various plant, microbial, and mammalian tissues, relying on NADP (H) (nicotinamide adenine dinucleotide phosphate) or NAD (H) (nicotinamide adenine dinucleotide) as coenzymes. Carbonyl reductases are distributed mainly in three superfamilies according to the difference in their amino acid sequence length and catalytically active site: Aldo-Keto Reductase Superfamily (AKRs), Medium-chain dehydrogenase/Reductase Superfamily (MDRs), Short-chain dehydrogenase/Reductase Superfamily (SDRs).

AKRs are generally present in monomeric form, containing around 320 amino acids, and are approximately 35kDa in size, a class of non-metal-dependent reductases. It is capable of binding nicotinamide coenzymes without the need for Rossmann folding. AKRs have high sequence similarity and are typical (alpha/beta)₈The barrel structure, Y (tyrosine) -K (lysine) -H (histidine) -D (aspartic acid), is its catalytically active quadruplet. MDRs, which usually exist as dimers or tetramers with a single subunit of about 350 amino acids, are a class of zinc-or non-zinc-dependent dehydrogenases, depending on whether there is a conserved G-H-E Zn²⁺A binding site. The sequence homology of the compounds is high and can generally reach 40-90%. Its three-dimensional structure contains the Rossmann fold, TGxxxGxG is its conserved coenzyme binding domain, and D (aspartic acid) -Y (tyrosine) -K (lysine) -H (histidine) is its catalytically active quadruplet.

SDRs are one of the largest, oldest protein superfamily known to date, and are widely available from a wide variety of organisms, ranging from archaea to higher eukaryotes and viruses. SDRs are typically monomeric, dimeric or tetrameric proteins, with single subunits containing about 250 amino acid residues, but also SDR forms of 350 residues, with these subunits extending at the C-terminus. SDRs are a class of nonmetallic, dependent dehydrogenases. Although most short-chain dehydrogenases have low sequence homology, generally only 15-30%, their tertiary structure has some common characteristics: (i) has a conserved 3D structure, Rossmann fold, typically a beta-alpha-beta topology with beta sheet and alpha helix; (ii) the N-terminal has a nucleotide cofactor binding motif TGxxxGxG; (iii) vectors with yxxxxk active site. The classical catalytic triad of SDR is defined as "S-Y-K", but this is not absolute. Among them, Ser is sometimes substituted by Thr and Tyr is sometimes substituted by Met. With the development of crystallization technology, more and more short-chain dehydrogenases were identified in structure, Asn was found to have some activation effect on Lys in the catalytic triad of the short-chain dehydrogenase, thus forming the most SDR-form of the catalytically active center "N-S-Y-K".

The carbonyl reductase can catalyze the asymmetric reduction of aliphatic ketone, aromatic ketone, aldehyde, quinone and the like to generate corresponding chiral alcohol. Chiral alcohols play a very important role in the fields of pharmaceutical manufacturing, food health, agrochemicals, and the like. In the invention, a directed evolution strategy of region epPCR (error-pro PCR) is designed, and a mutant with higher activity and stereoselectivity than a wild strain carbonyl reductase KmCR is obtained by a thin-layer chromatography screening method.

Disclosure of the invention

The invention aims to solve the problems of low activity, low stereoselectivity, narrow substrate spectrum range and the like of the conventional carbonyl reductase KmCR catalytic reduction 6-cyano- (5R) -3-tert-butyl carbonylhexanoate (A6), provide a stereoselective carbonyl reductase mutant, a gene recombinant strain utilizing the carbonyl reductase mutant and an enzyme solution thereof as a biocatalyst, is used for asymmetric reduction of aliphatic ketone compounds to prepare chiral compounds, particularly mutant reduction of tert-butyl 6-cyano- (5R) -3-carbonyl hexanoate (A6) to generate tert-butyl 6-cyano- (3S,5R) -dihydroxyhexanoate, the stereo selection can reach the requirement of optical purity, the catalytic activity is improved by about 0.8 time, the mutant is used for testing different aliphatic ketone compounds, and the catalytic activity of the aliphatic ketone compounds is improved to a certain degree.

The technical scheme adopted by the invention is as follows:

the invention provides a carbonyl reductase mutant, which is obtained by performing single mutation on the 100 th site of a wild carbonyl reductase KmCR-WT amino acid sequence shown in SEQ ID NO.1, preferably, the mutant is obtained by mutating alanine on the 100 th site of the amino acid sequence shown in SEQ ID NO.1 into one of serine, threonine or cysteine, and more preferably, the mutant is mutated into serine (the corresponding mutant is marked as KmCR-A100S).

SEQ ID NO.1：

MTFTVVTGANGYIAKHILKSLLEDGHRVIGTVRNSKKAEELKRTVNDENLIVELVPDMLVENAFDELFKKYNTQIKYVFHTASPVLETSKDYEKSLIEPAITGAKSMVEAIRKYSLTSVEHIVYTSSIAASSLESEFTDPTLVVSEDSWNPQGLEEAKTEFFTAYSYSKKIAEKTMWDFVEEYKGTEHEIKLTTVNPCFNIGPQAYEADVTETMNFTAELINHVVKSKVGDPLPPTRIVPYVDVRDTARAHVDALKNEKLAFQRLLVVGPFLSSQQIYDIVNERFPQLRGKIARGEPGSDKLDPAKLAKFDHARTTQALGWEFTPIEKAIADEVAQILRVGAYRG。

The carbonyl reductase mutant KmCR-A100S strictly follows Prelog rule, the amino acid sequence is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO. 4. Due to the specificity of the amino acid sequence, any fragment of the peptide protein containing the amino acid sequence shown in SEQ ID NO.3 or its mutant, such as conservative variant, bioactive fragment or derivative thereof, is included in the protection scope of the present invention as long as the peptide protein fragment or peptide protein variant has more than 90% homology with the aforementioned amino acid sequence. Particular such alterations may include deletions, insertions or substitutions of amino acids in the amino acid sequence; wherein for conservative changes of the variant, the substituted amino acid has a chemical structure or chemical properties similar to the original amino acid, such as replacement of isoleucine with leucine, and the variant may also have non-conservative changes, such as replacement of glycine with tryptophan.

The invention synchronously improves the stereoselectivity and catalysis of carbonyl reductaseThe transformation strategy of the carbonyl reductase mutant with the activation energy is as follows: 1) through the wild carbonyl reductase KmCR-WT homology modeling and molecular docking analysis shown in SEQ ID NO.1, the amino acids of the wild carbonyl reductase are counted and classified according to the distance between the reduced carbonyl of a substrate (aliphatic ketoester compound) and each amino acid (according to the selection of carbonyl oxygen atoms on the substrate

Amino acid residues within the range are classified), selecting the amino acid residues taking into account the length of the epPCR region fragment and the number of classified amino acids

Designing primers for amino acids within the range to establish a region epPCR; the region epPCR fragment preferably covers the amino acid fragment near the substrate acting atom or near the enzyme catalytic pocket, and the designed primer has proper length, so that the mutation rate which is reasonable and easy to operate is ensured while the range of the mutation library is reduced. 2) Establishing a thin-layer chromatography screening method to screen a mutation library obtained by the region epPCR, and re-screening by high performance liquid chromatography; the thin layer chromatography screening method should select proper developing agent to completely separate the substrate from the product and control certain sample application volume for content identification. 3) And (3) carrying out site-directed saturation mutation on the mutation sites obtained in the step (2) to determine the optimal mutant.

The invention also provides a coding gene of the carbonyl reductase mutant, a recombinant vector constructed by the coding gene and a gene engineering bacterium prepared by transforming the recombinant vector. The basic vector of the recombinant vector is preferably pET-28a (+), and the host bacterium for constructing the engineering bacterium is preferably E.coli BL21(DE 3).

The invention also provides application of the carbonyl reductase mutant in asymmetric reduction of aliphatic ketone compounds to synthesize a dual-chiral compound, wherein the aliphatic ketone compounds are tert-butyl 6-cyano- (5R) -3-carbonyl hexanoate, ethyl 4-chloroacetoacetate, ethyl acetoacetate,

ethyl

4,4, 4-trifluoroacetoacetate, tert-butyl acetoacetate, ethyl levulinate, methyl isobutyroacetate, ethyl isobutyroacetate, methyl 4-chloro-acetoacetate and ethyl butyroacetate.

The method for asymmetrically reducing the aliphatic ketone compound by using the carbonyl reductase mutant comprises the following steps: centrifuging fermentation liquor obtained after fermentation culture of carbonyl reductase mutant genetic engineering bacteria, collecting wet bacteria, forming a conversion system by using pure enzyme liquid obtained by crushing and extracting the wet bacteria as a catalyst, NADPH as a coenzyme, an aliphatic ketone compound as a substrate and a buffer solution with pH of 7.0-8.0 as a reaction medium, reacting at 35-40 ℃ and 600-800 rpm, and separating and purifying reaction liquid after the reaction is finished to obtain a chiral compound. When the substrate is tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate, the product, ambichiral compound, is tbutyl 6-cyano- (3S,5R) -dihydroxyhexanoate.

The substrate addition final concentration is 1-50mM, preferably 10mM, based on buffer volume; the final concentration of coenzyme added is 0.5-5mM, preferably 1mM based on the volume of the buffer solution; the final concentration of the catalyst is 0.1-20g/L calculated by the volume of the buffer solution, preferably, the addition amount of the pure enzyme is 0.1-10g/L calculated by the protein content, and preferably, 1-2 g/L. The reaction conditions are preferably 35 ℃ and 600 rpm. The buffer solution is acetic acid-sodium acetate buffer solution, potassium phosphate buffer solution, Tris-HCl buffer solution, preferably potassium phosphate buffer solution with pH of 7.0 and 100 mM.

The invention also discloses a method for asymmetrically reducing aliphatic ketone compounds by using the carbonyl reductase mutant, which comprises the following steps: respectively mixing wet thalli centrifugally collected from fermentation liquor obtained after fermentation culture of carbonyl reductase mutant genetic engineering bacteria and glucose dehydrogenase genetic engineering bacteria, forming a conversion system by using the mixed thalli as a catalyst, an aliphatic ketone compound as a substrate, glucose as an auxiliary substrate and a buffer solution with the pH value of 7.0-8.0 as a reaction medium, reacting at the temperature of 35-40 ℃ and the rpm of 600-800, and separating and purifying reaction liquid to obtain a chiral compound. When the substrate is tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate, the product, ambichiral compound, is tbutyl 6-cyano- (3S,5R) -dihydroxyhexanoate; the glucose dehydrogenase genetic engineering bacteria are characterized in that glucose dehydrogenase EsGDH genes shown in SEQ ID NO.6 are inserted into Nco I and Xho I sites of pET28a (+), recombinant expression vectors are constructed, and the expression vectors are transferred into E.coli BL21(DE3), so that E coli BL21(DE3)/pET28b (+) -EsGDH is prepared. In the transformation system, the adding amount of the catalyst is 0.1-20g/L (preferably 4.5g/L) calculated by the volume of the buffer solution, and the wet thalli are collected by centrifugation of fermentation liquor obtained after fermentation culture of carbonyl reductase mutant genetic engineering bacteria in the mixed thalli and the wet thalli are collected by centrifugation of the fermentation liquor obtained after fermentation culture of glucose dehydrogenase genetic engineering bacteria in a wet weight ratio of 1-5:1 (preferably 5: 1); the adding amount of the substrate is 1-150g/L, preferably 10g/L based on the volume of the buffer solution; the glucose is added in an amount of 1-150g/L, preferably 15g/L, based on the volume of the buffer.

The carbonyl reductase mutant gene engineering bacteria and the glucose dehydrogenase gene engineering bacteria are inoculated, transferred, induced and recovered, and the culture medium can be any culture medium which can enable the bacteria to grow and produce the invention in the field, preferably LB culture medium: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of NaCl, dissolving in distilled water, and sterilizing with steam at 121 ℃ for 20 min. The culture method and the culture conditions are not particularly limited, and may be appropriately selected according to the type of host and factors such as the culture method, and the like, according to ordinary knowledge in the art.

The construction method of the carbonyl reductase mutant gene engineering comprises the following steps: inserting the KmCR mutant gene of carbonyl reductase into Nco I and Xho I sites of pET28a (+), constructing a recombinant expression vector, and transferring the expression vector into E.coli BL21(DE3) to prepare the engineering bacteria containing the carbonyl reductase mutant gene.

The carbonyl reductase mutant gene engineering bacteria of the invention are prepared by wet bacteria cultured by fermentation or pure enzyme liquid extracted from the wet bacteria according to the following method:

(1) wet thalli: inoculating carbonyl reductase mutant genetic engineering bacteria into an LB liquid culture medium with a final concentration of 50 mu g/mL kanamycin, and culturing at 37 ℃ for 12-16 h to obtain a seed solution; the seed solution was inoculated into a fresh LB liquid medium containing kanamycin to a final concentration of 50. mu.g/mL in an inoculum size of 2.0% (v/v), and cultured at 37 ℃ and 200rpm for 2 hours (OD)₆₀₀0.6-0.8), adding Isopropyl thiogalactoside (IPTG) with final concentration of 0.15-0.2mM, and culturing at 28 deg.C to 12 ℃. (E)After 14h, the cells were centrifuged at 8000rpm for 10min at 4 ℃ to obtain wet cells containing the carbonyl reductase mutant.

(2) Crude enzyme solution: resuspending the wet bacteria of step (1) with 100mM PB buffer (preferably 20 g/L), and sonicating on ice for 10 min; ultrasonic crushing conditions: the power is set to 400W, the crushing is suspended for 1s and is suspended for 5 s; centrifuging at 12000rpm for 10-15 min at 4 deg.C, and filtering the supernatant with 0.22 μm filter membrane to obtain crude enzyme solution.

(3) Pure enzyme liquid

Binding solution (Binding Buffer) composition: 20mM sodium dihydrogen phosphate dihydrate, 300mM sodium chloride, solvent ultrapure water, pH adjusted to 7.0 with phosphoric acid or sodium hydroxide.

Wash (Washing Buffer) composition: 20mM sodium dihydrogen phosphate dihydrate, 300mM sodium chloride and 50mM imidazole, the solvent being ultrapure water, the pH being adjusted to 7.0 with phosphoric acid or sodium hydroxide.

Eluent (elusion Buffer) composition: 20mM sodium dihydrogen phosphate dihydrate, 300mM sodium chloride and 500mM imidazole in ultrapure water, pH adjusted to 7.0 with phosphoric acid or sodium hydroxide.

Washing the nickel column with binding solution at a flow rate of 0.4mL/min until UV baseline is balanced, and loading the crude enzyme solution at a flow rate of 0.2mL/min to fully bind the target protein and the nickel column; washing the hybrid protein with a washing solution at a flow rate of 0.3mL/min, and washing the hybrid protein until the UV baseline is balanced; eluting the target protein by eluent at the flow rate of 0.25mL/min, starting to collect when the UV reaches 200mAU, and stopping collecting when the UV is reduced to 200mAU again to obtain target protein eluent; the collected target protein eluate was dialyzed overnight (MD34, Viskase, USA) in 20mM potassium phosphate buffer solution with pH 7.0, and the retentate was the pure enzyme solution.

The preparation method of the glucose dehydrogenase gene engineering bacterium wet thallus comprises the following steps: inserting glucose dehydrogenase EsGDH gene (GenBank NO. KM817194.1, amino acid sequence is shown as SEQ ID NO.5, nucleotide sequence is shown as SEQ ID NO. 6) from Microbacterium (Exiguobacterium sibirium) DSM 17290 in NCBI database into Nco I and Xho I sites of pET28a (+), constructing recombinant expression vector, and transferring the expression vector into E.coli BL21(DE3) to obtain the productE coli BL21(DE3)/pET28b (+) -esgdh; inoculating E coli BL21(DE3)/pET28b (+) -esgdh into LB liquid culture medium with a final concentration of 50 mug/mL kanamycin, and culturing at 37 ℃ for 12h to obtain a seed solution; the seed solution was inoculated into a fresh LB liquid medium containing kanamycin to a final concentration of 50. mu.g/mL in an inoculum size of 2.0% (v/v), and cultured at 37 ℃ and 200rpm for 2 hours (OD)₆₀₀0.6), Isopropyl thiogalactoside (IPTG) was added to the culture solution to a final concentration of 0.15mM, and after 12 hours of culture at 28 ℃, the mixture was centrifuged at 8000rpm and 4 ℃ for 10 minutes to obtain wet cells containing glucose dehydrogenase.

Compared with the prior art, the invention has the following beneficial effects: compared with the traditional whole-gene epPCR strategy, the method can effectively reduce the scale of a gene mutation library, reduce the screening difficulty and time cost, and is suitable for molecular modification of most enzyme genes. The method is successfully applied to the molecular modification of carbonyl reductase KmCR from K.marxianus. The mutant obtained by transformation can be used for catalyzing and synthesizing 6-cyano- (3S,5R) -dihydroxy caproic acid tert-butyl ester, (S) -4-chloro-3-hydroxy butyric acid ethyl ester, (S) -3-hydroxy butyric acid ethyl ester, 4,4, 4-trifluoro- (S) -3-hydroxy butyric acid ethyl ester, (S) -3-hydroxy butyric acid tert-butyl ester, (S) -4-hydroxy valeric acid ethyl ester, (S) -3-hydroxy-4-methyl valeric acid methyl ester, (S) -3-hydroxy-4-methyl valeric acid ethyl ester, 4-chloro- (S) -3-hydroxy butyric acid methyl ester and 3-hydroxy caproic acid ethyl ester. Among them, the wild-type carbonyl reductase KmCR prefers Prelog rule but has only moderate stereoselectivity (de)_P66.6%, S). The activity of the KmCR mutant A100S is improved by 0.8 times compared with that of the wild type, and the KmCR mutant has strict S-configuration stereoselectivity. The catalytic activity of other aliphatic ketone compounds is improved, wherein the enzyme activity of isobutyryl ethyl acetate and butyryl ethyl acetate is higher than the level of the literature reported at present.

(IV) description of the drawings

FIG. 1, classification chart of epPCR residues for the region of example 1.

FIG. 2 is a design diagram of region epPCR in example 1.

FIG. 3 and example 2 are thin-layer chromatography screening charts, wherein tag 1 is a substrate reference, tags 2-4 are reaction solutions of different mutants, and tag 5 is a product reference; 1a represents the substrate control tert-butyl 6-cyano- (5R) -3-carbonylhexanoate, and 1b represents tert-butyl 6-cyano- (3S,5R) -dihydroxyhexanoate.

FIG. 4, EPPCR (A) and Large primer PCR (B) products of example 1, lane M is a standard DNA marker, lane 1 is a region epPCR fragment, and lane 2 is a Large primer PCR gene fragment.

FIG. 5, SDS-PAGE protein electrophoresis in example 4, wherein A is carbonyl reductase KmCR and its mutant crude enzyme protein electrophoresis, lane M is standard protein marker, lane 1 is KmCR crude enzyme supernatant, lane 2 is KmCR crude enzyme precipitate, lane 3 is mutant crude enzyme supernatant, and lane 4 is mutant crude enzyme precipitate; b is protein electrophoresis pattern of carbonyl reductase KmCR and its mutant pure enzyme solution, Lane 1 is KmCR pure enzyme solution, and Lane 2 is mutant pure enzyme solution.

FIG. 6, graph of protein standard in example 4.

FIG. 7, graph of NADPH standard in example 4.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: design of region epPCR

(1) Amplification of the region epPCR fragment (483bp)

A Protein KmCR (noted as wild type KmCR-WT, GenBank NO. AB183149.1, shown as SEQ ID NO.1 and nucleotide sequence shown as SEQ ID NO. 2) having 42% similarity with carbonyl reductase from Kluyveromyces marxianus CICC32920 was selected from a PDB Protein structure database (PDB, Protein Data Bank, abbreviated as PDB) to obtain Protein KADH (PDB ID: 5 ZEC). The wild-type carbonyl reductase KmCR-WT was homologously modeled by modeler 9.20, the substrate tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate (A6) was molecularly interfaced with the wild-type carbonyl reductase KmCR-WT using YASARA, and the substrate tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate (A6) was analyzed for distance from the surrounding amino acids by the reduced carbonyl. According to the substrate being reducedThe amino acids of the wild-type carbonyl reductase KmCR-WT were counted and classified according to the distance between carbonyl and each amino acid (fig. 1). The length of the epPCR fragment and the number of amino acids to be classified are comprehensively considered, and the length of the epPCR fragment and the number of the classified amino acids are selected

Primer design for region epPCR for amino acids within the range (FIG. 2): epPCR-F: ACACTGCGTCCCCGGTTCT, respectively; epPCR-R: GACGTATGGCACAATTCTCGTTG are provided. An error-prone PCR kit (purchased from "Ready-to-use error-prone PCR kit" of Tiannzze corporation) is adopted, E.coli BL21(DE3)/pET28a (+) -kmcr (constructed by the method of example 3) is used as a template, and epPCR-F and epPCR-R are used as primers to carry out PCR reaction. The reaction system is shown in Table 1. epPCR reaction procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30 s; annealing at 55 ℃ for 30 s; extending for 50s at 72 ℃ and circulating for 30-60 times.

After the PCR amplification was completed, the size of the PCR product was verified by agarose gel electrophoresis (A in FIG. 4). And a gel recovery kit (purchased from Axygen Biotechnology Co., Ltd. in Hangzhou) is adopted to carry out gel cutting recovery on the positive PCR product to be used as a template of a second round of large primer PCR. The gel cutting and recycling steps are as follows: cutting the gel containing the target DNA band under an ultraviolet lamp, completely absorbing the surface water by using absorbent paper, cutting into small pieces, weighing, recording the weight of the gel, and putting into a 2mL clean EP tube; adding 3 gel volumes of Buffer DE-A into an EP tube, heating in a water bath at 75 deg.C until the gel is completely melted, and the process lasts for about 8 min; adding 0.5 Buffer DE-A volume of Buffer DE-B into the EP tube, uniformly mixing, transferring into a 2mL clean EP tube containing a preparation tube, centrifuging at 12000rpm for 1min, and removing the supernatant; placing the preparation tube back into a 2mL EP tube, adding 500 μ L Buffer W1, centrifuging at 12000rpm for 1min, and removing the supernatant; placing the preparation tube back into a 2mL EP tube, adding 700 μ L Buffer W2 containing 75% ethanol by volume concentration, centrifuging at 12000rpm for 1min, discarding the supernatant, and repeating the step for 1 time again; and (3) placing the preparation tube into a new clean 1.5mL EP tube, adding preheated deionized water at 60 ℃, standing for 1min, centrifuging at 12000rpm for 1min, and abandoning the preparation tube to obtain a purified DNA fragment, namely a positive regional epPCR product.

TABLE 1 regional epPCR reaction System

(2) Large primer PCR amplification

A second round of large-primer PCR was performed using E.coli BL21(DE3)/pET28a (+) -kmcr as a template and the region epPCR positive product in step (1) as a primer, and the system is shown in Table 2.

TABLE 2 Large primers epPCR reaction System

Large primer PCR reaction program: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 55-57 ℃ for 30 s; extension for 6.5min at 72 ℃ for 30 cycles; final extension at 72 ℃ for 10 min. After the large primer PCR was completed, a bright and single band of about 6500bp was obtained as verified by agarose gel electrophoresis (B in FIG. 4).

Example 2: high throughput screening method and establishment of mutant libraries

Purifying and transforming the large primer PCR product in the embodiment 1 to obtain a regional epPCR mutation library, establishing a thin-layer chromatography screening method to perform primary screening on the mutation library, and performing secondary screening by using High Performance Liquid Chromatography (HPLC), wherein the specific steps are as follows:

(1) large primer PCR product purification and transformation

Example 1 after obtaining a large primer PCR positive electrophoresis product in step (2), digestion was performed with Dpn I enzyme to remove the original template: mu.L of Dpn I enzyme was added to 25. mu.L of the large primer PCR product and incubated at 37 ℃ for 1.5h to obtain a digested product.

The PCR product was purified using the Axygen Clean Up Kit (from Axygen Biotechnology Ltd., Hangzhou) according to the following steps: transferring the product after the PCR enzyme digestion to A 1.5mL EP tube, adding 3 times of PCR-A, and adding 100 mu L if the volume of PCR-A is less than 100 mu L; assembling A 2mL EP tube (containing A preparation tube), transferring the mixed solution of the PCR-A and the PCR product, centrifuging at 12000rpm for 1min, and removing the supernatant; eluting the preparation tube with 700 μ L Buffer W2 containing 75% ethanol by volume concentration, centrifuging at 12000rpm for 1min, and removing the supernatant; eluting the preparation tube with 400 μ L Buffer W2 containing 75% ethanol by volume concentration, centrifuging at 12000rpm for 1min, and removing the supernatant; transferring the preparation tube to a new clean 1.5mL EP tube, adding 30 μ L of preheated 60 ℃ deionized water, standing for 1min, centrifuging in the same manner, and discarding the preparation tube to obtain a purified PCR product.

Pre-prepared e.coli BL21(DE3) competent cells were taken out from a-80 ℃ refrigerator and slightly thawed on ice for about 5 min; adding 10 μ L of purified PCR product to the thawed competent cells in a clean bench, and standing on ice for 30 min; heating at 42 deg.C for 90s, immediately ice-cooling for 5 min; adding 800 mu L of sterilized LB liquid culture medium into a super clean bench, and culturing at 37 ℃ and 200rpm for 40-60 min; after completion of the culture, the cells were centrifuged at 8000rpm for 1min, and the supernatant was discarded to leave 100. mu.L of the cells in suspension and applied to a medium containing 50. mu.g/mL of cells^-1Culturing on LB plate of kanamycin (Kan) at 37 ℃ for 12-16 h to obtain single colony. Composition of LB liquid medium: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of NaCl, dissolving in distilled water, and sterilizing with steam at 121 ℃ for 20 min. The LB plate composition was supplemented with 20g/L agar based on the composition of LB liquid medium.

(2) Picking the single colony in the step (1) to a 48-deep-hole culture plate, and adding the single colony containing 50 mu g/mL^-1Kan's LB liquid medium 3mL, 37 ℃, 150rpm amplification culture for 12h, and 28 ℃, 150rpm added final concentration of 0.15mM IPTG induction for 14 h. After centrifugation at 4000rpm for 10min, the supernatant was discarded.

(3) Establishment of thin-layer chromatography preliminary screening method

In the 48-well plate of step (2), 320. mu.L of 100mM PB buffer (pH 7.5) was added to each well, followed by addition of 10g/L of tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate (final concentration: 20g/L glucose, final concentration: 5g/L glucose dehydrogenase), repeated pipetting with a pipette, mixing, reaction at 35 ℃ and 600rpm for 15min, and then 200. mu.L of the supernatant was taken from each well and extracted with 200. mu.L of ethyl acetate, followed by screening with 10. mu.L of ethyl acetate layer spot-applied TLC plate.

The developing agent adopts n-hexane and ethyl acetate (1:1, v/v), and the developer adopts alkaline potassium permanganate (1.5g KMnO)₄+10g K₂CO₃+1.25mL of 10% NaOH aqueous solution +200mL of H₂O), taking out the silica gel plate after the developing agent in the chromatographic cylinder climbs to the top end of the silica gel plate by 0.5-1 cm, clamping a suitable cotton ball by using tweezers after several seconds, dipping a dyeing agent, coating the dyeing agent on the silica gel plate, fully drying the silica gel plate by using hot air of a blower, displaying yellow spots on a light purple red background of a substrate containing a reducing group compound and a product at the moment, and identifying according to different Rf values (the moving distance of solute/the moving distance of solution) of the substrate and the product (figure 3).

(4) Establishing a high performance liquid chromatography rescreening method.

According to the result of preliminary screening in step (3), 50. mu.L of the bacterial liquid in the corresponding culture well in step (2) is taken and sent to Hangzhou Otsugaku Biotech company for sequencing (Table 3), and 50. mu.L of the bacterial liquid is taken and inoculated to 10. mu.L of the bacterial liquid containing 50. mu.g.mL^-1Kan's LB liquid medium in a test tube, at 37 degrees C were cultured for 12 hours, to obtain seed liquid. Inoculating the seed solution into fresh LB liquid medium containing Kan with a final concentration of 50 μ g/mL at an inoculation amount of 2.0% (v/v), culturing at 37 deg.C and 200rpm for 2h to OD₆₀₀When the concentration was 0.6, Isopropyl thiogalactoside (IPTG) was added to the culture medium to a final concentration of 0.15mM, and after culturing at 28 ℃ for 12 hours, the resulting mixture was centrifuged at 8000rpm and 4 ℃ for 10 minutes to obtain wet cells of each carbonyl reductase-containing mutant.

Re-screening in a 5mL reaction system: 5mL of 100mM potassium phosphate buffer solution of pH 7.0 was used as a reaction medium, and 4.5g DCW.L was added to the mixed cells^-1(the mass ratio of the wet cells containing the carbonyl reductase mutant Gene to the wet cells containing the glucose dehydrogenase Gene prepared in example 3 was 5:1, w/w), and tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate was added to the cells at a final concentration of 10 g.L^-1Glucose was added to a final concentration of 15 g.L^-1. The reaction was carried out at 35 ℃ and 600rpm for 15min, and 1mL of ethanol was added to terminate the reaction. Centrifuging at 12000rpm for 4min, filtering the supernatant with 0.22 μm organic membrane, and collecting the filtrateThe peak areas of the product, tbutyl 6-cyano- (3S,5R) -dihydroxyhexanoate (S-configuration) and tbutyl 6-cyano- (3R,5R) -dihydroxyhexanoate (R-configuration), were determined by high performance liquid chromatography, and the concentrations of the products were converted from the S-configuration product standard curve y of 170.98x-12.8 and the R-configuration product standard curve y of 181.1x + 18.04.

Wherein, C_RAnd C_SRespectively representing the molar concentration of the R-configuration product and the S-configuration product, and the unit is M.

Detection conditions of high performance liquid chromatography: the chromatographic column adopts J&K Scientific C18 reverse column (4.6mm × 150mm, 5 μm), mobile phase composed of acetonitrile and water in a volume ratio of 1:3(v/v), flow rate of 1.0mL min^-1The detection wavelength was set at 210nm, the amount of sample was 10. mu.L, the column oven was set at 40 ℃, the substrate retention time was 15.353min, and the product retention times were 9.057min (S-configuration) and 9.501min (R-configuration).

Through primary screening and secondary screening (table 3), a mutant KmCR-A100T with catalytic activity improved by 0.4 times and stereoselectivity de is obtained_p>99.5％(S)。

TABLE 3 rescreening of mutant libraries

Example 3: establishment and screening of site-directed saturation mutation library

1. Establishment of site-directed saturation mutagenesis library

Obtaining a mutant KmCR-A100T with improved stereoselectivity and catalytic activity by region epPCR, and researching the design of site-specific saturated mutation strategies on the four sites of the amino acid sequence 100, 127, 165 and 169 shown in SEQ ID NO.1 according to the theory that short-chain dehydrogenase catalyzes a quadruplet, which is the first site of the catalytic quadruplet. The relevant primer design is shown in Table 4, N represents base A, T, C, G; m represents base A, C; k represents base G, T.

TABLE 4 site-directed saturation mutagenesis primers

Site-directed saturation PCR reaction System and procedure referring to the Large primer PCR system and procedure of example 1, 1. mu.L of each of the upstream and downstream primers of site-directed saturation PCR in a 50. mu.L system was added, and the annealing temperature in the reaction procedure was determined by reference to the T of each primer_mThe value is obtained. Purification and transformation of PCR products purification and transformation of the Large primers in example 2 was referred to.

2. Establishment of coupling reaction system of carbonyl reductase and glucose

Carbonyl reductase relies on a coenzyme as a hydrogen mediator during the reaction, but the coenzyme is expensive and cannot maintain good stability, so an enzyme coupling method is adopted to construct a coenzyme circulation system. A coenzyme circulating system is constructed by using glucose dehydrogenase EsGDH and using glucose with low price as a cosubstrate.

(1) Preparation of glucose dehydrogenase EsGDH gene engineering bacteria wet thallus: 1) construction of engineering bacteria: a glucose dehydrogenase EsGDH gene (GenBank NO. KM817194.1, the amino acid sequence is shown as SEQ ID NO.5, and the nucleotide sequence is shown as SEQ ID NO. 6) from a microbacterium (Exiguobacterium sibirium) DSM 17290 in an NCBI database is inserted into Nco I and Xho I sites of pET28a (+), a recombinant expression vector is constructed, and the expression vector is transferred into E.coli BL21(DE3) to prepare E coli BL21(DE3)/pET28b (+) -EsGDH. 2) Preparation of wet cells: inoculating E coli BL21(DE3)/pET28b (+) -esgdh into LB liquid culture medium with a final concentration of 50 mug/mL kanamycin, and culturing at 37 ℃ for 12h to obtain a seed solution; the seed solution was inoculated into a fresh LB liquid medium containing kanamycin to a final concentration of 50. mu.g/mL in an inoculum size of 2.0% (v/v), and cultured at 37 ℃ and 200rpm for 2 hours (OD)₆₀₀0.6), Isopropyl thiogalactoside (IPTG) was added to the culture solution to a final concentration of 0.15mM, and after 12 hours of culture at 28 ℃, the mixture was centrifuged at 8000rpm and 4 ℃ for 10 minutes to obtain wet cells containing glucose dehydrogenase.

(2) Carbonyl reductase mutantPreparing wet thalli of genetically engineered bacteria: 1) construction of engineering bacteria: inserting the KmCR mutant gene of the carbonyl reductase obtained by site-specific saturation mutation in the step 1 into Nco I and Xho I sites of pET28a (+), constructing a recombinant expression vector, and transferring the expression vector into E.coli BL21(DE3) to prepare the carbonyl reductase mutant gene engineering strain. 2) Preparation of wet cells: inoculating carbonyl reductase mutant genetic engineering bacteria into LB liquid culture medium with final concentration of 50 mug/mL kanamycin, and culturing at 37 ℃ for 12h to obtain seed liquid; the seed solution was inoculated into a fresh LB liquid medium containing kanamycin to a final concentration of 50. mu.g/mL in an inoculum size of 2.0% (v/v), and cultured at 37 ℃ and 200rpm for 2 hours (OD)₆₀₀0.6), Isopropyl thiogalactoside (IPTG) was added to the culture solution to a final concentration of 0.15mM, and after 12 hours of culture at 28 ℃, the mixture was centrifuged at 8000rpm and 4 ℃ for 10 minutes to obtain wet cells containing the carbonyl reductase mutant.

(3) Preparing wet bacteria of wild carbonyl reductase gene engineering bacteria: 1) construction of engineering bacteria: the wild-type carbonyl reductase KmCR gene (GenBank NO. AB183149.1, nucleotide sequence shown in SEQ ID NO. 2) described in example 1 was inserted into Nco I and Xho I sites of pET28a (+), to construct a recombinant expression vector, and the expression vector was transferred into E.coli BL21(DE3), to prepare E coli BL21(DE3)/pET28b (+) -KmCR. 2) Preparation of Wet cells were prepared in the same manner as in the step (2) for carbonyl reductase-containing mutants.

(4) Establishing a coupling reaction system: 5mL of reaction system: 5mL of 100mM potassium phosphate buffer solution of pH 7.0 was used as a reaction medium, and 4.5g DCW.L was added to the mixed cells^-1(the mass ratio of the wet cells containing the carbonyl reductase mutant to the wet cells containing the glucose dehydrogenase is 5:1, w/w), and the final concentration of 6-cyano- (5R) -hydroxy-3-carbonyl hexanoic acid tert-butyl ester is 10 g.L^-1Glucose was added to a final concentration of 15 g.L^-1. The reaction was carried out at 35 ℃ and 600rpm for 15min, and 1mL of ethanol was added to terminate the reaction. After centrifugation at 12000rpm for 4min, the supernatant was filtered through a 0.22 μm organic membrane, and the filtrate was examined by the HPLC examination conditions described in example 2, the results of which are shown in Table 5. Under the same condition, carbonyl reductase gene engineering bacteria wet bacteria are used for replacing carbonyl reductase mutant gene engineering bacteria wet bacteriaAs a control.

3. Screening of site-directed saturation mutagenesis libraries

Table 5 shows that the site-directed saturation mutation is carried out on four sites of the catalytic quadruplet, the A100 site has a good mutation effect, and besides the KmCR-A100T which is completely S-selective and has improved catalytic activity, the KmCR-A100S (the amino acid sequence is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO.4) which is completely S-selective is also obtained, and the activity is improved by 0.8 times compared with that of wild type KmCR-WT, so that the mutant with the highest activity is obtained.

From the result of saturation mutation at the A100 site, the activity of nonpolar alanine is highest after the nonpolar alanine is mutated into polar uncharged serine, the stereoselectivity meets the requirement of optical purity, and besides serine, the activities of polar uncharged threonine (T) and cysteine (C) are higher than that of wild type KmCR-WT. It follows that the 100 sites favor the polar uncharged type of amino acids. Analyzing the electrostatic potential of the surface of the enzyme, and selecting amino acid near 100 sites

And comparing, screening 17 amino acids in total, and marking the amino acids with large electrostatic potential energy change before and after mutation. Defining the electrostatic potential energy to be dark red in an interval of-500 to-375 kJ/mol, light red in an interval of-375 to-250 kJ/mol, light blue in an interval of-250 to-125 kJ/mol and light blue in an interval of-125 to 0 kJ/mol. In addition to the large change of the mutation site 100 located in the alpha 1 helix, a82 on the Loop a adjacent to the alpha 1 helix and S168 and K169 on the alpha 2 helix are also greatly changed, and the K169 forms hydrogen bonds with the coenzyme in the catalytic mechanism and plays a role in stabilizing the coenzyme. The mutation makes the electrostatic potential of the K169 surface larger, thereby better stabilizing the coenzyme and further enhancing the catalytic activity of the enzyme to the substrate.

TABLE 5 modification of catalytically active sites

Note: a denotes the remaining undetected viable mutants at S127 site, A, C, D, E, F, G, H, I, K, M, N, P, Q, R, V, W, Y; b represents the remaining undetected viable mutants at the K169 site, C, D, E, F, G, I, L, M, N, P, Q, R, S, T, V, W; c indicates that no viable mutants were detected in the portion of the Y165 site, C, F, G, H, I, N, P, R, S, W.

Example 4: determination of enzyme activity of carbonyl reductase and mutant thereof

1. Preparation of wild carbonyl reductase KmCR-WT and mutant KmCR-A100S pure enzyme solution thereof

(1) Wet thallus

Carbonyl reductase mutant KmCR-A100S gene engineering bacteria were constructed by the method of example 3, and carbonyl reductase mutant KmCR-A100S gene engineering bacteria were used to obtain wet cells containing carbonyl reductase mutant KmCR-A100S as described in example 3.

(2) Crude enzyme solution

The wet cells were resuspended in 100mM PB buffer solution at a concentration of 20g/L, and then sonicated on ice for 10 min. Ultrasonic crushing conditions: the power was set at 400W, crushing for 1s, and pause for 5 s. And centrifuged at 12000rpm for 15min at 4 ℃ and the supernatant was filtered through a 0.22 μm filter to obtain a crude enzyme solution (A in FIG. 5).

(3) Pure enzyme liquid

Binding solution (Binding Buffer): 3.1g of sodium dihydrogen phosphate dihydrate (final concentration: 20mM) and 17.5g of sodium chloride (final concentration: 300mM) were weighed out in a 1L beaker, sufficiently dissolved by adding ultrapure water and made a volume of 1L, and the pH was adjusted to 7.0 with phosphoric acid or sodium hydroxide.

Washing solution (Washing Buffer): 3.1g of sodium dihydrogen phosphate dihydrate (final concentration: 20mM), 17.5g of sodium chloride (final concentration: 300mM) and 3.4g of imidazole (final concentration: 50mM) were weighed out in a 1L beaker, and sufficiently dissolved by adding ultrapure water and made a volume of 1L, and the pH was adjusted to 7.0 in the same manner.

Eluent (elusion Buffer): 3.1g of sodium dihydrogenphosphate dihydrate (final concentration: 20mM), 17.5g of sodium chloride (final concentration: 300mM) and 34.0g of imidazole (final concentration: 500mM) were weighed out in a 1L beaker, and sufficiently dissolved by adding ultrapure water and made a volume of 1L, and the pH was adjusted to 7.0 in the same manner.

The pure enzyme is obtained as follows:

the nickel column (1.6X 10cm, Bio-Rad, USA) was washed with binding solution at a flow rate of 0.4mL/min until the UV baseline equilibrated; after the base line is leveled by the binding solution, 10mL of the crude enzyme solution obtained in the step (2) is loaded at the flow rate of 0.2mL/min, so that the target protein is fully bound with the nickel column; washing the hybrid protein with a washing solution at a flow rate of 0.3mL/min, and washing the hybrid protein until the UV baseline is balanced; eluting the target protein by eluent at the flow rate of 0.25mL/min, starting to collect when the UV reaches 200mAU, and stopping collecting when the UV is reduced to 200mAU again to obtain target protein eluent; continuously washing with the eluent, and adjusting the flow rate to 0.3mL/min until the base line is leveled; changing the eluent into a binding solution to continuously wash the balanced nickel column, and adjusting the flow rate to be 0.35mL/min until the base line is leveled; the nickel column was stored with 10 column volumes of 20% ethanol aqueous solution at volume concentration and stored in a refrigerator at 4 ℃. The collected target protein eluate was dialyzed overnight (MD34, Viskase, USA) in 20mM potassium phosphate buffer pH 7.0, and the retentate was the pure enzyme solution of carbonyl reductase mutant KmCR-A100S (FIG. 5, B).

Under the same conditions, a wild-type carbonyl reductase KmCR-WT pure enzyme solution is prepared.

2. The BCA kit is adopted to determine the protein concentration of the pure enzyme solution, and the specific implementation steps are as follows:

TABLE 6 protein Standard solution preparation

(1) Preparing a working solution: working solution A and working solution B in a BCA Kit (KGPBCA) are prepared according to the proportion of 50:1(v/v), and are fully mixed to be used as working solutions. (2) Adding the protein standard solution and deionized water into a clean enzyme label plate, adding 200 mu L of working solution into the enzyme label plate, oscillating the plate on an oscillator for 30s, preserving the temperature at 37 ℃ for 30min, measuring the absorbance at 562nm, and drawing a standard curve (figure 6) with the ordinate being the protein ultraviolet absorbance value and the abscissa being the corresponding protein content. (3) Diluting the sample by 20 times with deionized water, sampling 20 mu L, adding into an enzyme label plate, simultaneously adding 200 mu L of working solution, measuring the absorbance in the same way, bringing the measured absorbance into a standard curve, and calculating to obtain the protein concentration of the wild type carbonyl reductase KmCR-WT pure enzyme solution of 5.3g/L and the protein concentration of the carbonyl reductase mutant KmCR-A100S pure enzyme solution of 4.9 g/L.

3. Enzyme activity detection conditions: 300 μ L reaction: 10mM substrate (substrate 1a in Table 11, i.e., t-butyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate), 1mM NADPH, 100. mu.L of purified enzyme solution (KmCR-WT purified enzyme solution and KmCR-A100S purified enzyme solution prepared in step 1), reacted at 35 ℃ and 600rpm for 5min, and then the reaction solution was taken to measure the absorbance at 340nm, and the NADPH content in the reaction solution was obtained from the NADPH standard curve (FIG. 7).

Enzyme activity is defined as the amount of enzyme required to consume 1. mu. mol of NADPH per minute under standard conditions, and is defined as one enzyme activity unit U. The specific enzyme activity is defined as the number of units of enzyme activity per mg of protein, and is recorded as U.mg^-1。

Relative enzyme activity: under the same conditions, the activity of the wild carbonyl reductase KmCR-WT pure enzyme solution to a substrate is set as 100%, and the mutant enzyme is relatively active relative to the wild enzyme. The catalytic activity of the wild carbonyl reductase KmCR-WT on the substrate of the tert-butyl 6-cyano- (5R) -hydroxy-3-carbonyl hexanoate can reach 36.8U/mg, and the catalytic activity of the carbonyl reductase mutant KmCR-A100S on the substrate of the tert-butyl 6-cyano- (5R) -hydroxy-3-carbonyl hexanoate can reach 66.5U/mg. The results are shown in Table 11.

Example 5: determination of kinetic parameters of carbonyl reductase and its mutants

And (3) detecting kinetic parameters of the wild carbonyl reductase KmCR-WT and the mutant KmCR-A100S thereof.

1. Kinetic parameters of KmCR-WT and its mutant KmCR-A100S on substrate A6

A conversion reaction system (0.5 mL) was prepared by adding NADPH to a final concentration of 5mM and 100. mu.L of the purified enzyme solution prepared in example 4 (the wild-type carbonyl reductase KmCR-WT purified enzyme solution and the carbonyl reductase mutant KmCR-A100S purified enzyme solution) to each of tbutyl 6-cyano- (5R) -3-carbonylhexanoate (0.5mM, 1mM, 2mM, 4mM, 6mM, 10mM) at different concentrations as a substrate in A1 mL centrifuge tube, reacting at 35 ℃ and 600rpm for 10min, terminating the reaction by adding 1 to 2. mu.L of 6M HCl, and detecting the amount by high performance liquid chromatography as described in example 2.

The Michaelis-Menten function nonlinear curve is fitted by using Origin 9.1 to obtain the meter constant K_mAnd the maximum reaction rate v_max. The results are shown in Table 7.

TABLE 7 kinetic parameters of wild-type carbonyl reductase KmCR-WT and its mutant KmCR-A100S on substrate

2. Kinetics parameters of KmCR-WT and its mutant KmCR-A100S to NADPH

In the same manner as in step 1, reactions were carried out under the same conditions using NADPH (0.1mM, 1mM, 2mM, 3mM, 4mM, 5mM) at different concentrations, respectively, and the substrate concentration was 5 mM. The rest is the same as step 1, and the results are shown in Table 8.

TABLE 8 kinetics of NADPH by carbonyl reductase KmCR-WT and its mutant KmCR-A100S

As is clear from tables 7 and 8, the K of the mutant against substrate A6 and NADPH_mThe values are 0.54mM and 0.14mM, respectively, and are reduced compared with 0.62mM and 0.19mM of the wild type, which shows that the affinity of the wild type for the substrate is improved, and the catalytic efficiency k is caused_cat/K_mAnd is increased.

Example 6: characterization of thermal stability of wild-type carbonyl reductase KmCR-WT and mutant KmCR-A100S thereof

Thermal stability of wild-type carbonyl reductase KmCR-WT and mutant KmCR-A100S mainly by melting temperatureT_mSemi-inactivation temperature

Half life t_1/2To investigate it.

1. Melting temperature T_m

500. mu.L of the pure enzyme solution prepared in example 4 was diluted with 20mM potassium phosphate at pH 7.0 to a final concentration (0.15 mg. multidot.mL)^-1) As a sample. Putting a sample in a10 mm quartz tube, and performing circular dichroism analysis on the enzyme by using a Circular Dichroism (CD) spectrometer, wherein the temperature change is controlled to be 10-90 ℃, and the ultraviolet spectrum setting range is 180-260 nm. According to the formula α ═ θ_t-θ_U)/(θ_F-θ_U) Calculating the circular dichroism value alpha at the wavelength of 222nm and obtaining T by utilizing Origin 9.1 nonlinear curve fitting_m. Wherein, theta_tCorresponding to ellipticity at any temperature, theta_FEllipticity, theta, corresponding to fully folded form_UCorresponding to the ellipticity of the unfolded form.

2. Semi-inactivation temperature

Detecting the semi-inactivation temperature of wild carbonyl reductase KmCR-WT and mutant KmCR-A100S thereof

mu.L of the pure enzyme solution prepared in example 4 was incubated at 20 ℃, 35 ℃, 39 ℃, 43 ℃, 47 ℃, 51 ℃, 55 ℃ and 59 ℃ for 15min and immediately placed on ice. Reacting at 35 ℃ and 600rpm for 10min, adding 1-2 mu L of 6M HCl to terminate the reaction, and determining the residual enzyme activity according to the detection conditions of the high performance liquid chromatography in the embodiment 2. The enzyme activity preserved at the optimal temperature is recorded as the initial enzyme activity of 100 percent. Obtained by utilizing Origin 9.1 nonlinear curve fitting

3. Half life t_1/2

Detection of wild-type carbonyl reductionHalf-life t of original enzyme KmCR-WT and mutant KmCR-A100S thereof_1/21mL of the pure enzyme solution prepared in example 4 was incubated at 35 ℃, 40 ℃ and 45 ℃ for 3 hours, and a part of the enzyme sample was taken out at intervals. Reacting at 35 ℃ and 600rpm for 10min, adding 1-2 microliter of HCl (6M) to terminate the reaction, and detecting and analyzing by HPLC (high performance liquid chromatography) described in example 2 to determine the residual enzyme activity. The Boltzmann function nonlinear curve was fitted using Origin 9.1. t is t_1/2Defined as the time required for the residual activity of the enzyme to drop to 50% of the original activity.

TABLE 9 half-inactivation constant and melting temperature of wild-type carbonyl reductase KmCR-WT and its mutant KmCR-A100S

TABLE 10 half-lives and inactivation constants of wild-type carbonyl reductases and their mutant A100S

From tables 9 and 10, the semi-inactivation temperatures of the wild type and the mutant were 55.4 ℃ and 53.8 ℃ respectively; the melting temperatures were 59.9 ℃ and 58.4 ℃ respectively. The half-lives of the wild type and mutant were 19.6h and 18.2h, respectively, at 35 ℃ and decreased to less than half of those at 35 ℃ as the temperature was increased to 45 ℃. The thermostability of the mutants was only slightly reduced compared to the wild type.

Example 7: wild carbonyl reductase and mutant KmCR-A100S catalytic reduction 4-chloroacetoacetic acid ethyl ester thereof

To 300. mu.L of 100mM potassium phosphate buffer solution at pH 7.0, 100. mu.L of NADPH was added to make a reaction system, the final concentration of which was 1mM, and the final concentration of which was 10mM, substrate ethyl 4-chloroacetoacetate (2 a in Table 11), and 100. mu.L of the pure enzyme solution of the carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared by the method of example 4 was added to make a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, a sample is taken and is detected by an enzyme-linked immunosorbent assay at 340nm, and the catalytic activity of the carbonyl reductase mutant on the 4-chloroacetoacetic acid ethyl ester is calculated by the same method as the example 4. Under the same conditions, the catalytic activity of the wild-type carbonyl reductase KmCR-WT (protein concentration of 5.3g/L) prepared in example 4 was examined. The catalytic activity of wild carbonyl reductase KmCR-WT on a substrate of ethyl 4-chloroacetoacetate can reach 6.2U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on the substrate of ethyl 4-chloroacetoacetate can reach 18.5U/mg, and the results are shown in Table 11.

Example 8: wild carbonyl reductase and its mutant for catalyzing reduction of ethyl acetoacetate

mu.L of NADPH (final concentration: 1 mM), ethyl acetoacetate (final concentration: 10mM) (3 a in Table 11), and 100. mu.L of a pure enzyme solution of the carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared in example 4 were added to 300. mu.L of 100mM potassium phosphate buffer (pH 7.0) to prepare a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, samples are taken and detected by an enzyme-linked immunosorbent assay at 340nm, and the catalytic activity of the carbonyl reductase mutant to the ethyl acetoacetate is calculated by the same method as the example 4. Under the same conditions, the catalytic activity of the wild-type carbonyl reductase KmCR-WT (protein concentration of 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on substrate ethyl acetoacetate can reach 29.5U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on substrate ethyl acetoacetate can reach 35.1U/mg. The results are shown in Table 11.

Example 9: wild carbonyl reductase and its mutant for catalyzing and reducing 4,4, 4-trifluoro-ethyl acetoacetate

To 300. mu.L of 100mM potassium phosphate buffer solution at pH 7.0, 100mM was added NADPH at a final concentration of 1mM, and

ethyl

4,4, 4-trifluoroacetoacetate at a final concentration of 10mM (4 a in Table 11), and 100. mu.L of a pure enzyme solution of the carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared by the method of example 4 was added to constitute a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, a sample is taken and is detected by an enzyme-linked immunosorbent assay at 340nm, and the catalytic activity of the carbonyl reductase mutant on the 4,4, 4-trifluoroacetoacetate ethyl ester is calculated by the same method as the example 4. Under the same conditions, the catalytic activity of the wild-type carbonyl reductase KmCR-WT (protein concentration of 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on 4,4, 4-ethyl trifluoroacetoacetate can reach 23.1U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on 4,4, 4-ethyl trifluoroacetoacetate can reach 28.4U/mg. The results are shown in Table 11.

Example 10: carbonyl reductase and mutant thereof for catalyzing and reducing acetoacetic acid tert-butyl ester

mu.L of NADPH (final concentration: 1 mM), substrate t-butyl acetoacetate (final concentration: 10mM) (5 a in Table 11), and 100. mu.L of a pure enzyme solution of carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared in example 4 were added to 300. mu.L of 100mM potassium phosphate buffer (pH 7.0) to prepare a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, samples are taken and detected by a microplate reader at 340nm for light absorption, and the catalytic activity of the carbonyl reductase mutant on the tert-butyl acetoacetate is calculated by the same method as that described in example 4. Under the same conditions, the catalytic activity of the carbonyl reductase KmCR-WT (protein concentration 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on the substrate of the t-butyl acetoacetate can reach 9.2U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on the substrate of the t-butyl acetoacetate can reach 12.7U/mg. The results are shown in Table 11.

Example 11: wild carbonyl reductase and mutant thereof for catalyzing and reducing ethyl levulinate

mu.L of NADPH (final concentration: 1 mM), a substrate ethyl levulinate (6 a in Table 11) at a final concentration: 10mM, and 100. mu.L of a pure enzyme solution of the carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared by the method of example 4 were added to 300. mu.L of 100mM potassium phosphate buffer solution at pH 7.0 to constitute a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, samples are taken and detected by an enzyme-linked immunosorbent assay at 340nm, and the catalytic activity of the carbonyl reductase mutant to the ethyl levulinate is calculated by the same method as the method in example 4. Under the same conditions, the catalytic activity of the carbonyl reductase KmCR-WT (protein concentration 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on the substrate ethyl levulinate can reach 6.6U/mg, and the catalytic activity of mutant KmCR-A100S on the substrate ethyl levulinate can reach 11.1U/mg. The results are shown in Table 11.

Example 12: wild carbonyl reductase and mutant thereof for catalytic reduction of methyl isobutyrylacetate

mu.L of NADPH (final concentration: 1 mM), the substrate methyl butyrylacetate (7 a in Table 11) at final concentration: 10mM, and 100. mu.L of the pure enzyme solution of carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared in example 4 were added to 300. mu.L of 100mM potassium phosphate buffer solution at pH 7.0 to constitute a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, samples are taken and detected by an enzyme-linked immunosorbent assay at 340nm, and the catalytic activity of the carbonyl reductase mutant on the methyl butyrylacetate is calculated according to the method described in the example 4. Under the same conditions, the catalytic activity of the wild-type carbonyl reductase KmCR-WT (protein concentration of 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on a substrate methyl isobutyryl acetate can reach 152.6U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on a substrate methyl isobutyryl acetate can reach 153.1U/mg. This is the highest level of catalysis of the substrate by the current literature-reported bio-enzymatic method, and the results are shown in Table 11.

Example 13: wild carbonyl reductase and isobutyrylacetic acid ethyl ester catalytic reduction of mutant thereof

mu.L of NADPH (final concentration: 1 mM), and ethyl isobutyrylacetate (final concentration: 10mM) (8 a in Table 11) as a substrate were added to 100mM potassium phosphate buffer solution (pH 7.0, final concentration: 100 mM), and 100. mu.L of the pure enzyme solution of carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared in example 4 was added to the resulting mixture to prepare a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, a sample is taken, an absorbance value is detected by a microplate reader at 340nm, and the catalytic activity of the carbonyl reductase mutant on the ethyl isobutyrylacetate is calculated by the same method as the method in the example 4. Under the same conditions, the catalytic activity of the carbonyl reductase KmCR-WT (protein concentration 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on a substrate ethyl isobutyryl acetate can reach 3.2U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on a substrate ethyl isobutyryl acetate can reach 6.2U/mg. The results are shown in Table 11.

Example 14: wild carbonyl reductase and its mutant for catalytic reduction of 4-chloro-methyl acetoacetate

To 300. mu.L of 100mM potassium phosphate buffer solution at pH 7.0, 100. mu.L of NADPH was added to make a reaction system, the final concentration of which was 1mM, and the final concentration of which was 10mM, of methyl 4-chloro-acetoacetate (9 a in Table 11), and 100. mu.L of a pure enzyme solution of the carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared by the method of example 4 was added to make a reaction system. The reaction is carried out for 5min at 35 ℃ and 600rpm, samples are taken and detected by a microplate reader at 340nm, and the catalytic activity of the carbonyl reductase mutant on the 4-chloro-methyl acetoacetate is calculated by the same method as the example 4. Under the same conditions, the catalytic activity of the wild-type carbonyl reductase KmCR-WT (protein concentration of 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on a substrate of 4-chloroacetoacetic acid methyl ester can reach 37.6U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on the substrate of 4-chloroacetoacetic acid methyl ester can reach 40.7U/mg. The results are shown in Table 11.

Example 15: wild carbonyl reductase and mutant thereof for catalytic reduction of ethyl butyrylacetate

mu.L of NADPH (final concentration: 1 mM), the substrate ethyl butyrylacetate (10 a in Table 11) at final concentration: 10mM, and 100. mu.L of the pure enzyme solution of carbonyl reductase mutant KmCR-A100S (protein concentration: 4.9g/L) prepared in example 4 were added to 300. mu.L of 100mM potassium phosphate buffer solution at pH 7.0 to constitute a reaction system. Reacting at 35 ℃ and 600rpm for 5min, sampling, detecting the light absorption value at 340nm by using an enzyme-labeling instrument, and calculating the catalytic activity of the carbonyl reductase mutant on the butyryl ethyl acetate by the same method as the method in example 4. Under the same conditions, the catalytic activity of the wild-type carbonyl reductase KmCR-WT (protein concentration of 5.3g/L) prepared in example 4 was examined.

Under the condition, the catalytic activity of wild carbonyl reductase KmCR-WT on a substrate of ethyl butyroacetate can reach 39.4U/mg, and the catalytic activity of carbonyl reductase mutant KmCR-A100S on the substrate of ethyl butyroacetate can reach 55.5U/mg. This is the highest enzyme activity of the substrate catalyzed by the bio-enzyme method reported in the literature at present, and the results are shown in Table 11.

TABLE 11 Activity of wild-type carbonyl reductases and their mutant A100S on different substrates

Sequence listing

<110> Zhejiang industrial university

<120> carbonyl reductase mutant and application thereof in asymmetric synthesis of bi-chiral compound

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 345

<212> PRT

<213> Kluyveromyces marxianus (Kluyveromyces. marxianus)

<400> 1

Met Thr Phe Thr Val Val Thr Gly Ala Asn Gly Tyr Ile Ala Lys His

1 5 10 15

Ile Leu Lys Ser Leu Leu Glu Asp Gly His Arg Val Ile Gly Thr Val

20 25 30

Arg Asn Ser Lys Lys Ala Glu Glu Leu Lys Arg Thr Val Asn Asp Glu

35 40 45

Asn Leu Ile Val Glu Leu Val Pro Asp Met Leu Val Glu Asn Ala Phe

50 55 60

Asp Glu Leu Phe Lys Lys Tyr Asn Thr Gln Ile Lys Tyr Val Phe His

65 70 75 80

Thr Ala Ser Pro Val Leu Glu Thr Ser Lys Asp Tyr Glu Lys Ser Leu

85 90 95

Ile Glu Pro Ala Ile Thr Gly Ala Lys Ser Met Val Glu Ala Ile Arg

100 105 110

Lys Tyr Ser Leu Thr Ser Val Glu His Ile Val Tyr Thr Ser Ser Ile

115 120 125

Ala Ala Ser Ser Leu Glu Ser Glu Phe Thr Asp Pro Thr Leu Val Val

130 135 140

Ser Glu Asp Ser Trp Asn Pro Gln Gly Leu Glu Glu Ala Lys Thr Glu

145 150 155 160

Phe Phe Thr Ala Tyr Ser Tyr Ser Lys Lys Ile Ala Glu Lys Thr Met

165 170 175

Trp Asp Phe Val Glu Glu Tyr Lys Gly Thr Glu His Glu Ile Lys Leu

180 185 190

Thr Thr Val Asn Pro Cys Phe Asn Ile Gly Pro Gln Ala Tyr Glu Ala

195 200 205

Asp Val Thr Glu Thr Met Asn Phe Thr Ala Glu Leu Ile Asn His Val

210 215 220

Val Lys Ser Lys Val Gly Asp Pro Leu Pro Pro Thr Arg Ile Val Pro

225 230 235 240

Tyr Val Asp Val Arg Asp Thr Ala Arg Ala His Val Asp Ala Leu Lys

245 250 255

Asn Glu Lys Leu Ala Phe Gln Arg Leu Leu Val Val Gly Pro Phe Leu

260 265 270

Ser Ser Gln Gln Ile Tyr Asp Ile Val Asn Glu Arg Phe Pro Gln Leu

275 280 285

Arg Gly Lys Ile Ala Arg Gly Glu Pro Gly Ser Asp Lys Leu Asp Pro

290 295 300

Ala Lys Leu Ala Lys Phe Asp His Ala Arg Thr Thr Gln Ala Leu Gly

305 310 315 320

Trp Glu Phe Thr Pro Ile Glu Lys Ala Ile Ala Asp Glu Val Ala Gln

325 330 335

Ile Leu Arg Val Gly Ala Tyr Arg Gly

340 345

<210> 2

<211> 1038

<212> DNA

<213> Kluyveromyces marxianus (Kluyveromyces. marxianus)

<400> 2

atgacattta cagtggtgac aggcgcaaat ggctacattg ccaagcacat tcttaaatcg 60

ttattagaag atggtcatcg cgtaattggg accgtgagaa acagcaagaa ggccgaggaa 120

ttgaaaagga ctgtcaatga tgagaatttg atagtggagt tggttcccga catgttagtg 180

gaaaacgcat ttgacgagtt gttcaagaag tacaacaccc aaatcaagta tgtgttccac 240

actgcgtccc cggttctcga gacgtcaaag gactatgaga aaagcttgat cgagcccgcg 300

attaccggtg cgaagtcaat ggtggaagct atcaggaagt actcattgac atcggtcgag 360

cacattgtgt atacgtcatc gattgctgcc agctcgctgg aatctgagtt taccgatcca 420

acgctcgttg tcagcgagga tagttggaac ccacaaggtt tggaagaggc aaagacggag 480

tttttcaccg cttactcgta ctcgaagaaa atcgccgaga agacgatgtg ggattttgtt 540

gaggaataca aggggactga gcacgaaata aagctcacta cggtcaaccc atgcttcaac 600

attgggcccc aggcgtacga ggcggacgtt accgagacta tgaacttcac ggcggagttg 660

atcaaccacg ttgtgaaaag caaagtgggc gatccgcttc ctccaacgag aattgtgcca 720

tacgtcgatg tcagggacac tgcgagagcg catgtcgatg cgttgaagaa cgagaagctg 780

gcattccaaa gactgttggt ggtggggccc tttttgtcga gccagcagat ctacgatatt 840

gtgaacgagc gcttcccgca attgcggggc aagatcgcgc ggggcgagcc tggcagcgac 900

aagctggacc ctgcgaagct ggccaagttc gaccacgccc ggaccacgca agctctcggg 960

tgggagttca cgcctatcga gaaggctata gctgacgagg tggcccagat cctccgtgtg 1020

ggcgcgtacc gtgggtaa 1038

<210> 3

<211> 345

<212> PRT

<213> Kluyveromyces marxianus (Kluyveromyces. marxianus)

<400> 3

Met Thr Phe Thr Val Val Thr Gly Ala Asn Gly Tyr Ile Ala Lys His

1 5 10 15

Ile Leu Lys Ser Leu Leu Glu Asp Gly His Arg Val Ile Gly Thr Val

20 25 30

Arg Asn Ser Lys Lys Ala Glu Glu Leu Lys Arg Thr Val Asn Asp Glu

35 40 45

Asn Leu Ile Val Glu Leu Val Pro Asp Met Leu Val Glu Asn Ala Phe

50 55 60

Asp Glu Leu Phe Lys Lys Tyr Asn Thr Gln Ile Lys Tyr Val Phe His

65 70 75 80

Thr Ala Ser Pro Val Leu Glu Thr Ser Lys Asp Tyr Glu Lys Ser Leu

85 90 95

Ile Glu Pro Ser Ile Thr Gly Ala Lys Ser Met Val Glu Ala Ile Arg

100 105 110

Lys Tyr Ser Leu Thr Ser Val Glu His Ile Val Tyr Thr Ser Ser Ile

115 120 125

Ala Ala Ser Ser Leu Glu Ser Glu Phe Thr Asp Pro Thr Leu Val Val

130 135 140

Ser Glu Asp Ser Trp Asn Pro Gln Gly Leu Glu Glu Ala Lys Thr Glu

145 150 155 160

Phe Phe Thr Ala Tyr Ser Tyr Ser Lys Lys Ile Ala Glu Lys Thr Met

165 170 175

Trp Asp Phe Val Glu Glu Tyr Lys Gly Thr Glu His Glu Ile Lys Leu

180 185 190

Thr Thr Val Asn Pro Cys Phe Asn Ile Gly Pro Gln Ala Tyr Glu Ala

195 200 205

Asp Val Thr Glu Thr Met Asn Phe Thr Ala Glu Leu Ile Asn His Val

210 215 220

Val Lys Ser Lys Val Gly Asp Pro Leu Pro Pro Thr Arg Ile Val Pro

225 230 235 240

Tyr Val Asp Val Arg Asp Thr Ala Arg Ala His Val Asp Ala Leu Lys

245 250 255

Asn Glu Lys Leu Ala Phe Gln Arg Leu Leu Val Val Gly Pro Phe Leu

260 265 270

Ser Ser Gln Gln Ile Tyr Asp Ile Val Asn Glu Arg Phe Pro Gln Leu

275 280 285

Arg Gly Lys Ile Ala Arg Gly Glu Pro Gly Ser Asp Lys Leu Asp Pro

290 295 300

Ala Lys Leu Ala Lys Phe Asp His Ala Arg Thr Thr Gln Ala Leu Gly

305 310 315 320

Trp Glu Phe Thr Pro Ile Glu Lys Ala Ile Ala Asp Glu Val Ala Gln

325 330 335

Ile Leu Arg Val Gly Ala Tyr Arg Gly

340 345

<210> 4

<211> 1038

<212> DNA

<213> Kluyveromyces marxianus (Kluyveromyces. marxianus)

<400> 4

atgacattta cagtggtgac aggcgcaaat ggctacattg ccaagcacat tcttaaatcg 60

ttattagaag atggtcatcg cgtaattggg accgtgagaa acagcaagaa ggccgaggaa 120

ttgaaaagga ctgtcaatga tgagaatttg atagtggagt tggttcccga catgttagtg 180

gaaaacgcat ttgacgagtt gttcaagaag tacaacaccc aaatcaagta tgtgttccac 240

actgcgtccc cggttctcga gacgtcaaag gactatgaga aaagcttgat cgagcccagt 300

attaccggtg cgaagtcaat ggtggaagct atcaggaagt actcattgac atcggtcgag 360

cacattgtgt atacgtcatc gattgctgcc agctcgctgg aatctgagtt taccgatcca 420

acgctcgttg tcagcgagga tagttggaac ccacaaggtt tggaagaggc aaagacggag 480

tttttcaccg cttactcgta ctcgaagaaa atcgccgaga agacgatgtg ggattttgtt 540

gaggaataca aggggactga gcacgaaata aagctcacta cggtcaaccc atgcttcaac 600

attgggcccc aggcgtacga ggcggacgtt accgagacta tgaacttcac ggcggagttg 660

atcaaccacg ttgtgaaaag caaagtgggc gatccgcttc ctccaacgag aattgtgcca 720

tacgtcgatg tcagggacac tgcgagagcg catgtcgatg cgttgaagaa cgagaagctg 780

gcattccaaa gactgttggt ggtggggccc tttttgtcga gccagcagat ctacgatatt 840

gtgaacgagc gcttcccgca attgcggggc aagatcgcgc ggggcgagcc tggcagcgac 900

aagctggacc ctgcgaagct ggccaagttc gaccacgccc ggaccacgca agctctcggg 960

tgggagttca cgcctatcga gaaggctata gctgacgagg tggcccagat cctccgtgtg 1020

ggcgcgtacc gtgggtaa 1038

<210> 5

<211> 262

<212> PRT

<213> Microbacterium (Exiguobacterium sibirium)

<400> 5

Met Gly Tyr Asn Ser Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly

1 5 10 15

Ser Met Gly Ile Gly Glu Ala Ile Ile Arg Arg Tyr Ala Glu Glu Gly

20 25 30

Met Arg Val Val Ile Asn Tyr Arg Ser His Pro Glu Glu Ala Lys Lys

35 40 45

Ile Ala Glu Asp Ile Lys Gln Ala Gly Gly Glu Ala Leu Thr Val Gln

50 55 60

Gly Asp Val Ser Lys Glu Glu Asp Met Ile Asn Leu Val Lys Gln Thr

65 70 75 80

Val Asp His Phe Gly Gln Leu Asp Val Phe Val Asn Asn Ala Gly Val

85 90 95

Glu Met Pro Ser Pro Ser His Glu Met Ser Leu Glu Asp Trp Gln Lys

100 105 110

Val Ile Asp Val Asn Leu Thr Gly Ala Phe Leu Gly Ala Arg Glu Ala

115 120 125

Leu Lys Tyr Phe Val Glu His Asn Val Lys Gly Asn Ile Ile Asn Met

130 135 140

Ser Ser Val His Glu Ile Ile Pro Trp Pro Thr Phe Val His Tyr Ala

145 150 155 160

Ala Ser Lys Gly Gly Val Lys Leu Met Thr Gln Thr Leu Ala Met Glu

165 170 175

Tyr Ala Pro Lys Gly Ile Arg Ile Asn Ala Ile Gly Pro Gly Ala Ile

180 185 190

Asn Thr Pro Ile Asn Ala Glu Lys Phe Glu Asp Pro Lys Gln Arg Ala

195 200 205

Asp Val Glu Ser Met Ile Pro Met Gly Asn Ile Gly Lys Pro Glu Glu

210 215 220

Ile Ser Ala Val Ala Ala Trp Leu Ala Ser Asp Glu Ala Ser Tyr Val

225 230 235 240

Thr Gly Ile Thr Leu Phe Ala Asp Gly Gly Met Thr Leu Tyr Pro Ser

245 250 255

Phe Gln Ala Gly Arg Gly

260

<210> 6

<211> 789

<212> DNA

<213> Microbacterium (Exiguobacterium sibirium)

<400> 6

atgggttata attctctgaa aggcaaagtc gcgattgtta ctggtggtag catgggcatt 60

ggcgaagcga tcatccgtcg ctatgcagaa gaaggcatgc gcgttgttat caactatcgt 120

agccatccgg aggaagccaa aaagatcgcc gaagatatta aacaggcagg tggtgaagcc 180

ctgaccgtcc agggtgacgt ttctaaagag gaagacatga tcaacctggt gaaacagact 240

gttgatcact tcggtcagct ggacgtcttt gtgaacaacg ctggcgttga gatgccttct 300

ccgtcccacg aaatgtccct ggaagactgg cagaaagtga tcgatgttaa tctgacgggt 360

gcgttcctgg gcgctcgtga agctctgaaa tacttcgttg aacataacgt gaaaggcaac 420

attatcaata tgtctagcgt ccacgaaatc atcccgtggc ctactttcgt acattacgct 480

gcttctaagg gtggcgttaa actgatgacc cagactctgg ctatggaata tgcaccgaaa 540

ggtatccgca ttaacgctat cggtccaggc gcgatcaaca ctccaattaa tgcagaaaaa 600

ttcgaggatc cgaaacagcg tgcagacgtg gaaagcatga tcccgatggg caacatcggc 660

aagccagagg agatttccgc tgtcgcggca tggctggctt ctgacgaagc gtcttacgtt 720

accggcatca ccctgttcgc agatggtggc atgaccctgt acccgagctt tcaggctggc 780

cgtggttga 789

Claims

1. A carbonyl reductase mutant, characterized in that the mutant is obtained by single mutation at position 100 of the amino acid sequence of wild-type carbonyl reductase shown in SEQ ID NO. 1.

2. The carbonyl reductase mutant as claimed in claim 1, wherein the mutant is obtained by mutating alanine at position 100 of the amino acid sequence shown in SEQ ID No.1 into one of serine, threonine or cysteine.

3. A genetically engineered bacterium constructed from the gene encoding the carbonyl reductase mutant of claim 1.

4. The use of the carbonyl reductase mutant of claim 1 in asymmetric reduction of aliphatic ketone compound to form achiral compound, wherein the aliphatic ketone compound is tbutyl 6-cyano- (5R) -3-carbonyl hexanoate, ethyl 4-chloroacetoacetate, ethyl acetoacetate, ethyl 4,4, 4-trifluoroacetoacetate, tbutyl acetoacetate, ethyl levulinate, methyl isobutyroacetate, ethyl isobutyroacetate, methyl 4-chloro-acetoacetate, ethyl butyroacetate.

5. The use according to claim 4, characterized in that the use is: respectively mixing wet thalli centrifugally collected from fermentation liquor obtained after fermentation culture of carbonyl reductase mutant genetic engineering bacteria and glucose dehydrogenase genetic engineering bacteria, forming a conversion system by using the mixed thalli as a catalyst, an aliphatic ketone compound as a substrate, glucose as an auxiliary substrate and a pH 7.0-8.0 buffer solution as a reaction medium, reacting at 35-40 ℃ and 600-800 rpm, and separating and purifying reaction liquid to obtain a chiral compound after the reaction is finished; the glucose dehydrogenase genetic engineering bacteria are obtained by inserting glucose dehydrogenase EsGDH gene shown in SEQ ID NO.6 into Nco I and Xho I sites of pET28a (+), constructing a recombinant expression vector, and transferring the expression vector into E.coli BL21(DE3) to prepare the genetic engineering bacteria E coli BL21(DE3)/pET28b (+) -EsGDH.

6. The method according to claim 5, wherein the amount of the catalyst added is 0.1-20g/L based on the volume of the buffer solution, and the wet biomass centrifugally collected from the fermentation broth after the fermentation culture of the carbonyl reductase mutant genetically engineered bacteria in the mixed biomass and the wet biomass centrifugally collected from the fermentation broth after the fermentation culture of the glucose dehydrogenase genetically engineered bacteria are mixed in a wet weight ratio of 1-5: 1; the adding amount of the substrate is 1-150g/L based on the volume of the buffer solution; the adding amount of the glucose is 1-150g/L based on the volume of the buffer solution.

7. The use as claimed in claim 5, wherein the carbonyl reductase mutant genetic engineering bacteria are prepared by the following method by wet bacteria cultured by fermentation: inoculating carbonyl reductase mutant genetic engineering bacteria into an LB liquid culture medium with a final concentration of 50 mu g/mL kanamycin, and culturing at 37 ℃ for 12-16 h to obtain a seed solution; inoculating the seed solution into a fresh LB liquid culture medium containing kanamycin with the final concentration of 50 mu g/mL by the inoculation amount of 2.0 percent in volume concentration, culturing for 2h at 37 ℃ and 200rpm, adding isopropyl thiogalactoside with the final concentration of 0.15-0.2mM into the culture solution, culturing for 12-14 h at 28 ℃, and centrifuging for 10min at 4 ℃ and 8000rpm to obtain the wet thallus containing the carbonyl reductase mutant.

8. The use according to claim 4, characterized in that the use is: centrifuging fermentation liquor obtained after fermentation culture of carbonyl reductase mutant genetic engineering bacteria, collecting wet bacteria, forming a conversion system by using pure enzyme liquid obtained by crushing and extracting the wet bacteria as a catalyst, NADPH as a coenzyme, an aliphatic ketone compound as a substrate and a buffer solution with pH of 7.0-8.0 as a reaction medium, reacting at 35-40 ℃ and 600-800 rpm, and separating and purifying reaction liquid after the reaction is finished to obtain a chiral compound.

9. Use according to claim 8, characterized in that the substrate is added to a final concentration of 1-50mM by volume of buffer; the final concentration of the coenzyme is 0.5-5mM based on the volume of the buffer solution; the final concentration of the catalyst is 0.1-20g/L calculated by the volume of the buffer solution.

10. The use of claim 8, wherein the pure enzyme solution extracted from the wet thallus of the carbonyl reductase mutant genetic engineering bacteria after fermentation culture is prepared by the following method:

(1) crude enzyme solution: resuspending wet bacteria cultured by fermentation of carbonyl reductase mutant genetic engineering bacteria with 100mM PB buffer solution, and placing on ice for ultrasonic crushing for 10 min; ultrasonic crushing conditions: the power is set to 400W, the crushing is suspended for 1s and is suspended for 5 s; centrifuging at 12000rpm for 10-15 min at 4 deg.C, filtering the supernatant with 0.22 μm filter membrane to obtain crude enzyme solution;

(3) pure enzyme solution:

the composition of the binding liquid is as follows: 20mM sodium dihydrogen phosphate dihydrate, 300mM sodium chloride and ultrapure water as a solvent, and adjusting the pH to 7.0 by using phosphoric acid or sodium hydroxide;

the washing liquid comprises the following components: 20mM sodium dihydrogen phosphate dihydrate, 300mM sodium chloride and 50mM imidazole in ultrapure water, pH adjusted to 7.0 with phosphoric acid or sodium hydroxide;

the eluent composition is as follows: 20mM sodium dihydrogen phosphate dihydrate, 300mM sodium chloride and 500mM imidazole in ultrapure water, and adjusting the pH to 7.0 with phosphoric acid or sodium hydroxide;

washing the nickel column with binding solution at a flow rate of 0.4mL/min until UV baseline is balanced, and loading the crude enzyme solution at a flow rate of 0.2mL/min to fully bind the target protein and the nickel column; washing the hybrid protein with a washing solution at a flow rate of 0.3mL/min, and washing the hybrid protein until the UV baseline is balanced; eluting the target protein by eluent at the flow rate of 0.25mL/min, starting to collect when the UV reaches 200mAU, and stopping collecting when the UV is reduced to 200mAU again to obtain target protein eluent; and (3) putting the collected target protein eluent into 20mM potassium phosphate buffer solution with the pH value of 7.0 for dialysis overnight, wherein the trapped fluid is pure enzyme solution.