CN106754775A - A kind of carbonyl reduction enzyme mutant and its gene and application - Google Patents
A kind of carbonyl reduction enzyme mutant and its gene and application Download PDFInfo
- Publication number
- CN106754775A CN106754775A CN201611203762.7A CN201611203762A CN106754775A CN 106754775 A CN106754775 A CN 106754775A CN 201611203762 A CN201611203762 A CN 201611203762A CN 106754775 A CN106754775 A CN 106754775A
- Authority
- CN
- China
- Prior art keywords
- carbonyl
- mutant
- enzyme mutant
- reduction enzyme
- carbonyl reduction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01184—Carbonyl reductase (NADPH) (1.1.1.184)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention relates to a kind of carbonyl reduction enzyme mutant and its gene, recombinant expression carrier and recombinant expression transformants comprising the carbonyl reduction enzyme mutant gene, the preparation method of the recombinase, and the recombinase in the carbonyl ethyl butyrate of 4 chlorine of asymmetric reduction 3 and other latent chiral carbonyl compounds preparing the application in the 3-hydroxyethyl butyrate of optical voidness (S) 4 chlorine 3 and other chiral, secondary alcohols.Compared with wild type carbonyl reductase, carbonyl reduction enzyme mutant of the present invention is greatly improved to the reduction vigor of the carbonyl ethyl butyrate of 4 chlorine 3, and the heat endurance of fractional mutant is also obviously improved, preferably catalysis the 3-hydroxyethyl butyrate of optical voidness (S) 4 chlorine 3 can be prepared using the mutant, with good prospects for commercial application.
Description
Technical field
The invention belongs to technical field of bioengineering, and in particular to a kind of streptomyces coelicolor carbonyl reductase ScCR1 dashes forward
Variant and its encoding gene, recombinant expression carrier and recombinant expression transformants containing the carbonyl reduction enzyme mutant gene,
The restructuring carbonyl reductase and preparation method thereof, and the carbonyl reduction enzyme mutant is in the catalysis chloro- 3- carbonyls ethyl butyrates of 4-
Asymmetric reduction, prepares the application of optical voidness (S) -4- chloro-3-hydroxyl ethyl butyrates.
Background technology
(S) -4- chloro-3-hydroxyls ethyl butyrate [Ethyl (S)-(-) -4-chloro-3-hydroxybutyrate, (S) -
CHBE], molecular formula：C6H11ClO3, molecular weight：166.60, No. CAS is 86728-85-0.Optical voidness (S) -4- chloro-3-hydroxyl fourths
Acetoacetic ester [(S)-CHBE] is the important medicine for synthesizing 3- hydroxy-3-methyl glutaryls coenzyme (HMG-CoA) reductase inhibitor
Intermediate.From pharmacological action analysis, the HMG-CoA reductase inhibitor be medicine Atorvastatin chief active into
Point.Atorvastatin, trade name " Lipitor " is Statins regulating plasma lipid medicine, and the medicine mainly acts on liver, orally
Afterwards, the hydrolysate of generation can Reverse transcriptase HMG-CoA reductase, promote LDL receptor synthesis, due to
HMG-CoA reductase is the key enzyme required for cholesterol biosynthesis, so the synthesis of cholesterol can be caused cannot be normally carried out, most
Total cholesterol level is not only reduced eventually, serum triglyceride level is also reduced, therefore, it is possible to effectively preventing and treating Atherosclerosis
Change and coronary heart disease.Current Atorvastatin is the first-selection of norcholesterol class medicine.
The method of chemical catalysis chiral, secondary alcohols synthesis mainly uses transiting state metal or borine as catalyst, with chirality
The hydrogen donor such as efficient catalytic boron hydride generates optics to the asymmetric transfer of latent chiral carbonyl group after part formation complex
The chiral, secondary alcohols of activity.But the method operation difficulty is big, and heavy metal may be remained in severe reaction conditions, and product, because
And chemical method synthesis application is restricted.At present, researcher has developed various bioanalysis synthesizing optical activity chiral secondary alcohol
Method, including enzyme process Kinetic Resolution and enzymatic method of asymmetrically reducing.Wherein, gone back using the asymmetric of latent chiral carbonyl compounds
The approach of former synthesizing optical activity chiral secondary alcohol, is capable of achieving theoretical 100% yield, is the chloro- 3- of production optical activity (S) -4-
The important method of 3-hydroxyethyl butyrate.Biological asymmetric reduction method has that green high-efficient, selectivity be high, reaction condition gently with
And it is simple to operate easily prepared many advantages, such as, therefore living things catalysis carbonyl asymmetric reduction synthesis of chiral secondary alcohol in recent years
Method is increasingly taken seriously.
(S) -4- chloro-3-hydroxyl ethyl butyrates are prepared using enzyme process method of asymmetrically reducing, carbonyl reduction is generally adopted by
Enzyme, is catalyzed the asymmetric reduction of the chloro- 3- carbonyls ethyl butyrates (being abbreviated as COBE) of 4-.Kita et al. is originated with reddish brown shadow yeast
Carbonyl reductase AR asymmetric reductions COBE synthesis (S)-CHBE, the enantiomeric excess value (ee) of product is 93%
(J.Mol.Catal.B.Enzym.,1999,6:305-313), the carbonyl reduction that Kataoka etc. is originated with Macedonia's Candida
Enzyme CmMR asymmetric syntheses (S)-CHBE, the enantiomeric excess value (ee) of its product is only 92% (Enzyme
Microb.Technol.,2006,38:944-951).Ye et al. is excavated by gene database in Pichia pastoris, is screened
To two kinds of Novel carbonyl reductases PsCRI and PsCRII, the enantiomeric excess value (ee) of product is equal after its catalysis reduction COBE>
99% (Appl.Microbiol.Biotechnol., 2011,89:513-522).How people is with from recombination bacillus coli
The PgCR of CCZU-Y10 is catalyzed COBE asymmetric reductions in dibutyl phthalate-water two-phase system and prepares (S)-CHBE,
Concentration of substrate is 1000mM, and the ee values of product are higher than 99%, high conversion rate up to 99% (Appl.Biochem.Biotechnol.,
2014,173:2042-2053)。
The carbonyl reductase ScCR1 energy that clone obtains from streptomyces coelicolor (Streptomyces coelicolor)
The highly-solid selectively asymmetric reduction of various high concentration carbonyls is enough catalyzed, corresponding optics chiral alcohol, the enzyme is prepared
Overexpression (Bioresour Technol.2011,102 are recombinated in Escherichia coli (Escherichia coli):
7023-7028).But the vigor of enzyme 3- carbonyls ethyl butyrate chloro- to 4- is medium, the Rate activity of pure enzyme only has 16U/mg, and should
The heat endurance of carbonyl reductase is also not good enough,(remaining vigor only has corresponding temperature during half after insulation 15min) also only
There are 47.4 DEG C, characterize to substrate tolerance(remaining vigor only has corresponding concentration of substrate during half after insulation 15min)
Only 34mM.By the means of the protein engineerings such as rite-directed mutagenesis, random mutation ScCR1 is carried out catalytic performance (catalysis activity,
Stability) transformation, improve its catalysis activity and its reaction stability, will have industrial application value higher.
The content of the invention
The technical problems to be solved by the invention are：The carbonyl reductase ScCR1 catalysis reduction chloro- 3- carbonyls ethyl butyrates of 4-
The problem that vigor is low and reaction stability is poor.For the problem, there is provided the carbonyl reduction enzyme mutant that a kind of catalytic performance is improved
Protein, the nucleotide sequence for encoding the mutein, the recombinant expression carrier containing the nucleotide sequence and recombination expression turn
Change body, the preparation method of the carbonyl reduction enzyme mutant and its in catalysis of carbonyl asymmetric reduction, in preparing optical homochiral alcohol
Application.
The purpose of the present invention can be achieved through the following technical solutions：
One of technical scheme that the present invention takes is：A kind of 3- carbonyl ethyl butyrates catalysis activity chloro- to 4- is provided to improve,
Stability-enhanced carbonyl reductase ScCR1 muteins.
Protein with the amino acid sequence as shown in SEQ ID No.2 in sequence table is mutated, by the 158th
Isoleucine replaces with valine, or on this basis, the proline, the alanine of the 60th to the 168th are respectively or same
The replacement of Shi Jinhang amino acid residues, obtain as derived from ScCR1 and carbonyl reduction enzymatic activity improve mutein.
Mutant ScCR1I158VThe protein of shown amino acid sequence composition is dashed forward from the fixed point saturation built by ScCR1
Screened in change storehouse and obtained.The mutant that 3- carbonyls ethyl butyrate catalysis activity chloro- to 4- is significantly improved is obtained in screening
ScCR1I158VOn the basis of, continue to ScCR1I158VTransformed, mainly take the means of random mutation to be somebody's turn to do with further reinforcing
The catalysis activity of enzyme simultaneously improves its stability.
Preferably, the carbonyl reduction enzyme mutant, is that the amino acid residue generation of wild carbonyl reductase ScCR1 is as follows
The mutant that the mutation of any one situation is obtained；
(1) the 158th isoleucine replaces with valine in the amino acid sequence of wild type carbonyl reductase ScCR1, life
Entitled ScCR1I158V；
(2) the 158th isoleucine replaces with valine in the amino acid sequence of wild type carbonyl reductase ScCR1, and
168th proline replaces with serine, is named as ScCR1I158V/P168S；
(3) the 158th isoleucine replaces with valine in the amino acid sequence of wild type carbonyl reductase ScCR1, and
168th proline replaces with serine, and the 60th alanine replaces with threonine, is named as ScCR1A60T/I158V/P168S。
The preparation method of the mutant is specially：With from streptomyces coelicolor (Streptomyces
Coelicolor the wild enzyme ScCR1 genes of carbonyl reductase in) are template, (are chosen using the mutant primer containing catastrophe point
One section of base sequence of each 15~20bp of amino acid sites upstream and downstream that needs are mutated, the base in mutational site is replaced with
The codon of amino acid after mutation, used as PCR forward primers, its reverse complementary sequence is PCR reverse primers) build to pinpoint and satisfy
And mutation library, high flux screening is carried out to resulting mutant gene bank, obtain 3- carbonyls ethyl butyrate catalysis activity chloro- to 4-
The mutant ScCR1 of raisingI158V(kcat/KMIt is 89s-1mM-1)；With mutant ScCR1I158VGene is template, using random prominent
Becoming primer carries out fallibility PCR structure random mutations storehouse, and high flux screening is carried out to resulting mutant gene bank, and the vigor of obtaining is carried
High and stability-enhanced mutant ScCR1I158V/P168S(kcat/KMIt is 196s-1mM-1,It is 49.2 DEG C,For
122mM)；With mutant ScCR1I158V/P168SGene is template, and carrying out fallibility PCR using random mutation primer builds random mutation
Storehouse, high flux screening is carried out to resulting mutant gene bank, has obtained that stability is significantly improved and that catalysis activity is improved is prominent
Variant ScCR1A60T/I158V/P168S(kcat/KMIt is 234s-1mM-1,It is 53.6 DEG C,It is 162mM).
Wherein described rite-directed mutagenesis PCR amplifications are this area routine techniques, and PCR amplification programs (50 μ l) are：Template 0.5~
20ng, 5 μ l 10 × KOD plus buffer, 5 μ l dNTP (each 2.0mM), 2 μ l MgSO4(25mM), a pair of mutant primers are each
1 μ l (20 μM), 1 KOD enzyme of unit (TOYOBO CO., LTD., Osaka, Japan), plus sterile purified water are to 50 μ l.
The program of rite-directed mutagenesis PCR amplification is：(1) 95 DEG C of denaturation 3min；(2) 98 DEG C are denatured 10sec, (3) 55 DEG C
Annealing 20sec, (4) 72 DEG C of extension 90sec, step (2)~(4) carry out 3 circulations altogether, and (5) 98 DEG C are denatured 10sec, (6) 54 DEG C
Annealing 20sec, (7) 72 DEG C of extension 90sec, step (5)~(7) carry out 3 circulations altogether, and (8) 98 DEG C are denatured 10sec, (9) 53 DEG C
Annealing 20sec, (10) 72 DEG C of extension 90sec, step (8)~(10) carry out 3 circulations, (11) 98 DEG C of denaturation 10sec, (12) altogether
52 DEG C of annealing 20sec, (13) 72 DEG C of extension 90sec, step (11)~(13) carry out 21 circulations, last 72 DEG C of extensions altogether
10min, 12 DEG C of preservation products.
Wherein described fallibility PCR amplifications are this area routine techniques, and the system (50 μ l) of PCR reactions is：Template 0.5~
20ng, 5 μ 10 × rTaq of l buffer, 5 μ l dNTP (each 2.0mM), 2 μ l MgSO4(25mM),5μl MnCl2(100 μM), one
1 μ l (20 μM) each to mutant primer, 1 rTaq enzyme (TaKaRa, Japan) of unit, 1 μ l DMSO, plus sterile purified water are to 50
μl。
The program of fallibility PCR amplification is：(1) 95 DEG C of denaturation 3min；(2) 98 DEG C of denaturation 10sec, (3) 55 DEG C of annealing
20sec, (4) 72 DEG C of extension 90sec, step (2)~(4) carry out 3 circulations, (5) 98 DEG C of denaturation 10sec, (6) 54 DEG C of annealing altogether
20sec, (7) 72 DEG C of extension 90sec, step (5)~(7) carry out 3 circulations, (8) 98 DEG C of denaturation 10sec, (9) 53 DEG C of annealing altogether
20sec, (10) 72 DEG C of extension 90sec, step (8)~(10) carry out 3 circulations altogether, and (11) 98 DEG C are denatured 10sec, (12) 52 DEG C
Annealing 20sec, (13) 72 DEG C of extension 90sec, step (11)~(13) carry out 21 circulations, last 72 DEG C of extensions 10min, 12 altogether
DEG C preservation product.
The two of the technical scheme that the present invention takes are：A kind of nucleic acid of separation, the nucleic acid be encode as technical scheme it
The nucleic acid of mutein described in.
The preparation method of nucleic acid of the present invention is this area customary preparation methods, and the preparation method is preferably comprised：
The nucleic acid molecules of the coding carbonyl reduction enzyme mutant are obtained by gene clone technology, or is synthesized by artificial complete sequence
Method obtain encoding the nucleic acid molecules of the carbonyl reduction enzyme mutant.
Nucleic acid of the present invention is preferably the nucleic acid molecules with point mutation, the nucleic acid molecules with point mutation
Preparation method is the conventional preparation method in this area, and the preparation method is preferably：With the mutant that technical scheme one is obtained
DNA sequence dna is template, genes of interest needed for entering performing PCR amplification using two ends primer, that is, obtain the nucleic acid molecules with point mutation：
ScCR1I158V、ScCR1I158V/P168SAnd ScCR1A60T/I158V/P168S。
Wherein described PCR amplifications are this area routine techniques, and PCR amplification programs (50 μ l) are：Template 0.5~20ng, 5 μ l
10 × KOD plus buffer, 5 μ l dNTP (each 2.0mM), 2 μ l MgSO4 (25mM), a pair of each 1 μ l (20 μ of mutant primer
M), 1 KOD enzyme of unit (TOYOBO CO., LTD., Osaka, Japan), plus sterile purified water is to 50 μ l.
The program of fallibility PCR amplification is：(1) 95 DEG C of denaturation 3min；(2) 98 DEG C of denaturation 10sec, (3) 55 DEG C of annealing
20sec, (4) 72 DEG C of extension 90sec, step (2)~(4) carry out 3 circulations, (5) 98 DEG C of denaturation 10sec, (6) 54 DEG C of annealing altogether
20sec, (7) 72 DEG C of extension 90sec, step (5)~(7) carry out 3 circulations, (8) 98 DEG C of denaturation 10sec, (9) 53 DEG C of annealing altogether
20sec, (10) 72 DEG C of extension 90sec, step (8)~(10) carry out 3 circulations altogether, and (11) 98 DEG C are denatured 10sec, (12) 52 DEG C
Annealing 20sec, (13) 72 DEG C of extension 90sec, step (11)~(13) carry out 21 circulations, last 72 DEG C of extensions 10min, 12 altogether
DEG C preservation product.
The three of the technical scheme that the present invention takes are：A kind of recombinant expression carrier comprising above-mentioned nucleic acid.
Wherein described recombinant expression carrier can be obtained by this area conventional method, i.e.,：By carbonyl of the present invention also
The nucleic acid molecules of protoenzyme mutant gene are connected to built-up on various expression vectors.Carrier of the present invention is preferably matter
Grain pET-28a (+).It is preferred that recombinant expression carrier of the invention can be obtained by following methods：Will be as obtained by PCR be expanded
Nucleic acid product and expression vector pET-28a use restriction enzyme Nde I and Hind III double digestions respectively, form complementary
Cohesive end, connects through T4DNA ligases, forms the recombinant expression plasmid containing carbonyl reduction enzyme gene of the invention
pET28a-ScCR1I158V、pET28a-ScCR1I158V/P168SAnd pET28a-ScCR1A60T/I158V/P168S。
The four of the technical scheme that the present invention takes are：A kind of recombinant expression transformants comprising above-mentioned recombinant expression carrier.
The preparation method of wherein described recombinant expression transformants is preferably：Above-mentioned recombinant expression carrier is converted to host
It is obtained in microorganism.Wherein described host microorganism is preferably：Escherichia coli (E.coli), more preferably e. coli bl21
Or bacillus coli DH 5 alpha (DE3).Foregoing recombinant expression plasmid is converted into E.coli BL21 (DE3), you can obtain of the invention excellent
The engineering strain of choosing, i.e. E.coli BL21 (DE3)/pET28a-ScCR1I158V、E.coli BL21(DE3)/pET28a-
ScCR1I158V/P168SWith E.coli BL21 (DE3)/pET28a-ScCR1A60T/I158V/P168S.It is normal that method for transformation may be selected this area
Rule method, such as electric robin, heat shock method etc., preferably select heat shock method to be converted, and hot shock condition is preferably：42 DEG C,
Heat shock 90 seconds.
The five of the technical scheme that the present invention takes are：A kind of preparation method of carbonyl reduction enzyme mutant, including such as
Lower step：The above-mentioned recombinant expression transformants of culture, obtain restructuring carbonyl reduction enzyme mutant from culture.
Wherein described preparation method is preferably：Above-mentioned recombination bacillus coli is seeded to and contains kanamycins (50 μ g/
Ml in LB culture mediums (peptone 10g/L, yeast extract 5g/L, NaCl 10g/L, pH7.0)), 37 DEG C of shaken cultivations overnight, are pressed
The inoculum concentration of 1% (v/v) is accessed in the 500mL triangular flasks equipped with 100mL LB culture mediums, is placed in 37 DEG C, the vibration of 180rpm shaking tables
Culture, as the extinction density OD of nutrient solution600When reaching 0.8, the isopropyl-beta D-thio pyrans half of final concentration of 0.1mM is added
Lactoside (IPTG) is induced, and inducing temperature is 16 DEG C, after induction 24 hours, by medium centrifugal, collects cell, and with giving birth to
Reason salt solution is washed twice, and obtains resting cell.The resting cell of gained is suspended in 10mL buffer solutions (pH 8.0), in ice-water bath
Middle ultrasonication, is collected by centrifugation supernatant, the as crude enzyme liquid of recombinase, crude enzyme liquid through Polyacrylamide Gel Electrophoresis,
Recombinant protein exists in cell in partly soluble form, has Partial Protein to be present in cell fragment in addition.
Latent chiral carbonyl compounds are catalyzed in the present invention carries out urging for asymmetric reduction reaction formation optical activity chirality alcohol
Agent, can be above-mentioned restructuring carbonyl reductase mutant protein, or the conversion comprising restructuring carbonyl reduction enzyme mutant
Body resting cell.
The six of the technical scheme that the present invention takes are：Above-mentioned protein or the whole cell of above-mentioned recombination bacillus coli are used as catalysis
The latent chiral carbonyl compounds of agent catalysis carry out asymmetric reduction reaction, form the application in chiral alcohol.
Described protein preferably carbonyl reduction enzyme mutant of the present invention or restructuring carbonyl reduction enzyme mutant
Body.Described latent chiral carbonyl compounds are preferably the chloro- 3- carbonyls ethyl butyrates (COBE) of 4-, can also be the heptan of 2,3- bis-
Ketone, 1- phenyl -1,2- propanedione or 2- methyl -2- heptene -6- ketone.
The terms and conditions of asymmetric reduction reaction of the present invention can be carried out by the normal condition of the such reaction in this area
Selection, it is preferred that described application comprises the steps：Reaction carry out in a two-phase system, two-phase reaction system be toluene with
Water, the concentration of the latent chiral carbonyl compounds is 50~200g/L (organic phase), and the molar concentration of isopropanol is concentration of substrate
1.0~1.5 times, the carbonyl reduction enzyme mutant consumption is 15~65kU/L, the NAD of extra addition+Concentration be 0~
0.1mM, reaction water phase pH of buffer is 6.0~7.0, and reaction temperature is 25~35 DEG C.
Agents useful for same of the present invention and raw material are commercially available.
Positive effect of the invention is：Compared with wild type carbonyl reductase, carbonyl reductase of the present invention
Mutant has a catalysis activity and stability higher, the reduction vigor of 3- carbonyls ethyl butyrate (COBE) chloro- to substrate 4- by
The Rate activity of the 38.8U/mg of wild type is promoted to up to 260U/mg, and stability is also greatly improved, Tm(albumen solution
Chain temperature) up to 58.1 DEG C are brought up to by 50.7 DEG C of wild type, to the tolerance of substrateAlso carried by the 34mM of wild type
Up to it is up to 162mM.Multiple carbonyl reduction enzyme mutants that the present invention is obtained are particularly well-suited to catalysis reduction COBE and prepare
Optically pure Lipitor medicine precursor compound (S)-CHBE, with good prospects for commercial application.
Specific embodiment
With reference to specific embodiment, the present invention is described in detail.
Embodiment 1
The rite-directed mutagenesis of carbonyl reductase ScCR1
Rite-directed mutagenesis is usedII Site-Directed Mutagenesis Kit
(Stratagene, Catalog#200522) scheme is operated.
It is as follows that the degeneracy mutant primer containing catastrophe point is designed first：
5’-ACGTCGCCTCCNNKCTCGGCTCGGTCGGCT-3 ',
5’-AGCCGACCGAGCCGAGMNNGGAGGCGACGT-3’。
Wherein N represents tetra- kinds of mixing of base of A, T, C, G；K represents two kinds of mixing of base of G, T；M represents two kinds of alkali of A, C
The mixing of base.
Template wherein used is：Wild type carbonyl reductase recombinant plasmid, comprising the gene as shown in SEQ ID No.1
Sequence.
PCR amplification programs (50 μ l) are：Template 0.5~20ng, 5 μ l 10 × KOD plus buffer, 5 μ l dNTP are (each
2.0mM), 2 μ l MgSO4(25mM), a pair of each 1 μ l of mutant primers (20 μM), 1 KOD enzyme of unit (TOYOBO CO.,
LTD., Osaka, Japan), plus sterile purified water is to 50 μ l.
PCR amplification programs：(1) 95 DEG C of denaturation 3min；(2) 98 DEG C of denaturation 10sec, (3) 55 DEG C of anneal 20sec, (4) 72 DEG C
Extend 90sec, step (2)~(4) carry out 3 circulations, (5) 98 DEG C of denaturation 10sec, (6) 54 DEG C of anneal 20sec, (7) 72 DEG C altogether
Extend 90sec, step (5)~(7) carry out 3 circulations, (8) 98 DEG C of denaturation 10sec, (9) 53 DEG C of anneal 20sec, (10) 72 altogether
DEG C extend 90sec, step (8)~(10) carry out altogether 3 circulation, (11) 98 DEG C denaturation 10sec, (12) 52 DEG C annealing 20sec,
(13) 72 DEG C of extension 90sec, step (11)~(13) carry out 21 circulations altogether, and last 72 DEG C of extensions 10min, 12 DEG C of preservations are produced
Thing.
The PCR primer that amplification is obtained is in 37 DEG C of Transformed E .coli BL21 (DE3) impressions after restriction endonuclease Dpn I digestion 2h
State cell, and even spread contains the LB agar plates of 50 μ l/mg kanamycins.After 37 DEG C of incubated overnights, monoclonal 96 is selected
Strain is cultivated and induced expression to deep-well plates.The vigor screening of mutation library, the vigor for obtaining are carried out according to spectrophotometer method
The mutant for significantly improving, serves Hai Meiji biological medicines Science and Technology Ltd. and is sequenced.Sequencing result DNAMAN softwares
Compare with carbonyl reductase ScCR1 sequences, 158 sport valine.The mutant for obtaining is named as ScCR1I158V。
Embodiment 2
The random mutation of carbonyl reductase ScCR1
Random nucleotide is introduced using fallibility round pcr to carbonyl reduction enzyme gene to be mutated, wherein the primer is as follows：
Sense primer：GGAATTCCATATGACTGTCGAAACCGCCACC
Anti-sense primer：CGCGGATCCCTAGACAGAACAGTAACCACCT
Wherein template is：Embodiment 1 obtains carbonyl reductase mutant plasmid pET28a-ScCR1I158V。
PCR reaction system (50 μ l) be：Template 0.5~20ng, 5 μ 10 × rTaq of l buffer, 5 μ l dNTP are (each
2.0mM), 2 μ l MgSO4(25mM), 5 μ l MnCl2(100 μM), a pair of each 1 μ l of mutant primers (20 μM), 1 rTaq of unit
Enzyme (TaKaRa, Japan), 1 μ l DMSO, plus sterile purified water are to 50 μ l.
The program of fallibility PCR amplification is：(1) 95 DEG C of denaturation 3min；(2) 98 DEG C of denaturation 10sec, (3) 55 DEG C of annealing
20sec, (4) 72 DEG C of extension 90sec, step (2)~(4) carry out 3 circulations, (5) 98 DEG C of denaturation 10sec, (6) 54 DEG C of annealing altogether
20sec, (7) 72 DEG C of extension 90sec, step (5)~(7) carry out 3 circulations, (8) 98 DEG C of denaturation 10sec, (9) 53 DEG C of annealing altogether
20sec, (10) 72 DEG C of extension 90sec, step (8)~(10) carry out 3 circulations altogether, and (11) 98 DEG C are denatured 10sec, (12) 52 DEG C
Annealing 20sec, (13) 72 DEG C of extension 90sec, step (11)~(13) carry out 21 circulations, last 72 DEG C of extensions 10min, 12 altogether
DEG C preservation product.
After pcr amplification product purifying, with Nde I and Hind III the two restriction enzymes respectively to fallibility PCR
Amplified production and carrier pET28a in 37 DEG C of double digestion 12h, both recovery products, with overnight being connected at 16 DEG C of T4 ligases,
Transformed E .coli BL21 (DE3) competent cell, and it is spread evenly across the LB agar plates containing 50 μ l/mg kanamycins, 37
DEG C incubated overnight, builds random mutant libraries, and screened.Screening obtains one and COBE catalysis activities is greatly improved
Mutant (168U/mg is up to the Rate activity of substrate COBE, and maternal there was only 38.4U/mg), find that it is dashed forward through DNA sequencing
It is P168S to become site, is named as ScCR1I158V/P168S。
Embodiment 3
Random mutation
Random nucleotide is introduced using fallibility round pcr to carbonyl reduction enzyme gene to be mutated, wherein the primer is as follows：
Sense primer：GGAATTCCATATGACTGTCGAAACCGCCACC
Anti-sense primer：CGCGGATCCCTAGACAGAACAGTAACCACCT
Wherein template is：Embodiment 2 obtains carbonyl reductase mutant plasmid pET28a-ScCR1I158V/P168S。
PCR reaction system (50 μ l) be：Template 0.5~20ng, 5 μ 10 × rTaq of l buffer, 5 μ l dNTP are (each
2.0mM), 2 μ l MgSO4(25mM), 5 μ l MnCl2(100 μM), a pair of each 1 μ l of mutant primers (20 μM), 1 rTaq of unit
Enzyme (TaKaRa, Japan), 1 μ l DMSO, plus sterile purified water are to 50 μ l.
The program of fallibility PCR amplification is：(1) 95 DEG C of denaturation 3min；(2) 98 DEG C of denaturation 10sec, (3) 55 DEG C of annealing
20sec, (4) 72 DEG C of extension 90sec, step (2)~(4) carry out 3 circulations, (5) 98 DEG C of denaturation 10sec, (6) 54 DEG C of annealing altogether
20sec, (7) 72 DEG C of extension 90sec, step (5)~(7) carry out 3 circulations, (8) 98 DEG C of denaturation 10sec, (9) 53 DEG C of annealing altogether
20sec, (10) 72 DEG C of extension 90sec, step (8)~(10) carry out 3 circulations altogether, and (11) 98 DEG C are denatured 10sec, (12) 52 DEG C
Annealing 20sec, (13) 72 DEG C of extension 90sec, step (11)~(13) carry out 21 circulations, last 72 DEG C of extensions 10min, 12 altogether
DEG C preservation product.
After pcr amplification product purifying, with Nde I and Hind III the two restriction enzymes respectively to fallibility PCR
Amplified production and carrier pET28a in 37 DEG C of double digestion 12h, both recovery products, with overnight being connected at 16 DEG C of T4 ligases,
Transformed E .coli BL21 (DE3) competent cell, and it is spread evenly across the LB agar plates containing 50 μ l/mg kanamycins, 37
DEG C incubated overnight, builds random mutant libraries, and screened.Screening obtains a stability the mutation for greatly improving
Body, Tm(albumen melting temperature is 58.1 DEG C, and the T of female parentmIt is 50.7 DEG C；To the tolerance of substrate COBEIt is 162mM, and
MaternalIt is 34mM.Find that its mutational site, for A60T, is named as ScCR1 through DNA sequencingA60T/I158V/P168S。
Embodiment 4
The preparation of the structure and recombinant expression transformants of recombinant expression carrier
By the carbonyl reduction enzyme mutant gene DNA fragmentation of gained in embodiment 1,2 and 3 at 37 DEG C respectively with restricted interior
Enzyme cutting Nde I and Hind III double digestion 12h, purify, using Ago-Gel DNA QIAquick Gel Extraction Kits through agarose gel electrophoresis
Reclaim target fragment.By target fragment in the presence of T4DNA ligases, after same I and Hind III double digestions through Nde
Plasmid pET28a, overnight obtain recombinant expression plasmid in 4 DEG C of connections.
Above-mentioned recombinant expression plasmid is transformed into E.coli DH5 α competent cells, conversion condition is 45 DEG C of heat shocks 90
Second, positive restructuring is screened in the resistant panel containing kanamycins, picking monoclonal, positive gram of bacterium colony PCR checkings
It is grand.Culture recombinant bacterium, after plasmid is extracted after plasmid amplification, converts into E.coli BL21 (DE3) competent cell again, turns
Change liquid to be applied on the LB flat boards containing kanamycins, 37 DEG C of inversion overnight incubations obtain positive restructuring transformant E.coli
BL21 (DE3)/pET28a-ScCR1 mutant, bacterium colony PCR verify positive colony.
Embodiment 5
The expression of carbonyl reductase ScCR1 mutant, purifying and enzymatic activity and Stability Determination
The expression inoculation of gained carbonyl reduction enzyme mutant in embodiment 4 is contained into 50 μ l/mg kanamycins in 100ml
LB fluid nutrient mediums in, 37 DEG C of 200rpm are cultivated to OD6000.6~0.8 is reached, 16 DEG C is cooled to and is added final concentration of
The IPTG of 0.1mM, continuing culture 20h carries out induced expression.6000 × g is centrifuged 10min collects thallines, and uses brine
Twice, resting cell is obtained.The resting cell of gained is suspended in the buffer solution of pH 6.5, the ultrasonication in ice bath, be centrifuged
Supernatant is collected, the crude enzyme liquid of carbonyl reduction enzyme mutant is as recombinated.Crude enzyme liquid is freezed, thick enzyme powder is as freezed.
It is thin with sodium phosphate buffer (50mM, pH8.0, NaCl containing 500mM and 5mM beta -mercaptoethanols) resuspended gained tranquillization
Born of the same parents, ultrasonication takes supernatant, you can obtain the thick enzyme of carbonyl reductase mutant protein after 30000 × g centrifugation 45min centrifugations
Liquid.Carbonyl reductase mutant protein is purified using Ni affinity columns (1ml), specific method is as follows：
(1) affine Ni is balanced with sodium phosphate buffer (50mM, pH8.0 contain 500mM NaCl and 5mM beta -mercaptoethanol)
Post；
(2) crude enzyme liquid of the carbonyl reductase mutant protein obtained by the above method is passed through into Ni with the flow velocity of 1ml/min
Post, makes destination protein be mounted on Ni posts；
(3) with the sodium phosphate buffer containing 0~50mM imidazoles, (50mM, pH8.0 contain 500mM NaCl and 5mM β-mercaptos
Base ethanol) elute the foreign protein that ability is not bound with Ni posts；
(4) with the sodium phosphate buffer containing 200mM imidazoles, (50mM, pH8.0 contain 500mM NaCl and 5mM β-sulfydryls
Ethanol) wash-out destination protein；
(5) Ni posts are balanced with sodium phosphate buffer (50mM, pH8.0 contain 500mM NaCl and 5mM beta -mercaptoethanol),
For future use.
(6) protein sample that SDS-PAGE detections are collected into is carried out with vertical electrophoresis apparatus.Take 20 μ l samples add 5 μ l 5 ×
SDS sample-loading buffers are processed, and applied sample amount is 10 μ l, standard molecular weight albumen (Protein Molecular Weight
Marker), it is purchased from Thermo companies of the U.S..SDS-PAGE gum concentrations are 12%, carry out concentration electrophoresis from 110V voltages, then change
For 200V voltages carry out separation electrophoresis.Result shows to purify the mutant protein for obtaining high-purity, molecular weight by the above method
Size is in 26kDa or so.
Carried out by way of extinction value changes at 340nm restructuring carbonyl reduction enzyme activity determination detecting.Specific method is such as
Under：In 1ml reaction systems (50mM sodium phosphate buffers, pH 6.5), the chloro- 3- carbonyls of substrate 4- of final concentration of 2mM are added
Ethyl butyrate (COBE), the NADH of final concentration of 0.1mM, 30 DEG C of insulations add appropriate pure enzyme solutions or clasmatosis after 2 minutes
Crude enzyme liquid afterwards, rapid to mix, the change of light absorption value at detection 340nm.The computing formula of enzyme activity is：Enzyme activity (U)=EW
×V×103/(6220×l)；In formula, EW is the changing value of absorbance at 340nm in 1min；V is the volume of reaction solution, unit
ml；6220 is the molar extinction coefficient of NADH, unit L/ (molcm)；L is optical path length, unit cm.Per unit (U) carbonyl
The definition of reductase is under above-mentioned condition, 1 μm of ol NADH of catalysis per minute aoxidizes required enzyme amount.Each mutant is surveyed
It is living, as a result referring to table 1.
Carbonyl reduction enzyme mutant stability is characterized：According to document (Angew.Chem.Int.Ed.2006,27,7745-
7751) carbonyl reductase is determinedValue, carbonyl reductase is determined with similar approachValue.
The ScCR1 of table 1 and its mutation volume property
Embodiment 6-8
ScCR1A60T/I158V/P168SIt is catalyzed the asymmetric reduction of different carbonyls
In 1ml reaction systems (50mM sodium phosphate buffers, pH 6.5), the substrate 2 of final concentration of 2mM, 3- bis- are added
Heptanone, 1- phenyl -1,2- propanedione and 2- methyl -2- heptene -6- ketone, the NADH of final concentration of 0.1mM, 30 DEG C are incubated 2 minutes
The mutant ScCR1 for adding appropriate embodiment 4 to obtain afterwardsA60T/I158V/P168SEnzyme liquid, rapid to mix, light absorption value at detection 340nm
Change.With reference to Bioresour.Technol.2011,102,7023-7028 method determines the ee values of product., knot
Fruit is shown in Table 2.
The ScCR1 of table 2A60T/I158V/P168STo the activity and stereoselectivity of different carbonyls
Embodiment 9
ScCR1A60T/I158V/P168SIt is catalyzed the asymmetric reduction of the chloro- 3- carbonyls ethyl butyrates of 4-
Weigh ScCR1 prepared by 40mg such as embodiments 5A60T/I158V/P168SFreeze the KPB buffer solutions that thick enzyme powder is dissolved in 5mL
(pH 6.5), add 5mL contain concentration be 200g/L substrates COBE toluene, 1.5 times of auxiliary substrate isopropanols of substrate equivalent,
Reacted respectively at 30 DEG C under magnetic agitation, the reaction time is 2 hours.Reaction is extracted after terminating with isometric ethyl acetate
Take, be extracted twice, combining extraction liquid, plus anhydrous sodium sulfate drying is overnight, post analysis determine substrate conversion efficiency and reduzate
Ee values, respectively 99.9% He>99% (S).And under the same terms, the substrate using wild-type enzyme ScCR1 catalytic reactions turns
Rate is only 70.1%.
Embodiment 10
(S) prepared by ten grams of levels of -4- chloro-3-hydroxyls ethyl butyrate
Reaction is carried out in the reactor of 500mL, weighs ScCR1 prepared by 1.24g such as embodiments 5A60T/I158V/P168SIt is quiet
Breath cell catalyst, its vigor is about 8.1U/mg resting cells, adds 150mL KPB buffer solutions (50mM, pH6.5), adds
150mL toluene and 30g substrates COBE, 16.4g isopropanol, the NAD of final concentration 0.1mM+, in 30 DEG C of constant temperature, 200rpm machineries are stirred
Lower reaction is mixed, reaction conversion ratio reaches 99% after reaction 9h, the product obtained using ethyl acetate extractive reaction adds appropriate nothing
Aqueous sodium persulfate is dried overnight, and rotary evaporation removes solvent, obtains 28.5g products (S) -4- chloro-3-hydroxyl ethyl butyrates, separates
Rate is 95%, and optical purity is higher than 99%.
The above-mentioned description to embodiment is to be understood that and use invention for the ease of those skilled in the art.
Person skilled in the art can easily make various modifications to these embodiments, and should this General Principle for illustrating
Use in other embodiment without by performing creative labour.Therefore, the invention is not restricted to above-described embodiment, art technology
Personnel's announcement of the invention, the improvement and modification not departed from done by scope of the invention all should be in protections of the invention
Within the scope of.
<110>East China University of Science
<120>A kind of carbonyl reduction enzyme mutant and its gene and application
<160> 2
<170> PatentIn version3.3
<210> 1
<211> 792
<212> DNA
<213> Streptomyces coelicolor
<220>
<223>Wild type carbonyl reductase
<400> 1
atgagcacca ccggaaccac ccccgccacc accgggtacg ccgccgagtt cgccggccgt 60
accgccctcg tcaccggtgc cgcctccggt atcggcctgg ccaccgcccg ccggctcggc 120
gccggcggcg cccgggtcgt cgtcgccgac ttcaacgccg agggcgccga gaaggccgcc 180
gccgagctgc gggccggtgg cgtcgaggcc gccgcggtcg agctggacgt cacccgtccg 240
gagtccgtcg aggcggccgt cgggttcgcc gtcgacacgt tcggctcgct ggacctcgcc 300
gtcaacaacg ccggcatcgg cggccccagc gccccgaccg gcgagtacga cgtggcggcc 360
taccagcgcg tcgtgcgcac caacctcgac ggcgtcttct actcgatgcg ctacgaactg 420
cccgccatcg aggcggccgg caagggcggc tcgatcgtga acgtcgcctc catcctcggc 480
tcggtcggct tcgccggctc ccccgcctac gtcgccgcca agcacggcgt ggtcgggctg 540
acgaaggcgg ccgccgccga gtacgccgcc cgcggcatcc ggatcaacgc ggtcggtccg 600
ggcttcatcg acacccccct gctcaagacc atggacgagg ccgcctacaa ggggctggtc 660
gccctgcacc cggccggccg cctcgggcgc tccgaggagg tcgcggagct gatcgccttc 720
ctgctgtccg accgcgcgtc cttcgtcgcg ggcagctatc acctggtcga cggcgcctac 780
accgccgtct ga 792
<210> 2
<211> 263
<212> PRT
<213> Streptomyces coelicolor
<220>
<223>Saltant type carbonyl reductase
<400> 2
Met Ser Thr Thr Gly Thr Thr Pro Ala Thr Thr Gly Tyr Ala Ala
5 10 15
Glu Phe Ala Gly Arg Thr Ala Lys Val Thr Gly Ala Ala Ser Gly
20 25 30
Ile Gly Leu Ala Thr Ala Arg Arg Leu Gly Ala Gly Gly Ala Arg
35 40 45
Val Val Val Ala Asp Phe Asn Ala Glu Gly Ala Glu Lys Ala Ala
50 55 60
Ala Glu Leu Arg Ala Gly Gly Val Glu Ala Ala Ala Val Glu Leu
65 70 75
Asp Val Thr Arg Pro Glu Ser Val Glu Ala Ala Val Gly Phe Ala
80 85 90
Val Asp Thr Phe Gly Ser Leu Asp Leu Ala Val Asn Asn Ala Gly
95 100 105
Ile Gly Gly Pro Ser Ala Pro Thr Gly Glu Tyr Asp Val Ala Ala
110 115 120
Tyr Gln Arg Val Val Arg Thr Asn Leu Asp Gly Val Pro Tyr Ser
125 130 135
Met Arg Tyr Glu Leu Pro Ala Ile Glu Ala Ala Gly Lys Gly Gly
140 145 150
Ser Ile Val Asn Val Ala Ser Ile Leu Gly Ser Val Gly Phe Ala
155 160 165
Gly Ser Pro Ala Tyr Val Ala Ala Lys His Gly Val Val Gly Leu
170 175 180
Thr Lys Ala Ala Ala Ala Glu Tyr Ala Ala Arg Gly Ile Arg Ile
185 190 195
Asn Ala Val Gly Pro Gly Phe Ile Asp Thr Pro Leu Leu Lys Thr
200 205 210
Met Asp Glu Ala Ala Tyr Lys Gly Leu Val Ala Leu His Pro Ala
215 220 225
Gly Arg Leu Gly Arg Ser Glu Glu Val Ala Glu Leu Ile Ala Phe
230 235 240
Leu Leu Ser Asp Arg Ala Ser Phe Val Ala Gly Ser Tyr His Leu
245 250 255
Ver Asp Gly Ala Tyr Thr Ala Val
260
Claims (9)
1. a kind of carbonyl reduction enzyme mutant, it is characterised in that it is the 60th of the amino acid sequence as shown in SEQ ID No.2
One or more site in alanine, 158 isoleucines or 168 proline residues after amino acid substitution by forming
Amino acid sequence composition activity improve carbonyl reduction enzyme mutant.
2. a kind of carbonyl reduction enzyme mutant according to claim 1, it is characterised in that the carbonyl reduction enzyme mutant
There is following sequence：
(1) the 158th isoleucine of the amino acid sequence as shown in SEQ ID No.2 in sequence table is replaced with into valine；
(2) the 158th isoleucine of the amino acid sequence as shown in SEQ ID No.2 in sequence table is replaced with into valine, the
168 proline replace with serine；
(3) the 60th alanine of the amino acid sequence as shown in SEQ ID No.2 in sequence table is replaced with into threonine, the 158th
Position isoleucine replaces with valine, and the 168th proline replaces with serine.
3. a kind of nucleic acid of separation, it is characterised in that carbonyl of the described nucleic acid coding as described in any in claim 1-2 is also
Protoenzyme mutein.
4. a kind of recombinant expression carrier comprising nucleic acid as claimed in claim 3.
5. a kind of recombinant expression transformants comprising recombinant expression carrier as claimed in claim 4.
6. a kind of preparation method of carbonyl reduction enzyme mutant, it is characterised in that culture recombination expression as claimed in claim 5
Transformant, obtains carbonyl reduction enzyme mutant from culture.
7. carbonyl reduction enzyme mutant as claimed in claim 1 prepares optics in the latent chiral carbonyl compounds asymmetric reduction of catalysis
Application in active (S)-chiral, secondary alcohols.
8. application as claimed in claim 7, it is characterised in that the carbonyl reduction enzyme mutant is with carbonyl reduction enzyme mutant
Albumen, or the transformant resting cell form comprising carbonyl reduction enzyme mutant is used.
9. application as claimed in claim 7, it is characterised in that described latent chiral carbonyl compounds are the chloro- 3- carbonyls fourths of 4-
Acetoacetic ester, the heptanone of 2,3- bis-, 1- phenyl -1,2- propanedione or 2- methyl -2- heptene -6- ketone.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611203762.7A CN106754775B (en) | 2016-12-23 | 2016-12-23 | A kind of carbonyl reduction enzyme mutant and its gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611203762.7A CN106754775B (en) | 2016-12-23 | 2016-12-23 | A kind of carbonyl reduction enzyme mutant and its gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106754775A true CN106754775A (en) | 2017-05-31 |
| CN106754775B CN106754775B (en) | 2019-08-20 |
Family
ID=58900171
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611203762.7A Active CN106754775B (en) | 2016-12-23 | 2016-12-23 | A kind of carbonyl reduction enzyme mutant and its gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106754775B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852592A (en) * | 2019-01-14 | 2019-06-07 | 中国科学院成都生物研究所 | The carbonyl reduction enzyme mutant that heat resistance improves |
| CN110004119A (en) * | 2019-04-18 | 2019-07-12 | 华东理工大学 | ε -one ester reduction enzyme mutant and its application for catalyzing and synthesizing (R)-alpha-lipoic acid precursor |
| CN113423827A (en) * | 2019-02-08 | 2021-09-21 | 赛诺菲 | Biotechnological optimization of microorganisms for 1, 2-dehydrogenation of steroids |
| CN113652408A (en) * | 2021-09-01 | 2021-11-16 | 华东理工大学 | Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyric acid ethyl ester |
| CN113652407A (en) * | 2021-07-09 | 2021-11-16 | 浙江工业大学 | Carbonyl reductase mutant and application thereof in asymmetric synthesis of bi-chiral compound |
| CN114525264A (en) * | 2020-11-23 | 2022-05-24 | 台州华酶生物科技有限公司 | High-activity carbonyl reductase mutant and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102341501A (en) * | 2009-03-05 | 2012-02-01 | Iep有限责任公司 | Method for stereoselectively and enzymatically reducing keto compounds |
| CN103923889A (en) * | 2014-05-04 | 2014-07-16 | 中国药科大学 | Hyacinthin reductase mutant |
| CN104099305A (en) * | 2014-07-18 | 2014-10-15 | 华东理工大学 | Carbonyl reductase mutant as well as gene and application thereof |
-
2016
- 2016-12-23 CN CN201611203762.7A patent/CN106754775B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102341501A (en) * | 2009-03-05 | 2012-02-01 | Iep有限责任公司 | Method for stereoselectively and enzymatically reducing keto compounds |
| CN103923889A (en) * | 2014-05-04 | 2014-07-16 | 中国药科大学 | Hyacinthin reductase mutant |
| CN104099305A (en) * | 2014-07-18 | 2014-10-15 | 华东理工大学 | Carbonyl reductase mutant as well as gene and application thereof |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109852592A (en) * | 2019-01-14 | 2019-06-07 | 中国科学院成都生物研究所 | The carbonyl reduction enzyme mutant that heat resistance improves |
| CN109852592B (en) * | 2019-01-14 | 2022-05-31 | 中国科学院成都生物研究所 | Carbonyl reductase mutant with improved heat resistance |
| CN113423827A (en) * | 2019-02-08 | 2021-09-21 | 赛诺菲 | Biotechnological optimization of microorganisms for 1, 2-dehydrogenation of steroids |
| CN110004119A (en) * | 2019-04-18 | 2019-07-12 | 华东理工大学 | ε -one ester reduction enzyme mutant and its application for catalyzing and synthesizing (R)-alpha-lipoic acid precursor |
| CN114525264A (en) * | 2020-11-23 | 2022-05-24 | 台州华酶生物科技有限公司 | High-activity carbonyl reductase mutant and application thereof |
| CN114525264B (en) * | 2020-11-23 | 2023-07-28 | 江苏美科生物科技有限公司 | High-activity carbonyl reductase mutant and application thereof |
| CN113652407A (en) * | 2021-07-09 | 2021-11-16 | 浙江工业大学 | Carbonyl reductase mutant and application thereof in asymmetric synthesis of bi-chiral compound |
| CN113652407B (en) * | 2021-07-09 | 2024-01-16 | 浙江工业大学 | Carbonyl reductase mutant and application thereof in asymmetric synthesis of chiral compound |
| CN113652408A (en) * | 2021-09-01 | 2021-11-16 | 华东理工大学 | Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyric acid ethyl ester |
| CN113652408B (en) * | 2021-09-01 | 2024-02-20 | 华东理工大学 | Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyrate ethyl ester |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106754775B (en) | 2019-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106754775B (en) | A kind of carbonyl reduction enzyme mutant and its gene and application | |
| CN108728421B (en) | Carbonyl reductase mutant and application thereof | |
| CN106929521B (en) | Aldehyde ketone reductase gene recombination co-expression vector, engineering bacterium and application thereof | |
| CN112430585B (en) | Esterase mutant and application thereof | |
| CN109055324B (en) | Improved ketoreductase and application thereof | |
| CN112746067B (en) | Lysine decarboxylase mutants for preparing D-ornithine | |
| CN110592035B (en) | Carbonyl reductase mutant, recombinant expression vector and application of carbonyl reductase mutant in production of chiral alcohol | |
| CN113444702B (en) | Enone reductase mutant and application thereof | |
| CN1351665A (en) | Sorbitol dehydrogenase, gene encoding this same and thereof | |
| CN114277020B (en) | Nitrilase mutant, engineering bacterium and application thereof | |
| CN114134127B (en) | Diaminobutyrate acetyltransferase mutants for synthesizing ectoin | |
| CN113061593B (en) | L-malate dehydrogenase mutant and application thereof | |
| CN115896081A (en) | Aspartase mutant and application thereof | |
| KR20190097250A (en) | Conversion of methylglyoxal to hydroxyacetone using a novel enzyme and its application | |
| CN110713990B (en) | Mutant protein of enoate reductase and application thereof | |
| CN106047826B (en) | Aldehyde dehydrogenase, its recombinant expression transformants and the application in the synthesis of statin precursor | |
| CN106282134A (en) | The preparation method of a kind of quinuclidone reductase KgQR and application in preparation (R)-3-quinuclidinol thereof | |
| CN110846288A (en) | Glutathione bifunctional enzyme mutant and application thereof | |
| CN114107236B (en) | Ketone reductase mutant | |
| WO2005123921A1 (en) | Novel glycerol dehydrogenase, gene therefor, and method of utilizing the same | |
| CN112410353A (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| CN113215122B (en) | Carbonyl reductase mutant and coding gene and application thereof | |
| KR101411920B1 (en) | A novel ribitol dehydrogenase and L-ribulose production using the said enzyme | |
| CN112646791B (en) | Mutant and construction method and application thereof | |
| CN109790554B (en) | Method for preparing elongated 2-keto acids and C5-C10 compounds thereof by genetic modification of metabolic pathways in microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |