CN103923889A - Hyacinthin reductase mutant - Google Patents
Hyacinthin reductase mutant Download PDFInfo
- Publication number
- CN103923889A CN103923889A CN201410185390.4A CN201410185390A CN103923889A CN 103923889 A CN103923889 A CN 103923889A CN 201410185390 A CN201410185390 A CN 201410185390A CN 103923889 A CN103923889 A CN 103923889A
- Authority
- CN
- China
- Prior art keywords
- mutant
- aldehyde reductase
- reductase enzyme
- phenylacetic aldehyde
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
- C12Y102/01—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
- C12Y102/01039—Phenylacetaldehyde dehydrogenase (1.2.1.39)
Abstract
The invention discloses a hyacinthin reductase mutant with enhanced catalytic activity. The amino acid sequence of the hyacinthin reductase mutant is as shown in SEQ ID: 4, 6 or 8. The obtained mutants Leu102Phe, Leu102Arg and Leu102Glu are enhanced in activity and more suitable for the application in biochemical industry. According to the hyacinthin reductase mutant, the activity of the improved hyacinthin reductase mutants Leu102Phe, Leu102Arg and Leu102Glu is enhanced at different degrees, the activity of catalyzing the reduction of hypnone is 1.41, 1.41 and 1.21 times that of a wild type hyacinthin reductase, and the activity of catalyzing the oxidation of isopropanol is 1.54, 1.6 and 1.12 times that of the wild type hyacinthin reductase.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of synthetic phenylacetic aldehyde reductase enzyme of biological catalyst catalysis chiral alcohol (Phenyacetaldehyde Reductase, PAR) mutant that can be used as.
Background technology
Chiral alcohol (Chiral Alcohols) is the important synthetic intermediate of a class, and it is widely used in the synthetic of fine chemistry, agricultural chemicals, liquid crystal material, and especially chiral drug is synthetic.Taking chirality alpha-chloro aromatic alcohol as example, the chirality alpha-chloro aromatic alcohol of single optical activity has been used to synthetic a series of bioactive medicines that have, as antidepressant drug, antidiabetic medicine, beta receptor agonist etc.
Utilizing the asymmetric reduction of carbonyl reduction enzyme catalysis prochiral ketones carbonyl is the common methods of preparing chiral alcohol, and the method is paid close attention to widely because of advantages such as high-level efficiency, highly-solid selectively, reaction conditions gentleness, environmental protection.But because the substrate in application process is common and natural substrate has larger difference, most aldehyde ketone carbonyl reduction enzyme substrates spectrum vigor narrow or that some important chiral alcohols of catalysis are synthetic is lower.Taking phenylacetic aldehyde reductase enzyme as example, 35% (Appl.Environ.Microbiol., 1997,63 (10): 3783-3788) that the vigor of its catalysis methyl phenyl ketone reduction only reduces for catalysis phenylacetic aldehyde.Lower catalytic activity can reduce speed, productive rate and the ultimate capacity of reaction, and the while is along with the activity of the extending enzyme in reaction times can further reduce even inactivation.
Thereby utilizing the protein engineerings such as rite-directed mutagenesis is enzyme to be transformed to the effective means of the mutant that obtains character improvement.To two kinds of means of the general use of the transformation of enzyme, a kind of is the orthogenesis that carries out random mutation, and another kind is the rationality transformation of carrying out rite-directed mutagenesis.Orthogenesis is the structure and function information in the case of there is no enough enzymes, enzyme to be entered to row stochastic sudden change to set up mutant library, then obtains by large-scale screening the mutant that character is improved.Such as Andre etc. are to having carried out random mutation in several rings district in the carbonyl reductase subunit-subunit interaction region that derives from Candida parapsilosis, 1.4 times of (J.Biotechnol. that the mutant vigor containing the sudden change of A275S/L276Q two point obtaining by screening is wild-type, 2013,165 (1): 52-62).Rationality transformation is on the basis of the relation of structure and function, and the critical sites that can affect function is carried out to rite-directed mutagenesis, thereby realizes accurate transformation.As carried out rite-directed mutagenesis at Karla etc. to deriving from the basis of alcohol dehydrogenase reductase enzyme (TeSADH) structural models of Thermoanaerobacter ethanolicus, the W110A mutant obtaining can catalysis aromatic ketone asymmetric reduction generate corresponding chiral alcohol, and the TeSADH of wild-type can not catalysis aromatic ketone reduction (Protein Eng., Des.Sel., 2007,20 (2): 47-55).
Aspect raising carbonyl reductase enzyme activity, obtaining some progress although enzyme is transformed, successfully example also seldom, especially passes through the rationality transformation of rite-directed mutagenesis at present.Along with the parsing of increasing carbonyl reductase crystalline structure, it is the study hotspot in the biological asymmetric synthesis of chiral alcohol field that the rationality transformation based on structure and function will continue.
Summary of the invention
The present invention is directed to prior art deficiency, the phenylacetic aldehyde reductase enzyme mutant that provides a kind of catalytic activity to improve, its aminoacid sequence is if its aminoacid sequence is as shown in SEQ ID NO:4,6 or 8.
There is the sudden change of following any one situation in the amino acid that above-mentioned phenylacetic aldehyde reductase enzyme mutant is phenylacetic aldehyde reductase enzyme:
(1) in the aminoacid sequence of phenylacetic aldehyde reductase enzyme, the 102nd leucine sports phenylalanine;
(2) in the aminoacid sequence of phenylacetic aldehyde reductase enzyme, the 102nd leucine sports arginine;
(3) in the aminoacid sequence of phenylacetic aldehyde reductase enzyme, the 102nd leucine sports L-glutamic acid;
Wherein, the aminoacid sequence of described phenylacetic aldehyde reductase enzyme is as shown in SEQ ID NO:2, and gene order is as shown in SEQ ID NO:1.
Above-mentioned phenylacetic aldehyde reductase enzyme mutant can be used as synthetic for chipal compounds of catalyzer, and described chipal compounds is (R)-alpha-chloro phenylethyl alcohol or (R)-4-chloro-3-hydroxyl ethyl butyrate preferably.
The present invention also provides the gene of the above-mentioned phenylacetic aldehyde reductase enzyme mutant of encoding, and its nucleotide sequence sequence is as shown in SEQ IDNO:3,5 or 7.
The present invention also provides a kind of method of the genetic engineering bacterium that builds above-mentioned phenylacetic aldehyde reductase enzyme mutant, specifically comprises the steps:
1) adopt chemosynthesis or PCR method to obtain the gene of the described phenylacetic aldehyde reductase enzyme mutant of coding;
2) by step 1) the phenylacetic aldehyde reductase enzyme mutant gene that obtains is connected to prokaryotic expression carrier, obtains recombinant expression vector, and the expression vector having adopted in the present invention is pET-22b (+), also can select ...
3) by step 2) obtain recombinant expression vector Transformed E .coli BL21 (DE3) obtain genetic engineering bacterium.
Another problem that the present invention will solve is to provide a kind of method of applying said gene engineering bacterium fermentation production phenylacetic aldehyde reductase enzyme and mutant thereof, the product phenylacetic aldehyde reductase enzyme obtaining taking structure and the genetic engineering bacterium of mutant thereof are as producing bacterial strain, bacterial strain is inoculated into minimum medium after seed activation, under 37 DEG C, 220rpm condition, cultivates; In the time that OD value is 2-3, bacterial strain is proceeded to the generation of fermention medium induced protein.The inductor of the use in Induction Process is IPTG, and the concentration of inductor is 0.05-0.5mM.
Described minimum medium is LB substratum (1L): Tryptones 10g, yeast extract 5g, sodium-chlor 10g.
Described fermention medium consists of (1L): Tryptones 10g, yeast extract 5g, sodium-chlor 5g, zinc chloride 0.1g, glycerine 5mL.
The present invention adopts site-directed mutagenesis technique that phenylacetic aldehyde reductase gene is carried out to rite-directed mutagenesis, after being connected to prokaryotic expression carrier pET-22b (+), clone is converted into E.coliBL21 (DE3), purified checking obtains the recombination bacillus coli of the phenylacetic aldehyde reductase enzyme mutant that can produce better catalytic activity, and the catalysis activity that obtains phenylacetic aldehyde reductase enzyme mutant is 1.2-2.7 times of wild-type phenylacetic aldehyde reductase enzyme.This application for phenylacetic aldehyde reductase enzyme provides good basis.
Brief description of the drawings
Fig. 1 is the PCR product agarose electrophoresis figure of phenylacetic aldehyde reductase enzyme mutant upstream and downstream gene fragment in embodiment 2, M:DNA Marker, swimming lane 1～4:L102F mutant upstream and downstream gene fragment, swimming lane 6～9:L102R mutant upstream and downstream gene fragment, swimming lane 10～13:L102E mutant upstream and downstream gene fragment.
Fig. 2 is the overlapping PCR product of phenylacetic aldehyde reductase enzyme mutant gene agarose electrophoresis figure in embodiment 2, M:DNA Marker, swimming lane 1:L102F mutant gene, swimming lane 2:L102R mutant gene, swimming lane 3:L102E mutant gene.
Fig. 3 is the SDS-PAGE electrophoretic analysis of phenylacetic aldehyde reductase enzyme mutant purifying situation in embodiment 4, swimming lane 1: phenylacetic aldehyde reductase enzyme, swimming lane 2:L102F mutant, swimming lane 3:L102R mutant, swimming lane 4:L102E mutant.
Embodiment
According to following embodiment, the present invention can be described better.But professional easily understands, the described concrete material proportion of embodiment, processing condition and result thereof etc. are only for the present invention is described, and should not limit the present invention.
Embodiment 1: the structure of phenylacetic aldehyde reductase gene and recombinant expression vector.
According to the gene order of phenylacetic aldehyde reductase enzyme (SEQ NO:1), adopt the method for chemosynthesis to obtain the gene order of wild-type phenylacetic aldehyde reductase enzyme, the phenylacetic aldehyde reductase gene obtaining is connected to pET-22b (+) carrier (being purchased from Novogen company), obtains recombinant expression vector pET-PAR.
Embodiment 2: the structure of phenylacetic aldehyde reductase enzyme mutant gene
The present invention adopts the method for overlapping PCR to carry out amino acid substitution to the leucine of the 102nd of phenylacetic aldehyde reductase enzyme the, first utilize respectively taking pET-PAR as template containing primer and the full length sequence upstream and downstream primer in mutational site and obtain mutant upstream and downstream gene order by pcr amplification reaction, then mutant upstream and downstream primer obtains total length mutant gene sequence by overlapping PCR.Design of primers is as follows:
Full-length gene order primer (restriction enzyme site is marked by underscore, 5 '-3 '):
FL-F：
CATATGAAGGCGATCCAGTACACG?SEQ?NO：9
FL-R：
CTCGAGCAGACCAGGGACCAC?SEQ?NO：10
Rite-directed mutagenesis primer (mutational site is marked by underscore, 5 '-3 '):
Leu102Phe
L102F-F：ATAGTTCTC
TTCTCCTTGTGAGC?SEQ?NO：11
L102F-R：GCTCACAAGGA
GAAGAGAACTATT?SEQ?NO：12
Leu102Arg
L102R-F：ATAGTTCTC
CGCTCCTTGTGAGC?SEQ?NO：13
L102R-R：GCTCACAAGGA
GCGGAGAACTATT?SEQ?NO：14
Leu102Glu
L102E-F：ATAGTTCTC
GAATCCTTGTGAGC?SEQ?NO：15
L102E-R：GCTCACAAGGA
TTCGAGAACTATT?SEQ?NO：16
1. the acquisition of mutant gene upstream and downstream fragment
PCR reaction conditions: 94 DEG C of 4min; 94 DEG C of 1min, 65 DEG C of 1min, 72 DEG C of 1min, carry out 25 circulations; 72 DEG C of 10min.
PCR reaction system:
1) upstream fragment: cumulative volume is 25 μ L, wherein ExTaq HS archaeal dna polymerase 0.5U, 10 × ExTaq HS damping fluid, 2.5 μ L, pET-PAR (plasmid template, about 30ng/ μ L) 1 μ L, FL-F (forward primer, 25mM) 1 μ L, rite-directed mutagenesis primer upstream primer is as L102F-F (reverse primer, 25mM) 1 μ L, dNTPs mixture 1 μ L, mends ddH2O to 25 μ L.
2) downstream fragment: cumulative volume is 25 μ L, wherein ExTaq HS archaeal dna polymerase 0.5U, 10 × ExTaq HS damping fluid, 2.5 μ L, pET-PAR (plasmid template, about 30ng/ μ L) 1 μ L, rite-directed mutagenesis primer downstream primer is as L102F-R (forward primer, 25mM) 1 μ L, FL-R (reverse primer, 25mM) 1 μ L, dNTPs mixture 1 μ L, mends ddH2O to 25 μ L.
The agarose gel electrophoresis that reaction finishes rear use 1% reclaims object fragment (306bp and 744bp, Fig. 1).
2. the acquisition of mutant full-length gene
PCR reaction conditions: 94 DEG C of 4min; 94 DEG C of 1min, 65 DEG C of 1min, 72 DEG C of 1min, carry out 5 circulations; 72 DEG C of 10min.
PCR reaction system: cumulative volume is 25 μ L, wherein ExTaq HS archaeal dna polymerase 0.5U, 10 × ExTaq HS damping fluid, 2.5 μ L, mutant upstream fragment 1 μ L, mutant downstream fragment 1 μ L, dNTPs mixture 1 μ L, mends ddH2O to 25 μ L.
After finishing, reaction in reaction system, add respectively FL-F (25mM) and the each 1 μ L of FL-R (25mM) to increase to mutant full-length gene order.
PCR reaction conditions: 94 DEG C of 4min; 94 DEG C of 1min, 65 DEG C of 1min, 72 DEG C of 1min, carry out 25 circulations; 72 DEG C of 10min.
The agarose gel electrophoresis that reaction finishes rear use 1% carries out gel recovery to object fragment (1050bp, Fig. 2).
Embodiment 2: the structure of mutant recombinant expression vector
The above-mentioned mutant gene obtaining is connected to pMD-19-T carrier by enzyme ligation, obtains recombinant cloning vector T-L102F, T-L102R, T-L102E and T-L102R.The each 5 μ L of mutant recombinant cloning vector that obtain, mix respectively ice bath 30min, 42 DEG C of heat shock 1min30S, ice bath 2min with the E.coli DH5 α competent cell (being purchased from Beijing Tian Gen biotech firm) of 25 μ L; Add after 500 μ L LB substratum in 37 DEG C, 220rpm and cultivate 1h; Get the bacterium liquid approximately 50 μ L that cultivate after 1h and coat containing on the LB flat board of 40 μ g/mL penbritins, cultivate 12～16h for 37 DEG C, obtain recombinant bacterium (respectively containing T-L102F, T-L102R and T-L102E).
The above-mentioned recombinant bacterium list of picking bacterium colony is in containing in the LB substratum of 40 μ g/mL penbritins, extracts contained recombinant plasmid in 37 DEG C, 220rpm after cultivating 12～16h.
Use respectively NdeI and XhoI double digestion T-L102F, T-L102R, T-L102E and pET-22b (+), agarose gel electrophoresis with 1% carries out gel recovery to the mutant in double digestion product and expression vector fragment, connect glue with T4-DNA ligase enzyme and reclaim the each mutant and the expression vector fragment that obtain, obtain mutant recombinant expression vector pET-L102F, pET-L102R and pET-L102E.The each 5 μ L of mutant recombinant cloning vector that obtain, mix respectively ice bath 30min, 42 DEG C of heat shock 1min30S, ice bath 2min with E.coli BL21 (DE3) competent cell (being purchased from Beijing Tian Gen biotech firm) of 25 μ L; Add after 500 μ L LB substratum in 37 DEG C, 220rpm and cultivate 1h; Get the bacterium liquid approximately 50 μ L that cultivate after 1h and coat containing on the LB flat board of 40 μ g/mL penbritins, cultivate 12～16h for 37 DEG C, obtain mutant recombinant bacterium E.coli BL21 (respectively containing pET-L102F, pET-L102R and pET-L102E).
Embodiment 3: the expression of phenylacetic aldehyde reductase enzyme and mutant thereof
Picking recombinant bacterium E.coliBL21 (containing the recombinant expression plasmid of phenylacetic aldehyde reductase enzyme and mutant thereof) is in containing in the LB substratum of 40 μ g/mL penbritins, 37 DEG C, 220rpm overnight incubation.Then be forwarded to containing in the fresh fermention medium of 40 μ g/mL penbritins by 2% inoculum size, be cultured to OD in 37 DEG C, 220rpm
600be about at 0.6～1.0 o'clock and add 0.3mM IPTG to induce, inductive condition is 20 DEG C, 22rpm, and induction time is 20h.After finishing, abduction delivering in 4 DEG C, the centrifugal 15min of 4500g, add the resuspended thalline of potassium phosphate buffer (50mM, pH7.0) stand-by after abandoning supernatant.
Fermention medium consists of (1L): Tryptones 10g, yeast extract 5g, sodium-chlor 5g, zinc chloride 0.1g, glycerine 5mL.
Embodiment 4: the purifying of phenylacetic aldehyde reductase enzyme and mutant thereof
Adopt nickel ion metal chelate affinity chromatography to carry out purifying to phenylacetic aldehyde reductase enzyme and mutant thereof.After above-mentioned thalline after resuspended carries out high pressure fragmentation, bacterial cell disruption liquid is in the centrifugal 30min of 12000g, supernatant liquor is loaded on to the HisTrapTM FF post (GE Healthcare) of using above-mentioned potassium phosphate buffer balance good, utilize the full-automatic chromatograph of AKTA Purifier to carry out imidazole concentration stepwise elution, A pump is above-mentioned potassium phosphate buffer, B pump is the above-mentioned potassium phosphate buffer containing 500mM imidazoles, and elution requirement is flow velocity 1mL/min.After completion of the sample with 10 column volumes of 7%B wash-out, 15 column volumes of 7%-50%B wash-out, 10 column volumes of 50%-100%B wash-out.Be collected and carry out ultrafiltration and concentration and buffer-exchanged containing the sample of target protein mass peak.More than operation is all carried out at 4 DEG C.
The purifying situation of analyzing phenylacetic aldehyde reductase enzyme and mutant thereof with SDS-PAGE, the voltage that wherein gum concentration of SDS-PAGE is 12%, 90V carries out sample concentration, and the voltage of 130V carries out sample separation.SDS-PAGE result shows that phenylacetic aldehyde reductase enzyme and mutant thereof obtain electrophoretically pure protein example after purifying, and the molecular size range that electrophoretic band shows is 40kD left and right (Fig. 3).
Embodiment 5: the vitality test of phenylacetic aldehyde reductase enzyme and mutant catalytic reduction reaction thereof
The enzyme activity of phenylacetic aldehyde reductase enzyme and mutant thereof adopts optics coupling method to measure, and detects 340nM (ε=6,220M
-1cm
- 1) locate the minimizing of the variation monitoring NADH of absorbancy, thus the vigor of enzyme obtained according to the change calculations of NADH amount.The 1mL enzyme reaction system of living is: 3.0mM methyl phenyl ketone, 0.27mM NADH is dissolved in 50mM potassium phosphate buffer (pH7.0), adds after appropriate enzyme in 25 DEG C of reaction 1min.Unit enzyme (U) alive definition: 1min internal consumption 1 μ M NADH generates NAD
+needed enzyme amount.Protein concn adopts BCA method to measure.Experimental result is as shown in table 1.
The vigor of table 1 phenylacetic aldehyde reductase enzyme and the reduction of mutant catalysis methyl phenyl ketone thereof
| ? | PAR | L102F | L102R | L102E |
| Than vigor (μ mol/min/mg) | 2.71 | 3.81 | 3.81 | 3.31 |
Embodiment 6: the vitality test of phenylacetic aldehyde reductase enzyme and mutant catalytic oxidation thereof
The measuring method of the vigor of phenylacetic aldehyde reductase enzyme and mutant catalytic oxidation thereof is identical with embodiment 5 principles, but the NAD that the Virahol that substrate is 40% and the coenzyme that adds are 0.27mM
+, what 340nM place absorbancy changed correspondence is the increase of NADH.Unit enzyme (U) alive is defined as: 1min internal consumption 1 μ M NAD
+generate the needed enzyme amount of NADH.Experimental result is as shown in table 1.
The vigor of table 2 phenylacetic aldehyde reductase enzyme and mutant catalysis isopropanol oxidation thereof
| ? | PAR | L102F | L102R | L102E |
| Than vigor (μ mol/min/mg) | 1.21 | 1.86 | 1.94 | 1.36 |
Claims (10)
1. the phenylacetic aldehyde reductase enzyme mutant that catalytic activity improves, is characterized in that, its aminoacid sequence is as shown in SEQ ID NO:4,6 or 8.
2. phenylacetic aldehyde reductase enzyme mutant as claimed in claim 1 application in chipal compounds is synthetic as catalyzer.
3. application as claimed in claim 2, is characterized in that described chipal compounds is (R)-alpha-chloro phenylethyl alcohol or (R)-4-chloro-3-hydroxyl ethyl butyrate.
4. the gene of coding phenylacetic aldehyde reductase enzyme mutant claimed in claim 1, is characterized in that, its nucleotide sequence sequence is as shown in SEQ ID NO:3,5 or 7.
5. carry the recombinant expression vector of gene described in claim 4.
6. contain the engineering bacteria of recombinant expression vector as claimed in claim 5.
7. the method for genetic engineering bacterium described in structure claim 6, is characterized in that, specifically comprises the steps
Adopt the complete synthesis or PCR method clones coding gene of phenylacetic aldehyde reductase enzyme mutant as claimed in claim 4 of chemistry;
The mutant gene that step (1) is obtained is connected to prokaryotic expression carrier, obtains recombinant expression vector;
The recombinant expression vector that step (2) is obtained is converted into E.coli BL21 (DE3) and obtains genetic engineering bacterium.
8. method claimed in claim 7, is characterized in that, described expression vector is pET-22b (+).
9. application rights requires the method for the genetic engineering bacterium fermentative production phenylacetic aldehyde reductase enzyme mutant described in 6, it is characterized in that, genetic engineering bacterium is inoculated in fermention medium after the activation of LB substratum, under 37 DEG C, 220rpm condition, is cultured to OD
600value is 0.6～1.0 o'clock, adds the expression of IPTG induction phenylacetic aldehyde reductase enzyme mutant.
10. method according to claim 9, is characterized in that, in Induction Process, IPTG concentration maintains within the scope of 0.05～0.5mM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410185390.4A CN103923889A (en) | 2014-05-04 | 2014-05-04 | Hyacinthin reductase mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410185390.4A CN103923889A (en) | 2014-05-04 | 2014-05-04 | Hyacinthin reductase mutant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103923889A true CN103923889A (en) | 2014-07-16 |
Family
ID=51142289
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410185390.4A Pending CN103923889A (en) | 2014-05-04 | 2014-05-04 | Hyacinthin reductase mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103923889A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754775A (en) * | 2016-12-23 | 2017-05-31 | 华东理工大学 | A kind of carbonyl reduction enzyme mutant and its gene and application |
| CN109031011A (en) * | 2018-05-07 | 2018-12-18 | 浙江万里学院 | The open-circuit fault diagnostic method of multi-electrical level inverter based on phase voltage histogram |
-
2014
- 2014-05-04 CN CN201410185390.4A patent/CN103923889A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754775A (en) * | 2016-12-23 | 2017-05-31 | 华东理工大学 | A kind of carbonyl reduction enzyme mutant and its gene and application |
| CN106754775B (en) * | 2016-12-23 | 2019-08-20 | 华东理工大学 | A kind of carbonyl reduction enzyme mutant and its gene and application |
| CN109031011A (en) * | 2018-05-07 | 2018-12-18 | 浙江万里学院 | The open-circuit fault diagnostic method of multi-electrical level inverter based on phase voltage histogram |
| CN109031011B (en) * | 2018-05-07 | 2021-04-30 | 浙江万里学院 | Open-circuit fault diagnosis method of multi-level inverter based on phase voltage histogram |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105671010B (en) | A kind of aldehyde Ketoreductase mutant, gene, engineering bacteria and its application | |
| CN105331642B (en) | Method for catalytically producing α -ketoglutaric acid by using L-glutamic acid oxidase | |
| CN103710321B (en) | Nicotinamide mononucleotide adenylyltransferase (Nmnat) mutant as well as coding gene and application thereof | |
| CN102277338A (en) | Diketoreductase mutant and application thereof | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN104630243A (en) | Carbonyl reductase gene, enzyme, vector and engineering bacterium as well as application of carbonyl reductase gene in asymmetrically reducing prochiral carbonyl compounds | |
| CN105349503A (en) | Carbonyl reductase AcCR and encoding gene and application thereof | |
| CN104263742A (en) | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof | |
| CN106636020A (en) | Mutant short-chain dehydrogenase, recombinant expression vector, genetic engineering bacterium and application | |
| CN106520715B (en) | A kind of short-chain dehydrogenase and its gene, recombinant expression carrier, genetic engineering bacterium and its application in the synthesis of astaxanthin chiral intermediate | |
| Duan et al. | Replacing water and nutrients for ethanol production by ARTP derived biogas slurry tolerant Zymomonas mobilis strain | |
| CN104152506A (en) | Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system | |
| CN105238768A (en) | Short-chain dehydrogenase, gene of short-chain dehydrogenase, recombinant expression vector, genetically engineered bacterium and application | |
| CN107177607A (en) | Bacillus subtilis BS04 urate oxidase gene and application thereof | |
| CN105647844A (en) | Recombinant bacteria using xylose to produce glycollic acid and building method and application of recombinant bacteria | |
| CN103421823B (en) | Come from the short-chain dehydrogenase of Lei Fusong Salmonella, encoding gene, carrier, engineering bacteria and application | |
| CN105238807A (en) | Construction of coenzyme efficient regeneration system and application thereof | |
| CN111100832A (en) | Gene engineering bacterium for synthesizing pyruvic acid and D-alanine and construction method and application thereof | |
| CN104694524A (en) | Method for preparing glutamic acid decarboxylase mutant by utilizing ramachandran map information and mutant thereof | |
| CN103695443B (en) | A kind of Novel carbonyl reductase, its gene and application | |
| CN103923889A (en) | Hyacinthin reductase mutant | |
| CN109576238A (en) | A kind of recombination transaminase and its application in chiral β-amino alcohols is prepared in asymmetric amination α-hydroxyl ketone | |
| Rocha-Martin et al. | Purification, immobilization and stabilization of a highly enantioselective alcohol dehydrogenase from Thermus thermophilus HB27 cloned in E. coli | |
| CN105039361A (en) | Carbonyl reductase gene, codase, vector, strain and application of gene | |
| CN104877983B (en) | A kind of trehalose synthase mutant and its preparation and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140716 |
|
| WD01 | Invention patent application deemed withdrawn after publication |