CN104263742A - Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof - Google Patents
Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof Download PDFInfo
- Publication number
- CN104263742A CN104263742A CN201410436860.XA CN201410436860A CN104263742A CN 104263742 A CN104263742 A CN 104263742A CN 201410436860 A CN201410436860 A CN 201410436860A CN 104263742 A CN104263742 A CN 104263742A
- Authority
- CN
- China
- Prior art keywords
- carbonyl reductase
- damping fluid
- wet thallus
- consumption
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant carbonyl reductase derived from Burkholderia gladioli ZJB-12126 and a coding gene thereof, a recombinant vector containing the gene, a recombinant gene engineering bacterium converted from the recombinant vector and application in preparing the recombinant carbonyl reductase.2-benzoylaminomethyl-3-one butyrate, N,N-bis-methyl-3-one-3-(2-thienyl)propanamide, ethyl 4-chloroacetoacetate (COBE) and tert-butyl (R)-6-cyano-5-hydroxy-3-carbonylhexanoate used as substrates are subjected to biological catalytic reaction to prepare high-optical-purity (2S,3R)-2-benzamidomethyl-3-hydroxybutyrate, (S)-N,N-bis-methyl-3-hydroxy-3-(2-thienyl)propanamide, ethyl (S)-4-chloro-3-hydroxybutyrate and tert-butyl 6-cyano-(3R,5R)-dihydroxyhexanoate.
Description
(1) technical field
The present invention relates to that one derives from the carbonyl reductase gene of gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126, codase, the recombinant vectors containing this gene, this recombinant vectors transform the recombination engineering bacteria that obtains and preparing the application in chirality pharmaceutical intermediate compound.
(2) background technology
Carbonyl reductase (E.C.1.1.1.184) belongs to oxidation epoxidase family, and reaction needed coenzyme NAD (P) H participates in, and the dive letones asymmetric reduction of chirality of energy stereoselectivity catalysis becomes optics chiral alcohol intermediate.This fermentoid is distributed widely in occurring in nature, is all found in all kinds of animal, microorganism and plant.Wherein, because microbe species is various, distribution wide, be the main source of carbonyl reductase.From multiple-microorganism, find carbonyl reductase at present, as: Pichia finlandica, Clostridium ljungdahlii, Vibrio vulnificus, Candida glabrata, Serratia quinivorans, Polygonum minus, Arabidopsis thaliana, Oenococcus oeni, Serratia marcescens, Chryseobacterium sp., Rhodococcus erythropolis, Candida magnoliae, Lactobacillus jensenii and Lactobacillus coryniformis etc.In addition, from extreme microorganism, also found the carbonyl reductase addicted to extreme environment, as: Thermococcus sibiricus, Thermococcus guaymasensis, Haloferax volcanii, Thermus thermophilus, Sulfolobus acidocaldarius, Carboxydothermus hydrogenoformans, Thermococcus kodakarensis, Thermotoga maritime, Koliella Antarctica, Pyrobaculum calidifontis and Halobacterium sp. etc.
In recent years, along with developing rapidly of genomics, proteomics and information biology, gene excavating technology clone novel carbonyl reductase is utilized to become a kind of important means.A large amount of carbonyl reductase that at present utilized this technology to clone.Wherein the gene of part carbonyl reductase is expressed in different host'ss (intestinal bacteria, pichia spp etc.), obtains and produces enzyme activity and the higher genetic engineering bacterium of selectivity, and be applied to asymmetric reduction carbonyl complex.However, the substrate spectrum of many carbonyl reduction enzyme catalysiss is narrower, is the suitableeest biological catalyst of specific reaction screening often, therefore greatly limit its range of application.In addition, the catalytic efficiency of many enzymes is lower, also limit its industrial applications.Screening has the Novel carbonyl reductase of wider substrate spectrum, and studying it can the chirality pharmaceutical intermediate compound of efficient highly selective catalysis, not only can widening its range of application, promote its application potential, also laying the foundation for realizing suitability for industrialized production.
(2S, 3R)-2-benzoyl aminomethyl-3-hydroxybutyrate ester is the crucial chiral intermediate of synthesis penem-like pharmaceutical intermediate 4-AA (4AA).Current acquisition (2S, the main path of 3R)-2-benzoyl aminomethyl-3-hydroxybutyrate ester intermediate generates (2S, 3R)-2-benzoyl aminomethyl-3-hydroxybutyrate ester with chiral catalyst (R)-BINAP-Ru asymmetry catalysis 2-benzoyl aminomethyl-3-ketone butyric ester.But due to its severe reaction conditions, be unfavorable for its suitability for industrialized production.Biological catalysis synthesis (2S, 3R)-2-benzoyl aminomethyl-3-hydroxybutyrate ester report is less, and most product forming mix-configuration.Saccharomycopsis malanga NBRC 171096 catalysis generates (2S, 3R) single configuration, and there is higher enantioselectivity (enantiomeric excess value ee>96.2%) and cis-selectivity (diastereomeric excess value de>92.2%), but catalytic efficiency low (productive rate only 4%).US Patent No. 20130034895 have studied the carbonyl reduction Enzyme catalyzed synthesis (2S deriving from Lactobacillus kefir, 3R)-2-benzoyl aminomethyl-3-hydroxybutyrate ester, there is higher enantioselectivity (ee is 60-99%), but have no the report of its cis-selectivity.
Duloxetine (glad hundred reach, Cymbalta) is a kind of serotonin and NRI (SNRIs), is developed by Eli Lilly company of the U.S..It contains a chiral centre, and only the enantiomorph of (S) configuration has pharmaceutical activity.(S) two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of-N, N-is the crucial chiral intermediate in duloxetine building-up process.Two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of current acquisition (S)-N, N-is also mainly by transition metal chiral ligand catalytic hydrogenation approach.Microbial method asymmetric reduction synthesis (S)-N, N-two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide report is less.Pankaj etc. report candida tropicalis (Candida tropicalis MTCC-5158) and Candida viswanathii bacterium (Candida viswanathii) catalytic substrate N, two methyl-3-ketone-3-(2-thienyl) the propionic acid amide synthesis of N-(S)-N, two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N-, transformation efficiency >80%, ee>99%.Domestic patent CN102925368, CN 103013898 and CN103421854 discloses carbonyl reductase asymmetric reduction preparation (S)-N that ball is satisfied in muscardine (Beauver iabassiana) and kluyveromyces marxianus (Kluyveromyce marxianus), two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N-, concentration of substrate can reach 30g/L, transformation efficiency >80%, ee>99%.US Patent No. 20130177962 discloses and utilizes ketoreductase (KRED) to produce (S)-N, the method of two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N-, concentration of substrate can reach 100g/L, but this technique needs strict temperature control and reaction controlling, and adding Virahol, by product acetone is difficult to remove.
(S)-4-chloro-3-hydroxyl ethyl butyrate and 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester are the side chain chiral intermediates of HMG-CoA enzyme inhibitors Stains medicine.The research of biological process asymmetric reduction synthesis (S)-4-chloro-3-hydroxyl ethyl butyrate is comparatively ripe, the enzyme related to is also more, the bacterial strain with higher selectivity and activity has: Geotrichum candidum, Pichia stipitis, Candida albicans, Streptomyces coelicolor and Candida parapsilosis ATCC 7330.Concentration of substrate during a kind of carbonyl reductase catalytic production (the S)-4-chloro-3-hydroxyl ethyl butyrate be wherein cloned into from Candida parapsilosis ATCC 7330 reaches as high as 3000mM, productive rate >99.0%, ee>99.9%.In addition, Codexis house journal US7807423B2 discloses a series of ketoreductase, catalytic production (S)-4-chloro-3-hydroxyl ethyl butyrate, ee>99%.6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester is the another kind of chiral intermediate of atorvastatin, current highly-solid selectively catalysis (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester generates 6-cyano group-(3R, the bacterial strain of 5R)-dihydroxyl hecanoic acid t-butyl ester has: Saccharomyces cerevisiae, Pichia angusta, Pichia haplophila, Beauveria bassiana, Pichia pastoris, Pichia membranefaciens, Candida humicola, Kluyveromyces drosophilarum, Rhodotorula glutinis and Pichia caribbic etc.Codexis house journal US7879585B2 has cloned a kind of ketoreductase and has transformed from Saccharomyces cerevisiae, catalytic production 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester transformation efficiency is 85%, de>99%.
As can be seen here, the biocatalysis technique studying these medicine chiral intermediates is significant, can not only provide new route for the synthesis of these compounds, can provide new enzyme source again for it.Up to now, the application of carbonyl reductase in these medicine chiral intermediate asymmetric reductions in Burkholderia gladioli bacterial strain is had not yet to see.
(3) summary of the invention
The object of the invention is to provide one and derives from gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126 carbonyl reductase gene, codase, recombinant vectors containing this gene, this recombinant vectors transforms the recombination engineering bacteria obtained, and at preparation (2S, 3R)-2-benzoyl aminomethyl-3-hydroxybutyrate ester, (S)-N, two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N-, (S)-4-chloro-3-hydroxyl ethyl butyrate and 6-cyano group-(3R, application in the chirality pharmaceutical intermediate compounds such as 5R)-dihydroxyl hecanoic acid t-butyl ester.
The technical solution used in the present invention is:
The invention provides the carbonyl reductase gene that one derives from gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126, the nucleotides sequence of described gene is classified as shown in SEQ ID NO:1, and described carbonyl reductase gene obtains by the following method:
Utilize round pcr, be that template clone is about the carbonyl reductase gene order of 0.8kb, called after adh2 with the total genomic dna derived from gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126 bacterial strain under the effect of primer 1 (ATGAGCAAGCGGCTGGAAGGCAAGG), primer 2 (TCAGACCTGGGCCTGGCCGCC).This fragment is connected on pMD18-T carrier, obtains cloning vector pMD18-T-adh2, vector intestinal bacteria are obtained the recombination bacillus coli containing carrier pMD18-T-adh2.To recombinant plasmid order-checking, and utilize software to analyze sequencing result, this sequence contains the open reading frame of a long 756bp.
The present invention express primer 3 (
cATATGaGCAAGCGGCTGGAAGG CAAGG) and primer 4 (
cTCGAGtCAGACCTGGGCCTGGCCGCCG), restriction enzyme site is respectively Nde I and Xho I (underscore), with cloning vector pMD18-T-adh2 for template, obtains the carbonyl reductase gene for expressing by pcr amplification.
Any the nucleotide sequence that the replacement of one or more Nucleotide, insertion or disappearance process obtain is carried out to nucleotide sequence shown in SEQ ID NO:1, as long as itself and this Nucleotide has the homology of more than 90%, all belong to protection scope of the present invention.
The invention provides a kind of restructuring carbonyl reductase of being encoded by described carbonyl reductase gene adh 2, called after BgADH2, the aminoacid sequence of described restructuring carbonyl reductase is for shown in SEQ ID NO:2.
The polypeptide fragment that any process of inserting amino acid in aminoacid sequence shown in SEQ ID NO:2, lack or replacing obtains or its mutant; as long as aminoacid sequence has more than 95% homology shown in itself and SEQ ID NO:2, all belong to protection scope of the present invention.
The present invention relates to the recombinant vectors containing described carbonyl reductase gene.
The present invention relates to and utilize described recombinant vectors to transform the recombination engineering bacteria obtained, be specially: carbonyl reductase gene is connected with expression vector pET28a, construct the heterogenous expression recombinant plasmid pET28a-adh2 containing carbonyl reductase gene.Recombinant expression pET28a-adh2 is converted in E. coli BL21 (DE3), obtains recombination bacillus coli BL21 (the DE3)/pET28a-adh2 containing recombinant plasmid pET28a-adh2.
The invention still further relates to the application of carbonyl reductase gene in preparation restructuring carbonyl reductase, be specially: build the recombinant vectors containing described carbonyl reductase gene, shown recombinant vectors is converted in intestinal bacteria (preferred E.coli BL21 (DE3)), the recombination engineering bacteria obtained carries out inducing culture, nutrient solution is separated the somatic cells obtained containing restructuring carbonyl reductase, the carbonyl reductase crude enzyme liquid obtained after broken carries out purifying, obtains the pure enzyme of carbonyl reductase.
The invention still further relates to described restructuring carbonyl reductase and prepare the application in medicine chiral intermediate, describedly to be applied as: the wet thallus obtained through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene is for catalyzer, be in the damping fluid of 6 ~ 10 in pH value, add substrate, cosubstrate and NAD (P)
+, 20 ~ 40 DEG C, reaction under 50 ~ 250rpm condition (preferably 30 DEG C, 150r/min under react 2h), after reacting completely, obtain the mixed solution of drug containing chiral intermediate; After reaction terminates, mixed solution is extracted with ethyl acetate twice, merges organic layer and with anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, obtains medicine chiral intermediate after drying; Described substrate is the one in 2-benzoyl aminomethyl-3-ketone butyric ester, N, N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide, 4-chloroacetyl acetacetic ester and (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester; Described cosubstrate is glucose, ammonium formiate, Virahol or dehydrated alcohol, preferred glucose, when described cosubstrate is glucose, adds Hexose phosphate dehydrogenase and forms cosubstrate system, when described cosubstrate is ammonium formiate, adds hydrogenlyase and form cosubstrate system; The consumption of described catalyzer counts 20-200g/L damping fluid (preferred 50g/L) with wet thallus weight, the starting point concentration of described substrate is 10-100mmol/L damping fluid (preferred 20mmol/L), the consumption of described cosubstrate is 10-200g/L damping fluid (preferred 50g/L), described NAD (P)
+consumption be 0.01-5mmol/L damping fluid (preferred 2mmol/L), described glucose takes off the wet thallus weighing scale that desaturase or formate dehydrogenase enzyme dosage obtain through fermentation culture to take off desaturase or hydrogenlyase thalline containing glucose, is 20-200g/L damping fluid (preferred 50g/L).Described substrate 2-benzoyl aminomethyl-3-ketone butyric ester adds (i.e. 2-benzoyl aminomethyl-3-ketone butyric ester dimethyl sulfoxide (DMSO) be mixed with 400mmol/L solution) with the form of 400mmol/L DMSO solution.
Further, the wet thallus that the engineering bacteria containing restructuring carbonyl reductase gene of the present invention obtains through fermentation culture is prepared as follows: the engineering bacteria containing restructuring carbonyl reductase gene is seeded to the LB liquid nutrient medium containing final concentration 50 μ g/mL kalamycin resistance, 37 DEG C, 12h is cultivated under 200rpm, be seeded to fresh in the LB liquid nutrient medium of final concentration 50 μ g/mL kalamycin resistance again with volumetric concentration 1% inoculum size, in 37 DEG C, under 150rpm, be cultured to thalline OD
600reach 0.6-0.8, add the IPTG that final concentration is 0.1mM, at 28 DEG C after inducing culture 12h, 4 DEG C, the centrifugal 5min of 5000rpm, abandoning supernatant, collects wet thallus.
Desaturase wet thallus of the present invention is prepared as follows: (will preferably derive from the GDH of Exiguobacterium sibiricum 255-15 containing Hexose phosphate dehydrogenase (GDH), GenBank:ACB59697.1) recombinant bacterium BL21 (DE3)/pET28b-gdh or (preferably derive from the FDH of Candida boidinii containing hydrogenlyase (FDH), GenBank:AF004096) recombinant bacterium BL21 (DE3)/pET28b-fdh is seeded to the LB liquid nutrient medium containing final concentration 50 μ g/mL kalamycin resistance, 37 DEG C, 12h is cultivated under 200rpm, be seeded to fresh in the LB liquid nutrient medium of final concentration 50 μ g/mL kalamycin resistance again with 1% inoculum size (v/v), in 37 DEG C, thalline OD is cultured under 150rpm
600reach 0.6-0.8, add the IPTG that final concentration is 0.1mM, at 28 DEG C after inducing culture 12h, 4 DEG C, the centrifugal 5min of 5000rpm, abandoning supernatant, collecting precipitation, namely obtains desaturase wet thallus.
Further, the wet thallus that preferably described reaction obtains through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene, for catalyzer, is in the damping fluid of 6 ~ 10 in pH value, adds substrate, glucose, Hexose phosphate dehydrogenase and NAD (P)
+, 30 DEG C, react under 150rpm condition, after reacting completely, obtain the mixed solution of drug containing chiral intermediate; Described substrate is the one in 2-benzoyl aminomethyl-3-ketone butyric ester, N, N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide, 4-chloroacetyl acetacetic ester and (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester; The consumption of described catalyzer counts 50g/L damping fluid with the weight of wet thallus, the starting point concentration of described substrate is 20mmol/L damping fluid, the consumption of described cosubstrate is 50g/L damping fluid, the consumption of described Hexose phosphate dehydrogenase is with the wet thallus weighing scale obtained through fermentation culture containing the thalline of Hexose phosphate dehydrogenase, for 50g/L damping fluid, described NAD (P)
+consumption be 2mmol/L damping fluid.
Further, carbonyl reductase BgADH2 containing described carbonyl reductase gene of the present invention generates (2S as biological catalyst at conversion of substrate 2-benzoyl aminomethyl-3-ketone butyric ester (formula I), application in 3R)-2-benzamide methyl-3-hydroxybutyrate ester (formula II), in formula I, R is the alkyl of C1-C6, and the reaction formula related to as shown in Figure 6.
Particularly, the reaction system of above-mentioned application is: with phosphate buffered saline buffer (100mM, pH 7.0) be reaction medium, the wet thallus obtained through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene is for catalyzer, add Hexose phosphate dehydrogenase, 2-benzoyl aminomethyl-3-ketone butyric ester, NADP
+and glucose, 30 DEG C, rotating speed 150r/min Water Under bath shaking table reaction 2h, after reaction terminates, reaction solution equal-volume extraction into ethyl acetate twice, merge organic layer and with anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, obtain enriched material, drying, is (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester; Described substrate adds with the form of 400mmol/L DMSO solution, the final concentration 20mmol/L damping fluid of substrate, NADP
+consumption is 2mmol/L damping fluid, and glucose consumption is 50g/L damping fluid, and wet thallus consumption is 50g/L damping fluid.
Further, when described substrate is N, N-pair of methyl-3-ketone-3-(2-thienyl) propionic acid amide, its reaction formula as shown in Figure 7.
Particularly, the reaction system of above-mentioned application is: the wet thallus obtained through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene is for catalyzer, with potassium phosphate buffer (pH 8.0) for reaction medium, add Hexose phosphate dehydrogenase, glucose, NADP
+substrate N, two methyl-3-ketone-3-(2-thienyl) propionic acid amide (formula III) of N-, 30 DEG C, 2h is reacted under rotating speed 150r/min condition, after reaction terminates, reaction solution adds the 6M NaOH aqueous solution and adjusts pH to 11.0, then adds equal-volume extraction into ethyl acetate twice, merges organic layer and uses anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, obtains enriched material, dry, be two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide (formula IV) of (S)-N, N-; Described restructuring carbonyl reductase wet thallus consumption 50g/L damping fluid, glucose dehydro enzyme dosage count 50g/L damping fluid, glucose consumption for 50g/L damping fluid, NADP with Hexose phosphate dehydrogenase wet thallus weight
+consumption is 2mmol/L damping fluid, concentration of substrate 20mmol/L damping fluid.
Further, when described substrate is 4-chloroacetyl acetacetic ester, its reaction formula as shown in Figure 8.
Particularly, the reaction system of above-mentioned application is: the wet thallus obtained through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene, for catalyzer, for reaction medium, adds Hexose phosphate dehydrogenase with potassium phosphate buffer (pH 7.0), glucose, NADP
+substrate 4-chloroacetyl acetacetic ester (4-chloroacetoacetate ethyl, COBE) (formula V), 30 DEG C, 2h is reacted under rotating speed 150r/min condition, after reaction terminates, reaction solution adds equal-volume extraction into ethyl acetate twice, merges organic layer and uses anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, enriched material is dry, is (S)-4-chloro-3-hydroxyl ethyl butyrate (CHBE) (formula VI); Described restructuring carbonyl reductase wet thallus consumption 50g/L damping fluid, glucose dehydro enzyme dosage count 50g/L damping fluid with Hexose phosphate dehydrogenase wet thallus weight, and glucose consumption is 50g/L damping fluid, NADP
+consumption is 2mmol/L damping fluid, concentration of substrate 20mmol/L damping fluid.
Further, when described substrate is (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, its reaction formula as shown in Figure 9.
Particularly, the reaction system of above-mentioned application is: the wet thallus obtained through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene, for catalyzer, for reaction medium, adds Hexose phosphate dehydrogenase with potassium phosphate buffer (pH 7.0), glucose, NADP
+substrate (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester (formula VII), 30 DEG C, react 2h under rotating speed 150r/min condition, after reaction terminates, add equal-volume extraction into ethyl acetate twice, merge organic layer and use anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, enriched material drying is 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester (formula VIII); Described restructuring carbonyl reductase wet thallus consumption is 50g/L damping fluid, glucose dehydro enzyme dosage counts 50g/L damping fluid with Hexose phosphate dehydrogenase wet thallus consumption, and glucose consumption is 50g/L damping fluid, NADP
+consumption is 2mmol/L damping fluid, concentration of substrate 20mmol/L damping fluid.
Catalyzer of the present invention also comprises other forms such as the pure enzyme of carbonyl reductase BgADH2, crude enzyme liquid or thick enzyme powder.When adopting carbonyl reductase recombination engineering bacteria to make catalyzer, in conjunction with a kind of coenzyme recycle system, two enzyme Double bottom thing coenzyme recycle system such as glucose/Hexose phosphate dehydrogenase (GDH), formic acid/hydrogenlyase (FDH) and single enzyme Double bottom such as ethanol, Virahol thing coenzyme recycle system need be comprised.Usually replace NAD (P) H to react with cosubstrate, conventional cosubstrate is: glucose 10-200g/L, ethanol or Virahol 2-30% (v/v accounts for the quality percent by volume of total transformation system); Preferably cell concentration is 20-200g/L.
Gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126 of carbonyl reductase gene of the present invention can be provided, deposit number is CCTCC M 2012379, be preserved in China typical culture collection center, preservation address is Wuhan, China Wuhan University, preservation date is on September 25th, 2012, discloses in previous patent application (CN103045504A).
Beneficial effect of the present invention is mainly reflected in: the invention provides the carbonyl reductase gene deriving from a kind of gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126, this carbonyl reductase gene can be connected the recombinant expression pET28a-adh2 building and obtain containing this gene with expression vector, be converted in e. coli bl21 (DE3) again, obtain recombination bacillus coli, these intestinal bacteria contain restructuring carbonyl reductase, recombination bacillus coli can be utilized to carry out biocatalytic reaction as biological catalyst, for the biocatalysis synthesis of medicine chiral intermediate provides alternative novel enzyme source.
Restructuring carbonyl reductase BgADH2 is as biological catalyst, with 2-benzamide methyl-3-ketone butyric ester for substrate preparation (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester, product ee>95%, de>95%, 2h substrate conversion efficiency is 68%, (ee 81% compared with B.gladioli ZJB-12126 wild mushroom in CN103045504A, de 91%, 24h substrate conversion efficiency 64%), enantioselectivity and transformation efficiency are all improved.With N, when N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide, 4-chloroacetyl acetacetic ester and (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester are substrate, also corresponding (the S)-N of conversion reaction preparation can be carried out, N-two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide, (S)-4-chloro-3-hydroxyl ethyl butyrate and 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester, product ee is respectively 99%, 99% and 95%; Substrate conversion efficiency is respectively 82%, 87% and 93%.
(4) accompanying drawing explanation
Fig. 1 is cloning vector pMD18-T-adh2 physical map;
Fig. 2 is pET28a-adh2 recombinant plasmid physical map;
Fig. 3 is carbonyl reductase gene PCR amplification low melting-point agarose gel (argrose) electrophorogram; Wherein, swimming lane 1 is DL2000DNA Marker; Swimming lane 2 to increase the carbonyl reductase gene fragment obtained for utilizing primer 1 and primer 2; Swimming lane 3 to increase the carbonyl reductase gene fragment obtained for utilizing primer 3 and primer 4.
The enzyme of the positive recombinant plasmid pET28a-adh2 of Fig. 4 cuts structure iron; Wherein, swimming lane 1 is DL 10000DNA Marker fragment; Swimming lane 2 is carbonyl reductase gene; Swimming lane 3 is pET28a-adh2/Nde I sample; Swimming lane 4 is pET28a-adh2/Xho I sample; Swimming lane 5 is pET28a-adh2/Nde I and Xho I sample;
Fig. 5 is the SDS-PAGE figure after carbonyl reduction enzyme purification: swimming lane 1 is protein molecular weight Marker, and swimming lane 2 is the carbonyl reductase BgADH2 after purifying.
Fig. 6 is (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate Lipase absobed equation.
Fig. 7 is (S)-N, N-two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide synthesis equation.
Fig. 8 is (S)-4-chloro-3-hydroxyl ethyl butyrate synthesis equation.
Fig. 9 is 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester synthesis equation.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1: the amplification of carbonyl reductase gene adh 2
According to gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126 genome sequencing information, excavate wherein a large amount of carbonyl reductases, one of them has catalysis 2-benzoyl aminomethyl-3-ketone butyric ester and N, two methyl-3-oxygen-3-(2-thienyl) propionic acid amide of N-generates (2S, 3R) enzyme of-2-benzoyl aminomethyl-3-hydroxybutyrate ester and two methyl-3-hydroxyl-3-(2-thienyl) the propionic acid amide function of (S)-N, N-is the carbonyl reductase BgADH2 that the present invention relates to.
Utilize MPBio company
spin test kit extracts the total genomic dna of gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB12126 thalline, with this genomic dna for template, under the effect of primer 1 (ATGAGCAAGCGGCTGGAAGGCAAGG), primer 2 (TCAGACCTGGGCCTGGC CGCC), carry out pcr amplification.PCR reaction system (cumulative volume 50 μ L): 10 × Pfu DNA Polymerase Buffer 5 μ L, 10mM dNTP mixture (each 2.5mM of dATP, dCTP, dGTP and dTTP) 1 μ L, concentration is cloning primer 1, each 1 μ L of primer 2 of 50 μMs, genomic dna 1 μ L, Pfu DNA Polymerase 1 μ L, seedless sour water 40 μ L.
Adopt the PCR instrument of Biorad, PCR reaction conditions: denaturation 95 DEG C of 5min, 95 DEG C of sex change 30s, 65 DEG C of annealing 45s, 72 DEG C extend 1min, totally 30 circulations, and last 72 DEG C extend 10min.
PCR reaction solution detects with 0.9% agarose gel electrophoresis and cuts glue and reclaims this fragment of purifying, utilizes Taq archaeal dna polymerase to hold to fragment 5 ' and introduces base A.Under the effect of T4DNA ligase enzyme, this fragment is connected with pMD18-T carrier, obtain cloning recombinant plasmids pMD18-T-adh2, see Fig. 1.By this recombinant plasmid transformed in e. coli jm109, coating containing final concentration is that the LB of 50 μ g/ml sodium ampicillin resistances is dull and stereotyped, random picking positive colony order-checking, utilize software analysis sequencing result, result shows: the nucleotide sequence length increased through primer 1 and primer 2 is 756bp (its nucleotide sequence is as shown in SEQ ID NO:1), the open reading frame (aminoacid sequence is SED ID NO.2) that this sequence encoding one is complete.
Embodiment 2: the structure of recombination bacillus coli BL21 (DE3)/pET28a-adh2
According to embodiment 1 analytical results design primer 3 (
cATATGaGCAAGCGGCTGGAAGGCAA GG), primer 4 (
cTCGAGand in primer 3 and primer 4, introduce Nde I and Xho I restriction enzyme site (underscore mark) respectively TCAGACCTGGGCCTGGCCGCCG).Under the initiation of primer 3 and primer 4, high-fidelity Pfu archaeal dna polymerase is utilized to increase, obtain the long carbonyl reductase gene order (its nucleotide sequence is as shown in SEQ ID NO:1) for 756bp, Nde I and Xho I restriction enzyme (TaKaRa) is utilized to process amplified fragments after order-checking, and utilize T4DNA ligase enzyme (TaKaRa) by this fragment with connecting with the commercialization carrier pET28a (Invitrogen) of identical restriction enzyme ferment treatment, construction of expression vector pET28a-adh2.The expression vector pET28a-adh2 of structure is converted in e. coli bl21 (DE3) (Invitrogen), the LB coated containing final concentration 50 μ g/mL kalamycin resistance is dull and stereotyped, 8-16h is cultivated at 37 DEG C, random picked clones, extracting plasmid carries out enzyme and cuts qualification, qualification result as shown in Figure 4, there is single band in line at 3 swimming lanes and 4 swimming lanes in positive recombinant plasmid pET28a-adh2 single endonuclease digestion as can be seen from Figure 4, after double digestion there are two bands in 5 swimming lanes, and a band is consistent with goal gene clip size.This result illustration purpose gene has been cloned into Nde I and the Xho I site of pET28a, namely obtains recombination bacillus coli E.coli BL21 (DE3)/pET28a-adh2.
Embodiment 3: restructuring carbonyl reductase (BgADH2) wet thallus
Recombination bacillus coli E.coli BL21 (the DE3)/pET28a-adh2 thalline containing recombinant expression pET28a-adh2 embodiment 2 obtained is seeded to the LB liquid nutrient medium containing final concentration 50 μ g/mL kalamycin resistance, 37 DEG C, 12h is cultivated under 200rpm, be seeded to fresh in the LB liquid nutrient medium of final concentration 50 μ g/ml kalamycin resistance again with 1% inoculum size (v/v), in 37 DEG C, under 150rpm, be cultured to thalline OD
600reach 0.6-0.8, add the IPTG that final concentration is 0.1mM, at 28 DEG C after inducing culture 12h, 4 DEG C, the centrifugal 5min of 5000rpm, abandoning supernatant, collecting precipitation, namely obtains recombination bacillus coli BL21 (the DE3)/pET28a-adh2 wet thallus containing recombinant expression.This thalline can directly as biological catalyst or for protein purification.
Embodiment 4: the separation and purification of carbonyl reductase (BgADH2)
By the thalline (i.e. recombination bacillus coli BL21 (DE3)/pET28a-adh2 wet thallus) of acquisition in embodiment 3 with binding buffer liquid (50mM, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 10mM imidazoles) resuspended after, through ultrasonication, the centrifugal 40min of 12000rpm, supernatant is with after the above-mentioned Ni affinity chromatography resin equilibrated in conjunction with liquid is hatched, use dcq buffer liquid (50mM again, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 20mM imidazoles) rinse extremely substantially without foreign protein, subsequently with elution buffer (50mM, pH 8.0 sodium phosphate buffer, containing 300mM NaCl, 250mM imidazoles) wash-out collect target protein, target protein is merged and with dialysis buffer liquid (50mM after electroresis appraisal purity, pH 8.0 sodium phosphate buffer) dialyse 48h, getting trapped fluid adopts Coomassie Brilliant Blue mensuration protein content to be 2mg/mL, enzyme liquid being diluted to final concentration is 0.5mg/mL packing, frozen in-80 DEG C (carbonyl reductase BgADH2 protein electrophoresis figure is shown in accompanying drawing 5), obtain the pure enzyme of carbonyl reductase BgADH2.
Embodiment 5: the determination of activity of restructuring carbonyl reductase BgADH2
The pure enzyme of carbonyl cyclase BgADH2 obtained with the separation and purification of embodiment 4 method is for catalytic substrate 2-benzoyl aminomethyl-3-ketone butyric ester.
Catalyst system composition and catalytic condition as follows: 10mL phosphate buffered saline buffer (100mM, pH 7.0) in add the pure enzyme of carbonyl reductase BgADH2 (final concentration is 0.1g/L), 2-benzoyl aminomethyl-3-ketone butyric ester (final concentration 20mmol/L, starting point concentration is 400mmol/L DMSO), NAD (P) H (final concentration 5mmol/L damping fluid) forms reaction system.30 DEG C, react 5min sampling detection enzyme under rotating speed 150r/min condition and live.Under similarity condition, the trapped fluid obtained through dialysing with e. coli bl21 (DE3) and e. coli bl21 (DE3)/pET28a bacterial cell disruption supernatant in contrast.
Mei Huo unit (U) is defined as: 30 DEG C, under pH 7.0 condition, the enzyme amount needed for 1min internal consumption 1 μm of ol NAD (P) H is defined as 1U.The consumption of NAD (P) H adopts microplate reader to measure under 340nm.Enzyme according to the consumption calculating restructuring carbonyl reductase BgADH2 of NAD in system (P) H is lived.Measurement result is in table 1.
Table 1 is recombinated the enzyme activity determination of carbonyl reductase BgADH2
| Bacterial strain/plasmid | Enzyme lives (U/mg) |
| E. coli bl21 (DE3) | 0 |
| E. coli bl21 (DE3)/pET28a | 0 |
| E. coli bl21 (DE3)/pET28a-adh2 | 5.4 |
Embodiment 6: restructuring carbonyl reductase BgADH2 coenzyme type measures
Catalyst system composition and catalytic condition as follows: 10mL phosphate buffered saline buffer (100mM, pH 7.0) in add embodiment 4 prepare the pure enzyme of restructuring carbonyl reductase BgADH2 (final concentration is 0.1g/L), 2-benzoyl aminomethyl-3-ketone butyric ester (final concentration 20mmol/L, starting point concentration is 400mmol/L DMSO), NADH or NADPH (2mmol/L damping fluid) forms reaction system.30 DEG C, after reacting 5min under rotating speed 150r/min condition, sampling detects enzyme and lives (method is with embodiment 5).Under similarity condition, not add the reaction solution of coenzyme in contrast.Measurement result is in table 2.
Table 2 is recombinated carbonyl reductase BgADH2 coenzyme Preference
| Coenzyme type | Enzyme lives (U/mg) |
| Contrast | 0 |
| NADH | 0.2 |
| NADPH | 4.5 |
Result shows, when this carbonyl reductase take NADPH as coenzyme, enzyme activity is far away higher than using NADH as the enzyme activity of coenzyme, and therefore this can infer that this enzyme is a kind of NADPH cofactor-dependent carbonyl reductase.
Embodiment 7: restructuring carbonyl reductase BgADH2 Cofactor Regeneration Systems
Using the recombination bacillus coli BL21/pET28a-adh2 wet thallus containing recombinant expression of embodiment 3 method acquisition as biological catalyst, with 2-benzamide methyl-3-ketone butyric ester for substrate.
(1) selection of carbonyl reductase BgADH2 Cofactor Regeneration Systems
Hexose phosphate dehydrogenase (GDH) (is derived from Exiguobacterium sibiricum 255-15, GenBank:ACB59697.1) recombinant bacterium BL21 (DE3)/pET28b-gdh) thalline (glycerine pipe) and hydrogenlyase (FDH) (derive from Candida boidinii, GenBank:AF004096) recombinant bacterium BL21 (DE3)/pET28b-fdh) thalline (glycerine pipe) is seeded to LB liquid nutrient medium containing final concentration 50 μ g/mL kalamycin resistance respectively, 37 DEG C, 12h is cultivated under 200rpm, be seeded to fresh in the LB liquid nutrient medium of final concentration 50 μ g/mL kalamycin resistance again with 1% inoculum size (v/v), in 37 DEG C, thalline OD is cultured under 150rpm
600reach 0.6-0.8, add the IPTG that final concentration is 0.1mM, at 28 DEG C after inducing culture 12h, 4 DEG C, the centrifugal 5min of 5000rpm, abandoning supernatant, collecting precipitation, namely obtains Hexose phosphate dehydrogenase wet thallus or hydrogenlyase wet thallus.This thalline can directly apply to Cofactor Regeneration Systems.
Transformation system: potassium phosphate buffer (100mM, pH 7.0) 10mL, carbonyl reductase BgADH2 wet thallus amount 0.5g (dry cell weight is 0.048g), substrate 2-benzamide methyl-3-ketone butyric ester 20mmol/L damping fluid, NADP
+0.5mmol/L damping fluid, cosubstrate (cosubstrate is one of following: the glucose of 50g/L damping fluid, the ammonium formiate of 50g/L damping fluid, the Virahol of 30%v/v damping fluid or the ethanol of 30%v/v damping fluid), (desaturase is one of following to desaturase: Hexose phosphate dehydrogenase (GDH) or hydrogenlyase (FDH), desaturase wet thallus consumption is 0.5g), 30 DEG C, rotating speed 150r/min shaking table reaction 2h.Reaction terminates rear equal-volume extraction into ethyl acetate twice, and sample treatment is identical with embodiment 9.Measure transformation efficiency and ee and de of product.Under similarity condition, not add the reaction solution of coenzyme circulating system in contrast.The results are shown in Table 3.
The different coenzyme recycle system of table 3 is on the impact of catalyzed reaction
Result shows that productive rate can reach 62.6% when selecting glucose/GDH as Cofactor Regeneration Systems, and being only second to ethanol is the coenzyme recycle system of cosubstrate, and its selectivity is all higher than other Cofactor Regeneration Systems.
(2) optimization of Hexose phosphate dehydrogenase biomass in carbonyl reductase BgADH2 regenerating coenzyme circulating system
Transformation system: potassium phosphate buffer (100mM, pH 7.0) 10mL, (dry cell weight is 0.048g to carbonyl reductase BgADH2 wet thallus amount 0.5g, prepared by embodiment 3 method), 2-benzoyl aminomethyl-3-ketone butyric ester 0.05g (final concentration 20mmol/L, starting point concentration is 400mmol/L DMSO), NADP
+0.5mmol/L damping fluid, glucose 50g/L damping fluid, Hexose phosphate dehydrogenase wet thallus amount prepared by step (1) is respectively 0.1,0.25,0.5,0.75,1.0g (dry cell weight is respectively 0.011,0.024,0.05,0.074,0.09g), 30 DEG C, rotating speed 150r/min shaking table reaction 2h.Reaction terminates rear equal-volume extraction into ethyl acetate twice, and sample treatment is identical with embodiment 9.Measure transformation efficiency and ee and de of product.Under similarity condition, not add the reaction solution of Hexose phosphate dehydrogenase in contrast.Optimum result is in table 4.
The optimization of GDH biomass in table 4 BgADH2 regenerating coenzyme circulating system
| GDH (wet thallus g) | Transformation efficiency (%) |
| 0 | 68 |
| 0.1 | 72 |
| 0.25 | 90 |
| 0.5 | 96 |
| 0.75 | 95 |
| 1.0 | 96 |
Result shows when BgADH2 biomass and Hexose phosphate dehydrogenase biomass weight ratio are 1:1, and regenerating coenzyme circulation can meet the demand of BgADH2 to NADPH substantially.Above catalytic reaction products ee and de is all greater than 95%.
(3) optimization of glucose concn in carbonyl reductase BgADH2 regenerating coenzyme circulating system.
Transformation system: potassium phosphate buffer (100mM, pH 7.0) 10mL, (dry cell weight is 0.048g to carbonyl reductase BgADH2 wet thallus amount 0.5g, prepared by embodiment 3), 2-benzoyl aminomethyl-3-ketone butyric ester 0.05g (final concentration 20mmol/L damping fluid, starting point concentration is 400mmol/L DMSO), NADP
+0.5mmol/L damping fluid, glucose concn is respectively 10g/L, 50g/L, 100g/L, 150g/L and 200g/L damping fluid.Hexose phosphate dehydrogenase wet thallus amount 0.5g (dry cell weight is 0.05g) prepared by step (1), reacts 2h under rotating speed 150r/min by 30 DEG C.Reaction terminates rear equal-volume extraction into ethyl acetate twice, and sample treatment is identical with embodiment 8.Measure transformation efficiency and ee and de of product.Under similarity condition, not add the reaction solution of glucose in contrast.Optimum result is in table 5.
The optimization of glucose concn in table 5 carbonyl reductase BgADH2 regenerating coenzyme circulating system
| Glucose (g/L) | Transformation efficiency (%) |
| 0 | 12 |
| 10 | 68 |
| 50 | 96 |
| 100 | 96 |
| 150 | 95 |
| 200 | 95 |
Result shows that, when glucose concn is 50g/L, regenerating coenzyme circulating system can meet the demand of carbonyl reductase BgADH2 to NADPH substantially.Above catalytic reaction products ee and de is all greater than 95%.
(4) NADP in carbonyl reductase BgADH2 regenerating coenzyme circulating system
+the optimization of concentration.
Transformation system: potassium phosphate buffer (100mM, pH 7.0) 10mL, (dry cell weight is 0.048g to carbonyl reductase BgADH2 wet thallus amount 0.5g, prepared by embodiment 3), 2-benzoyl aminomethyl-3-ketone butyric ester 0.05g (final concentration 20mmol/L damping fluid, starting point concentration is 400mmol/L DMSO), NADP
+be respectively 0.01,0.02,0.05,0.1,0.5,1.0 and 2.0mmol/L damping fluid.Glucose concn is 50g/L damping fluid.Hexose phosphate dehydrogenase wet thallus amount 0.5g (dry cell weight is 0.05g) prepared by step (1), reacts 2h under rotating speed 150r/min by 30 DEG C.Reaction terminates rear equal-volume extraction into ethyl acetate twice, and sample treatment is identical with embodiment 8.Measure transformation efficiency and ee and de of product.Under similarity condition, not add NADP
+reaction solution in contrast.Optimum result is in table 6.
The optimization of NADP+ concentration in table 6 carbonyl reductase BgADH2 regenerating coenzyme circulating system
| NADP+(mM) | Transformation efficiency (%) |
| 0 | 40 |
| 0.01 | 58 |
| 0.02 | 60 |
| 0.05 | 76 |
| 0.1 | 95 |
| 0.5 | 95 |
| 1.0 | 95 |
| 2.0 | 95 |
Result shows that the transformation efficiency of carbonyl reductase BgADH2 catalytic substrate is with NADP
+concentration increases and increases, and works as NADP
+when concentration is greater than 0.1mM, transformation efficiency tends towards stability.Above catalytic reaction products ee and de is all greater than 95%.
Embodiment 8: the application of the full cell of restructuring carbonyl reductase BgADH2 in preparation 4AA intermediate (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester
(1) using recombination bacillus coli BL21 (the DE3)/pET28a-adh2 wet thallus containing recombinant expression of embodiment 3 method acquisition as biological catalyst, with 2-benzamide methyl-3-ketone butyric ester for substrate, carry out biocatalytic reaction preparation (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester.
Catalyst system composition and catalytic condition as follows: 10mL phosphate buffered saline buffer (100mM, pH 7.0) in add 0.5g carbonyl reductase BgADH2 wet thallus (dry cell weight is 0.048g), (dry cell weight is 0.05g to 0.5g Hexose phosphate dehydrogenase wet thallus, prepared by embodiment 7 method), 2-benzoyl aminomethyl-3-ketone butyric ester 0.05g (final concentration 20mmol/L damping fluid, starting point concentration is 400mmol/L DMSO), NADP
+2mmol/L damping fluid, glucose 50g/L damping fluid forms reaction system.30 DEG C, rotating speed 150r/min Water Under bath shaking table reaction 2h, reaction terminates rear equal-volume extraction into ethyl acetate twice, merge organic layer and with anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, enriched material HPLC moving phase is dissolved, and HPLC detects transformation efficiency and ee and de.Under similarity condition, using the reaction solution added without thalline as blank, replace above-mentioned recombination bacillus coli BL21 (DE3)/pET28a-adh2 as negative control using e. coli bl21 (DE3)/pET28a wet thallus.After 2h, the transformation efficiency of substrate is 68%, ee>97%, de>95%, (24h substrate conversion efficiency is 64% compared with original strain, product ee 81%, de 92%), transformation efficiency and selectivity are all significantly improved.Blank and negative control all show substrate non-activity.
The ee of (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester is calculated as follows: [(A
(2S, 3R)-A
(2R, 3S))/(A
(2S, 3R)+ A
(2R, 3S))] × 100, wherein A is peak area; (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester de is calculated as follows: [(A
(2S, 3R)-A
(2R, 3R))/(A
(2S, 3R)+ A
(2R, 3R))] × 100, wherein A is peak area.
(2) Liquid Detection of 2-benzamide methyl-3-ketone butyric ester and 2-benzamide methyl-3-hydroxybutyrate ester
High performance liquid chromatograph device: Shimadzu LC-20AD system-SPD-20A UV-detector.
Detection transformation efficiency is chromatographic column is Hypersil ODS2C18 (4.6mm × 250mm, 2.5 μm), moving phase: water: acetonitrile=75:25, flow velocity 1mL/min, column temperature 40 DEG C, determined wavelength: 254nm.The retention time of 2-benzamide methyl-3-ketone butyric ester is 10.5min.The retention time of 2-benzamide methyl-3-hydroxybutyrate ester two pairs of enantiomers is respectively 6.0min and 6.9min.
During detection ee and de, chiral chromatographic column is Chiralpak AY-H (250 × 4.6mm, 5 μm), moving phase: normal hexane: ethanol=76:24, flow velocity 1.0mL/min.(2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester, (2R, 3R)-2-benzamide methyl-3-hydroxybutyrate ester, (2R, the retention time of 3S)-2-benzamide methyl-3-hydroxybutyrate ester and (2S, 3S)-2-benzamide methyl-3-hydroxybutyrate ester is respectively: 5.8,6.7,7.3 and 10.4min.The retention time of substrate 2-benzamide methyl-3-ketone butyric ester two kinds of configurations is respectively at 9.8min and 11.0min.
Embodiment 9: the application of the full cell of restructuring carbonyl reductase BgADH2 in two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of preparation duloxetine. intermediate (S)-N, N-
(1) recombination bacillus coli BL21 (the DE3)/pET28a-adh2 wet thallus containing recombinant expression obtained in embodiment 3 is as biological catalyst, with N, two methyl-3-ketone-3-(2-thienyl) propionic acid amide of N-is substrate, carry out two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of bioconversion reaction preparation (S)-N, N-.
Catalyst system composition and catalytic condition as follows: add in 10mL potassium phosphate buffer (pH 8.0) 0.5g recombinate carbonyl reductase BgADH2 wet thallus (dry cell weight is 0.048g) and 0.5g Hexose phosphate dehydrogenase wet thallus (dry cell weight is 0.05g, prepared by embodiment 7 method), N, N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide 0.037g (final concentration is 20mmol/L damping fluid), NADP
+2mmol/L damping fluid, glucose 50g/L damping fluid.30 DEG C, under rotating speed 150r/min condition, react 2h.Add the 6M NaOH aqueous solution after reaction terminates and adjust pH to 11.0.Add equal-volume extraction into ethyl acetate twice again, merge organic layer and with anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, enriched material HPLC moving phase is dissolved, and HPLC detects productive rate and ee.Under similarity condition, using the reaction solution of not mycetome as blank, replace above-mentioned recombination bacillus coli BL21 (DE3)/pET28a-adh2 wet thallus as negative control using e. coli bl21 (DE3)/pET28a wet thallus.The transformation efficiency of substrate is 82%, ee>99%.Blank and negative control all show substrate non-activity.
(2) liquid phase detection method of two methyl-3-ketone-3-(2-thienyl) propionic acid amide of N, N-and two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N, N-
High performance liquid chromatograph device: Shimadzu LC-20AD system-SPD-20A UV-detector.
When detection transformation efficiency and ee, chiral chromatographic column is Chiralcel OJ-H (150 × 2.1mm, 5 μm), moving phase: normal heptane: ethanol: diethylamine=97:3:0.1, flow velocity 0.2mL/min, determined wavelength 235nm.N, N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide, (S)-N, the retention time of two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N-and two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of (R)-N, N-is respectively: 5.8,6.4 and 7.1min.
Embodiment 10: the full cell of restructuring carbonyl reductase BgADH2 is preparing the application in atorvastatin pharmaceutical intermediate (S)-4-chloro-3-hydroxyl ethyl butyrate
(1) recombination bacillus coli BL21 (the DE3)/pET28a-adh2 wet thallus containing recombinant expression obtained in embodiment 3 is as biological catalyst, with 4-chloroacetyl acetacetic ester (COBE) for substrate, carry out bioconversion reaction preparation (S)-4-chloro-3-hydroxyl ethyl butyrate (CHBE).
Catalyst system composition and catalytic condition as follows: add in 10mL potassium phosphate buffer (pH 7.0) 0.5g recombinate carbonyl reductase BgADH2 wet thallus (dry cell weight is 0.048g) and 0.5g Hexose phosphate dehydrogenase wet thallus (dry cell weight is 0.05g, prepared by embodiment 7 method), COBE 0.033g (final concentration is 20mmol/L damping fluid), NADP
+2mmol/L damping fluid, glucose 50g/L damping fluid.30 DEG C, under rotating speed 150r/min condition, react 2h.Add equal-volume extraction into ethyl acetate twice after reaction terminates, merge organic layer and with anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, enriched material moving phase is dissolved, gas chromatographic detection productive rate and ee.Under similarity condition, using the reaction solution of not mycetome as blank, replace above-mentioned recombination bacillus coli BL21 (DE3)/pET28a-adh2 wet thallus as negative control using e. coli bl21 (DE3)/pET28a wet thallus.The transformation efficiency of substrate is 87%, ee>99%.Blank and negative control all show substrate without effect.
(2) the vapor detection method of 4-chloroacetyl acetacetic ester and 4-chloro-3-hydroxyl ethyl butyrate
Gas-chromatography instrument: Shimadzu GC-14C system-fid detector.
When detection transformation efficiency and ee, chiral chromatographic column is BGB-174 (30m × 0.25mm × 0.25 μM), injector temperature: 220 DEG C, detector temperature: 220 DEG C, column temperature: 110 DEG C, is warming up to 125 DEG C with 0.5 DEG C/min speed program.Carrier is helium, flow velocity: 1.5mL/min.The retention time of COBE, (S)-CHBE and (R)-CHBE is respectively: 6.8,23.7 and 24.2min.
Embodiment 11: the full cell of restructuring carbonyl reductase BgADH2 is preparing the application in atorvastatin pharmaceutical intermediate 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester
(1) recombination bacillus coli BL21 (the DE3)/pET28a-adh2 wet thallus containing recombinant expression obtained in embodiment 3 is as biological catalyst, with (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester for substrate, carry out bioconversion reaction and prepare 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester.
Catalyst system composition and catalytic condition as follows: add in 10mL potassium phosphate buffer (pH 7.0) 0.5g recombinate carbonyl reductase BgADH2 wet thallus (dry cell weight is 0.048g) and 0.5g Hexose phosphate dehydrogenase wet thallus (dry cell weight is 0.05g, prepared by embodiment 7 method), (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester 0.0458g (final concentration is 20mmol/L damping fluid), NADP
+2mmol/L damping fluid, glucose 50g/L damping fluid.30 DEG C, under rotating speed 150r/min condition, react 2h.Add equal-volume extraction into ethyl acetate twice after reaction terminates, merge organic layer and with anhydrous magnesium sulfate drying, filter, Rotary Evaporators removing ethyl acetate, enriched material moving phase is dissolved, liquid chromatographic detection productive rate and de.Under similarity condition, using the reaction solution of not mycetome as blank, replace above-mentioned recombination bacillus coli BL21 (DE3)/pET28a-adh2 wet thallus as negative control using e. coli bl21 (DE3)/pET28a wet thallus.The transformation efficiency of substrate is 93%, de>99%.Blank and negative control all show substrate without effect.
(2) liquid phase detection method of (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester and 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester
Liquid chromatography instrument: Shimadzu LC-20AD system-SPD-20A UV-detector.
When detection transformation efficiency and ee, chromatographic column is Hypersil ODS2C18 (4.6mm × 250mm, 2.5 μm), moving phase: acetonitrile: water=1:3, flow velocity 1mL/min, determined wavelength 220nm.(R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester, 6-cyano group-(3R, the retention time of 5R)-dihydroxyl hecanoic acid t-butyl ester and 6-cyano group-(3R, 5S)-dihydroxyl hecanoic acid t-butyl ester is respectively: 11.4,9.4 and 9.8min.
From above experimental result, the recombination bacillus coli containing carbonyl reductase gene that the present invention obtains has the ability of stronger carbonyl reduction, can directly to contain the somatic cells of enzyme for carrying out biocatalysis or conversion reaction in enzyme source.Carbonyl reductase BgADH2 (SED ID NO.2) is as conversion enzyme, 2-benzoyl aminomethyl-3-ketone butyric ester can be utilized, N, two methyl-3-ketone-3-(2-thienyl) propionic acid amide of N-, 4-chloroacetyl acetacetic ester (COBE) and (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester are substrate, carry out bioconversion reaction and prepare high optically pure medicine chiral intermediate (2S, 3R)-2-benzamide methyl-3-hydroxybutyrate ester, (S)-N, two methyl-3-hydroxyl-3-(2-thienyl) propionic acid amide of N-, (S)-4-chloro-3-hydroxyl ethyl butyrate and 6-cyano group-(3R, 5R)-dihydroxyl hecanoic acid t-butyl ester.
Claims (10)
1. derive from a carbonyl reductase gene of gladiolus bulkholderia cepasea (Burkholderia gladioli) ZJB-12126, it is characterized in that the nucleotides sequence of described gene is classified as shown in SEQ ID NO:1.
2. the restructuring carbonyl reductase of carbonyl reductase genes encoding described in a claim 1.
3. to recombinate as claimed in claim 2 carbonyl reductase, it is characterized in that the aminoacid sequence of described enzyme is for shown in SEQ ID NO:2.
4. the recombinant vectors that described in a claim 1, carbonyl reductase is gene constructed.
5. recombinant vectors described in a claim 4 transforms the recombination engineering bacteria obtained.
6. the application of carbonyl reductase gene according to claim 1 in preparation restructuring carbonyl reductase.
7. apply as claimed in claim 6, it is characterized in that described being applied as: build the recombinant vectors containing described carbonyl reductase gene, described recombinant vectors is converted in intestinal bacteria, the recombination engineering bacteria obtained carries out inducing culture, and nutrient solution is separated the somatic cells obtained containing restructuring carbonyl reductase.
8. carbonyl reductase of recombinating described in a claim 2 is preparing the application in medicine chiral intermediate, be applied as described in it is characterized in that: the wet thallus obtained through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene is for catalyzer, be in the damping fluid of 6 ~ 10 in pH value, add substrate, cosubstrate and NAD (P)
+, 20 ~ 40 DEG C, react under 50 ~ 250rpm condition, after reacting completely, obtain the mixed solution of drug containing chiral intermediate; Described substrate is the one in 2-benzoyl aminomethyl-3-ketone butyric ester, N, N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide, 4-chloroacetyl acetacetic ester and (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester; Described cosubstrate is glucose, ammonium formiate, Virahol or dehydrated alcohol, when described cosubstrate is glucose, adds Hexose phosphate dehydrogenase and forms cosubstrate system, when described cosubstrate is ammonium formiate, adds hydrogenlyase and forms cosubstrate system; The consumption of described catalyzer counts 20-200g/L damping fluid with the weight of wet thallus, the starting point concentration of described substrate is 10-100mmol/L damping fluid, the consumption of described cosubstrate is 10-200g/L damping fluid, described glucose takes off the consumption of desaturase or ammonium formiate desaturase with the wet thallus weighing scale obtained through fermentation culture containing the thalline of Hexose phosphate dehydrogenase or hydrogenlyase, for 20-200g/L damping fluid, described NAD (P)
+consumption be 0.01-5mmol/L damping fluid.
9. apply as claimed in claim 8, it is characterized in that described wet thallus is prepared as follows: the engineering bacteria containing restructuring carbonyl reductase gene is seeded to the LB liquid nutrient medium containing final concentration 50 μ g/ml kalamycin resistance, 37 DEG C, 12h is cultivated under 200rpm, be seeded to fresh in the LB liquid nutrient medium of final concentration 50 μ g/ml kalamycin resistance again with volumetric concentration 1% inoculum size, in 37 DEG C, under 150rpm, be cultured to thalline OD
600reach 0.6-0.8, add the IPTG that final concentration is 0.1mM, at 28 DEG C after inducing culture 12h, 4 DEG C, the centrifugal 5min of 5000rpm, abandoning supernatant, collects wet thallus.
10. apply as claimed in claim 8, it is characterized in that wet thallus that described reaction obtains through fermentation culture with the engineering bacteria containing restructuring carbonyl reductase gene is for catalyzer, be in the damping fluid of 6 ~ 10 in pH value, add substrate, glucose, Hexose phosphate dehydrogenase and NAD (P)
+, 30 DEG C, react under 150rpm condition, after reacting completely, obtain the mixed solution of drug containing chiral intermediate; Described substrate is the one in 2-benzoyl aminomethyl-3-ketone butyric ester, N, N-two methyl-3-ketone-3-(2-thienyl) propionic acid amide, 4-chloroacetyl acetacetic ester and (R)-6-cyano group-5-hydroxyl-3-carbonyl hecanoic acid t-butyl ester; The consumption of described catalyzer counts 50g/L damping fluid with the weight of wet thallus, the starting point concentration of described substrate is 20mmol/L damping fluid, the consumption of described cosubstrate is 50g/L damping fluid, described glucose takes off the consumption of desaturase with the wet thallus weighing scale obtained through fermentation culture containing the thalline of Hexose phosphate dehydrogenase, for 50g/L damping fluid, described NAD (P)
+consumption be 2mmol/L damping fluid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410436860.XA CN104263742A (en) | 2014-08-29 | 2014-08-29 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410436860.XA CN104263742A (en) | 2014-08-29 | 2014-08-29 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104263742A true CN104263742A (en) | 2015-01-07 |
Family
ID=52155321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410436860.XA Pending CN104263742A (en) | 2014-08-29 | 2014-08-29 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104263742A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630243A (en) * | 2015-01-20 | 2015-05-20 | 浙江工业大学 | Carbonyl reductase gene, enzyme, vector and engineering bacterium as well as application of carbonyl reductase gene in asymmetrically reducing prochiral carbonyl compounds |
| CN104630242A (en) * | 2015-01-20 | 2015-05-20 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
| CN105039361A (en) * | 2015-06-30 | 2015-11-11 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, strain and application of gene |
| CN105062986A (en) * | 2015-08-19 | 2015-11-18 | 南京工业大学 | Application of carbonyl reductase gene, engineering bacterium containing gene, and method of catalytic deoxidizing reaction of engineering bacterium |
| CN105755095A (en) * | 2016-02-04 | 2016-07-13 | 浙江工业大学 | Method for synthesizing (R)-2-hydroxy acid by biological enzyme method |
| CN107586793A (en) * | 2017-10-10 | 2018-01-16 | 吉林凯莱英医药化学有限公司 | The method for preparing the alcoholic compound with multiple chiral centers |
| CN111944776A (en) * | 2020-09-03 | 2020-11-17 | 中国科学技术大学 | Carbonyl reductase and application thereof |
-
2014
- 2014-08-29 CN CN201410436860.XA patent/CN104263742A/en active Pending
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630243A (en) * | 2015-01-20 | 2015-05-20 | 浙江工业大学 | Carbonyl reductase gene, enzyme, vector and engineering bacterium as well as application of carbonyl reductase gene in asymmetrically reducing prochiral carbonyl compounds |
| CN104630242A (en) * | 2015-01-20 | 2015-05-20 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
| CN104630242B (en) * | 2015-01-20 | 2017-12-05 | 浙江工业大学 | A kind of carbonyl reduction enzyme gene, codase, carrier, engineering bacteria and its application |
| CN105039361A (en) * | 2015-06-30 | 2015-11-11 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, strain and application of gene |
| CN105039361B (en) * | 2015-06-30 | 2019-08-30 | 浙江工业大学 | Carbonyl reduction enzyme gene, codase, carrier, bacterial strain and application |
| CN105062986A (en) * | 2015-08-19 | 2015-11-18 | 南京工业大学 | Application of carbonyl reductase gene, engineering bacterium containing gene, and method of catalytic deoxidizing reaction of engineering bacterium |
| CN105062986B (en) * | 2015-08-19 | 2019-04-09 | 南京工业大学 | The application of carbonyl reduction enzyme gene, the engineering bacteria containing the gene and its catalytic reduction reaction method |
| CN105755095A (en) * | 2016-02-04 | 2016-07-13 | 浙江工业大学 | Method for synthesizing (R)-2-hydroxy acid by biological enzyme method |
| CN105755095B (en) * | 2016-02-04 | 2019-10-29 | 浙江工业大学 | A kind of method of biological enzyme synthesis (R) -2- hydroxy acid |
| CN107586793A (en) * | 2017-10-10 | 2018-01-16 | 吉林凯莱英医药化学有限公司 | The method for preparing the alcoholic compound with multiple chiral centers |
| CN107586793B (en) * | 2017-10-10 | 2020-10-20 | 吉林凯莱英医药化学有限公司 | Method for preparing alcohol compounds having multiple chiral centers |
| CN111944776A (en) * | 2020-09-03 | 2020-11-17 | 中国科学技术大学 | Carbonyl reductase and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104263742A (en) | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof | |
| CN104630243B (en) | Carbonyl reduction enzyme gene, enzyme, carrier, engineering bacteria and its application in asymmetric reduction prochiral carbonyl compounds | |
| US9404117B2 (en) | Increased production of isobutanol in yeast with reduced mitochondrial amino acid biosynthesis | |
| JP5804946B2 (en) | Increased heterogeneous Fe-S enzyme activity in yeast | |
| Chen et al. | Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism | |
| DK2255007T3 (en) | FERMENTATIVE PRODUCTION OF ISOBUTANOL WITH Yeast | |
| Ying et al. | Characterization of a zinc-containing alcohol dehydrogenase with stereoselectivity from the hyperthermophilic archaeon Thermococcus guaymasensis | |
| MX2008013881A (en) | Fermentive production of four carbon alcohols. | |
| JP2011522541A (en) | Deletion mutants for producing isobutanol | |
| CN105378057A (en) | Glycerol 3-phosphate dehydrogenase for butanol production | |
| US20160083751A1 (en) | Method for producing aldehyde from co2 | |
| Luo et al. | Cloning and characterization of a NADH-dependent aldo-keto reductase from a newly isolated Kluyveromyces lactis XP1461 | |
| Bea et al. | Kinetic resolution of α-methylbenzylamine by recombinant Pichia pastoris expressing ω-transaminase | |
| CN104630242B (en) | A kind of carbonyl reduction enzyme gene, codase, carrier, engineering bacteria and its application | |
| CN103013898B (en) | Carbonyl reductase expressed recombination engineering bacterium and application thereof | |
| CN101857887B (en) | Method for preparing optically pure aryl alcohol with cell-free extracts of recombinant strains by catalytic asymmetric conversion | |
| CN105039361B (en) | Carbonyl reduction enzyme gene, codase, carrier, bacterial strain and application | |
| CN104093836A (en) | Hydrocarbon synthase gene, and use thereor | |
| Chen et al. | Regulation of 3-hydroxypropionaldehyde accumulation in Klebsiella pneumoniae by overexpression of dhaT and dhaD genes | |
| CN104651292A (en) | Recombinant escherichia coli for preparing (S)-4-chlorine-3-hydroxyl ethyl butyrate by adopting asymmetric transformation and application of recombinant escherichia coli | |
| CN103695443B (en) | A kind of Novel carbonyl reductase, its gene and application | |
| CN106978379A (en) | A kind of Escherichia coli for producing isobutanol and ethanol and preparation method thereof | |
| Lee et al. | A non-pathogenic and optically high concentrated (R, R)-2, 3-butanediol biosynthesizing Klebsiella strain | |
| JP5713333B2 (en) | Method for producing dihydroxyacetone | |
| CN110016444A (en) | Acinetobacter calcoaceticus ZJPH1806 and its application for preparing Miconazole chiral intermediate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150107 |
|
| RJ01 | Rejection of invention patent application after publication |