CN105755095A - Method for synthesizing (R)-2-hydroxy acid by biological enzyme method - Google Patents
Method for synthesizing (R)-2-hydroxy acid by biological enzyme method Download PDFInfo
- Publication number
- CN105755095A CN105755095A CN201610080101.3A CN201610080101A CN105755095A CN 105755095 A CN105755095 A CN 105755095A CN 201610080101 A CN201610080101 A CN 201610080101A CN 105755095 A CN105755095 A CN 105755095A
- Authority
- CN
- China
- Prior art keywords
- hydroxy acid
- seq
- gene
- kar
- gdh
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P41/00—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture
- C12P41/002—Processes using enzymes or microorganisms to separate optical isomers from a racemic mixture by oxidation/reduction reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for synthesizing (R)-2-hydroxy acid by a biological enzyme method. The method comprises the following steps of taking a wet cell mass obtained by fermenting a recombinant genetic engineering strain as a catalyst, racemization 2-hydroxy acid shown in a formula (I) as a substrate, glucose as a cosubstrate, and a buffer solution of which the pH value is 6.0 to 9.0 as a reaction medium to form a reaction system; performing a conversion reaction under the conditions that the temperature is 20 to 50DEG C and the rotating speed is 150rpm; after the reaction is complete, separating and purifying a reaction solution to obtain the (R)-2-hydroxy acid, wherein the recombinant genetic engineering strain is recombinant escherichia coli containing 2-hydroxy acid dehydrogenase (HADH) genes, carbonyl reductase KAR genes and glucose dehydrogenase (GDH) genes. According to a single-bacteria, double-plasmid and trienzyme co-expression system disclosed by the invention, the conversion between the racemization 2-hydroxy acid and single-configuration (R)-2-hydroxy acid through an engineering strain is innovatively and successfully realized, the culture of multiple bacteria is avoided, the total concentration of bacteria is reduced, the reaction process is simplified, and extraction steps of an intermediate product are reduced; in addition, the catalytic efficiency is also remarkably improved; the system is more suitable for industrial application of a cascade catalysis system.
Description
(1) technical field
The present invention relates to the preparation method of one (R)-2-hydroxy acid, utilize single bacterium double-mass model three enzyme table altogether particularly to one
Reach the method that series connection oxidoreduction cascade system catalysis raceme 2-hydroxy acid produces (R)-2-hydroxy acid.
(2) background technology
2-hydroxy carboxylic acids (2-hydroxy acids) is the compound that a class has analog structure, they
It is structurally characterized in that there is a hydroxyl its carboxyl side C1 position.2-hydroxy carboxylic acid has ketone group and two senses of hydroxyl due to it simultaneously
Group, character is the most active.Optical voidness 2-hydroxy acid class handedness module is important fine-chemical intermediate and chiral precursor, 2-
Hydroxy acid enantiomers or important chiral resolving agent and chiral catalyst, with 'alpha '-hydroxy acids as catalyst, can be by aliphatic
It is corresponding chiral alcohol with aromatic aldehyde asymmetric transformation.There is optically active 2-hydroxy acid and become the focus of research, as
Representational malic acid, mandelic acid, o-chloromandelic acid, parachloromandelic acid, phenyl-lactic acid etc. are all the keys synthesizing important medicine
Intermediate.The structural formula of its R type of 2-hydroxy acid and S type is as follows:
Optically active 2-hydroxy acid is a kind of particularly important pharmaceutical intermediate: as R-(-)-mandelic acid is widely used in
The synthesis of multi-medicament, such as cephalosporin, penicillin, anti-tumor agent, obesity medicine, optically pure aminoacid, blood vessel are tight
Open peptide converting enzyme inhibitor, coenzyme A, clopidogrel etc..Research shows, the medicine synthesized by the mandelic acid of single configuration with disappear outward
The medicine of the mandelic acid or derivatives thereof synthesis of rotation is compared, and not only drug effect is higher, and more crucially side effect have dropped, and therefore exists
Many pharmaceutical synthesis aspect application necessarily require to be unitary type compound；It is molten that optically active mandelic acid is also used as chirality
Agent, for multiple asymmetric catalysis synthesis；Optically active mandelic acid, owing to having good Biodegradable, is to be subject at present most
The acid optical resolution agent attracted attention, can make most raceme amine and amino acids carry out optics with diastereomer isomery salt formation
Split, can be split by R-MA as controlled different caye the beautiful jade derivant of intermediate octahydro coughing medicine first south, alcamines medicine is also had
Having and well split effect, the medicine sertraline hydrochloride with it as resolving agent the most just has the market of 3,000,000,000 U.S. dollars.With
(R)-o-chloromandelic acid is that the medicament for resisting platelet aggregation clopidogrel of intermediate occupies whole world situation of selling well medicine ranking list second；
(R)-chloro mandelic acid is the derivant preparing morphine beautiful jade medicine；(R)-parachloromandelic acid is that novel oomycetes diseases antibacterial is double
The raw material of mandipropamid；(R)-2,4-difluoro mandelic acid is the important intermediate of the phenylethanolamine controlling body weight.
Phenyl-lactic acid is the synthetics precursor that some are important, and is widely used in the fields such as medicine, chemical industry, biosynthesis.The most several
Nian Lai, it as a kind of novel antibacterial again by the extensive concern of food service industry.(R)-2-hydroxy-4-phenyl butanoic acid is anti-
The important source material of hypertension drug of first choice-pril pharmaceutical synthesis.
According to incompletely statistics, on current international market optically active 2-hydroxy acid demand about with average annual more than 10% speed
Increase, it has also become the great chemical products of international focus；Optically active 2-hydroxy acid is as the material of a kind of high added value, and it should
With widely and the huge market demand, its preparation increasingly comes into one's own.
Chipal compounds has important function in people live, owing to two reflect body at pharmacology, toxicity and function work
With etc. each side the most different, therefore, prepare optically pure chipal compounds in the field such as medicine, agricultural, material and environmental protection
All have and be worth widely.At present, the acquisition of optical activity 2-hydroxy acid mainly uses chemical resolution method and biological catalysis two kinds.
Chemical resolution method mainly includes diastereomer salt-pepper noise Split Method, Chromatographic resolution method, chiral extraction Split Method, capillary
Electrophoresis tube Split Method.
1. diastereomer salt-pepper noise Split Method, the common problem faced is exactly expensive, and has certain toxicity,
Causing the wasting of resources and environmental pollution to a certain extent, the R-MA of current China large-scale production all uses the method raw
Produce.
2. Chromatographic resolution method, this method cost of equipment is the highest, consumes big, and cost is the highest, and treating capacity is little, is therefore only limitted to detection
And prepared by laboratory, it is impossible to for commodity production.
3. chiral extraction Split Method, chiral extraction partition method is the chiral separation method the most just proposed, from commercialization
Produce and also have the biggest distance.
4. capillary electrophoresis Split Method, because having efficient, quick, economic dispatch feature, is widely used in various medicine mapping
The separation of body, the method just has high in cost of production shortcoming.
Biological catalysis is considered as that chipal compounds produces the key technology made a breakthrough, hence with biological catalysis preparation
Standby optical pure mandel and derivant thereof have become the focus of research both at home and abroad.Biological catalysis is divided into again Enzymatic Resolution, the most right
Claim reducing process, oxidation-reduction method.
1. Enzymatic Resolution, Enzymatic Resolution is the one of kinetics resolution method, and the most frequently used is through raceme of degrading
A kind of enantiomer in body, and leave another kind of configuration, reaches to split purpose, owing to the method is by degradation selectivity wherein
Planting configuration and obtain required enantiomer, therefore conversion ratio is restricted, it is impossible to surmount 50%, has certain limitation.Separately
Outward, also utilize lipase to split o-chloromandelic acid ester and obtain the carboxylate of single configuration, then obtain light by method for hydrolysis
Learn pure o-chloromandelic acid, but the method complex steps, it is not suitable for industrial applications.
2. method of asymmetrically reducing, the stereo selectivity enzyme having in utilizing microbial body passes through method of asymmetrically reducing by latent hands
The compound of property is reduced into optically pure single enantiomer.The advantage of this method is that theoretical yield is high, and simple to operate etc., shortcoming is this
Course of reaction is it is generally required to add coenzyme, and coenzyme is expensive, is greatly increased production cost, is unfavorable for industrial applications.
3. oxidation-reduction method, the 2-hydroxy acid that disappears in addition, as raw material, utilizes the dehydrogenase oxidoreductase of tool enantio-selectivity, carbonyl
Mandelic acid and the derivant thereof of single configuration is prepared in reductase reduction.This method saves the time, saves extraction or the purification of middle product,
Carry out it is also possible to reduce reversible reflection to substrate direction.It it is the most valuable chirality 2-hydroxy acid acquisition methods.
The approach of 2-hydroxy acid is obtained as shown in Figure 1 at present by biological catalysis.
(3) summary of the invention
It is an object of the present invention to provide a kind of single bacterium double-mass model three enzyme series connection oxidoreduction cascade system catalysis raceme 2-hydroxyl
Acid produces the method for chirality 2-hydroxy acid, uses biological catalysis to go the oxidation-reduction method in racemization 2-hydroxy acid, it is achieved raceme
2-hydroxy acid is converted into the approach of (R)-2-hydroxy acid, and the method not only avoids the cultivation of many thalline, reduces thalline total concentration, simplifies anti-
Answer process, but also significantly improve catalytic efficiency, be more suitable for cascading the commercial Application of catalyst system and catalyzing.
The technical solution used in the present invention is:
The present invention provides a kind of method of biological enzyme synthesis (R)-2-hydroxy acid, and described method is with recombination engineering bacteria warp
The wet thallus that fermentation culture obtains is catalyst, with the hydroxy acid of raceme 2-shown in formula I as substrate, with glucose for the auxiliary end
Thing, is constituted reaction system (i.e. three enzyme coexpression systems) for reaction medium, at 20～50 DEG C (preferably with pH6.0～9.0 buffer
35 DEG C), carry out conversion reaction under the conditions of 150rpm, after reaction completely, reactant liquor is isolated and purified, it is thus achieved that (R)-2-hydroxy acid；Institute
State recombination engineering bacteria for containing 2-hydroxy acid dehydrogenase HADH gene, carbonyl reductase KAR gene and glucose dehydrogenase GDH base
The recombination bacillus coli of cause；Described 2-hydroxy acid dehydrogenase HADH gene coding amino acid sequence is SEQ ID NO.2, SEQ ID
Shown in one of NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10；Preferably SEQ ID NO.4 and SEQ ID
Shown in one of NO.8；
In formula I: m (R) represents m R group, R is hydroxyl, halogen or C1～C4 alkyl, and m is 0～2 positive integers；N is 0
～5 CH2；When preferably m is 0, R be H, n be 0,1 or 2；When m is 1, R is 2-F, 4-F, 2-Cl, 3-Cl, 4-Cl, 2-Br, 3-
Br、4-Br、4-CH3、4-CF3、3-OH、4-OH、4-OCH3Or 3-OCH3-4-OH, n are 0；When m is 2, R is 2,4-F or 3,5-F,
N is 0.
Further, the nucleotides sequence of described 2-hydroxy acid dehydrogenase HADH gene be classified as SEQ ID NO.1, SEQ ID NO.3,
Shown in one of SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9.
Further, the nucleotides sequence of described carbonyl reductase KAR gene is classified as shown in SEQ ID NO.11.
Further, the nucleotides sequence of described glucose dehydrogenase GDH gene is classified as shown in SEQ ID NO.13.
Further, in described reaction system, the consumption of catalyst is calculated as 20-60g/L (preferably 40g/ with wet thallus weight
L), Final substrate concentrations is 10-30mM (preferably 20mM), the final concentration of 10-50mM of cosubstrate (preferably 30mM).
Further, described recombination engineering bacteria is prepared as follows: 2-hydroxy acid dehydrogenase HADH gene is linked table
Reach carrier pET28b and build plasmid pET28b-HADH, then by carbonyl reductase KAR gene and glucose dehydrogenase GDH gene with
Expression vector pETDuet-1 connects structure plasmid pCDFDuet-KAR-GDH；Then by plasmid pET28b-HADH and plasmid
PCDFDuet-KAR-GDH proceeds to escherichia coli, screening positive clone, it is thus achieved that containing 2-hydroxy acid dehydrogenase HADH gene, carbonyl reduction
Enzyme KAR gene and the recombination bacillus coli of glucose dehydrogenase GDH gene.
Further, described recombination engineering bacterium fermentation cultural method is: will contain 2-hydroxy acid dehydrogenase HADH gene, carbonyl
The recombination bacillus coli of reductase KAR gene and glucose dehydrogenase GDH gene is inoculated into containing 50 μ g/mL streptomycins and 50 μ g/
In the LB fluid medium of mL kanamycin, in 37 DEG C, shaken cultivation 8～10h under the conditions of 150 revs/min, it is thus achieved that seed liquor；Will
Seed liquor by volume concentration 2% inoculum concentration accesses containing 50 μ g/mL streptomycins and the LB fluid medium of 50 μ g/mL kanamycin
In, 37 DEG C, under the conditions of 150 revs/min shaken cultivation to OD600When reaching 0.4～0.6, add IPTG to final concentration 0.1mM, in 28
DEG C, shaken cultivation 10～12h under the conditions of 150 revs/min, fermentation liquid is centrifuged, takes precipitation brine twice, centrifugal,
Collect wet thallus.
The present invention is with cheap raceme 2-hydroxy acid as substrate, and utilization has S-2-hydroxy acid dehydrogenase and carries out asymmetric
Oxidation, obtains (R)-2-hydroxy acid and the mixture of 2-keto acid, and recycling has R-stereo selectivity carbonyl reductase by therein
2-keto acid reduces, and finally makes racemic 2-hydroxy acid deracemization, obtains (R)-2-hydroxy acid, relates to chirality hydroxy acid composition principle anti-
Answer formula as in figure 2 it is shown, reaction equation lists representational 19 kinds of 2-hydroxy acids, the 2-of the present invention three enzyme coexpression system catalysis
Hydroxy acid substrate includes but not limited to this 19 kinds of 2-hydroxy acids.
Reaction system of the present invention is single bacterium double-mass model three enzyme series connection oxidoreduction cascade system, construction method include with
Lower step:
(1) E.coll BL21 (DE3)/pET28b-HADH bacterial strain is built
Design primer is to P1-F:GGAATTCCATATGATGATCATTTCCGCTTCCACC, P1-R:CCCAAGCTT
TCAGGCGCCCAGTTCGCGGACCA
In Pseudomonas aeruginosa CCTCCM 2011394, the DNA of genome is as pcr template, carries out PCR
Amplification, amplified production is that (being designated as HADH1, nucleotides sequence is classified as SEQ ID NO.1 institute to 2-hydroxy acid dehydrogenase 2-HADH gene order
Showing, aminoacid sequence is shown in SEQ ID NO.2), it is connected with expression vector pET28b and is transferred to E.coli BL21
(DE3), E.coll BL21 (DE3)/pET28b-HADH1 bacterial strain is built.
With the 2-HADH gene (i.e. HADH1) in Pseudomonas aeruginosa CCTCC M 2011394 as mould
Plate, is screened by gene excavating and differs (32.67-35.15%) four 2-HADH sequences with template peptide sequence homology
HADH2, HADH3, HADH4, HADH5, be respectively derived from: Burkholderia xenovorans LB400 (ABE35802.1),
Pseudomonas putida(AAC15503.1),Pseudomonas aeruginosa strain NUST
(AGM49308.1),Pseudomonas fluorescens strain EBC191(AAW79575.1)。
Connect the 2-hydroxy acid dehydrogenase 2-HADH base in Burkholderia xenovorans LB400 (ABE35802.1)
Because sequence (being designated as HADH2, nucleotides sequence is classified as shown in SEQ ID NO.3, and aminoacid sequence is shown in SEQ ID NO.4) arrives
PET28b and be transferred to E.coli BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-HADH2 bacterial strain.
The 2-hydroxy acid dehydrogenase 2-HADH gene order connected in Pseudomonas putida (is designated as HADH3, nucleotide
Sequence is shown in SEQ ID NO.5, and aminoacid sequence is shown in SEQ ID NO.6) to pET28b and be transferred to E.coli
BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-HADH3 bacterial strain.
Connect the 2-hydroxy acid dehydrogenase 2-HADH gene order in Pseudomonas aeruginosa strain NUST
(being designated as HADH4, nucleotides sequence is classified as shown in SEQ ID NO.7, and aminoacid sequence is shown in SEQ ID NO.8) arrives pET28b also
And it is transferred to E.coli BL21 (DE3), build E.coll BL21 (DE3)/pET28b-HADH4 bacterial strain.
Connect the 2-hydroxy acid dehydrogenase 2-HADH gene sequence in Pseudomonas fluorescens strain EBC191
Row (being designated as HADH5, nucleotides sequence is classified as shown in SEQ ID NO.9, and aminoacid sequence is shown in SEQ ID NO.10) arrive
PET28b and be transferred to E.coli BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-HADH5 bacterial strain.
(2) E.coli BL21 (DE3)/pCDFDuet-KAR-GDH bacterial strain is built
Design primer is to P2-F:AGGCCATGGGTAAAATCGCAATTGCCG, P2-R:
AATCTCGAGGATCTCGAAGTTCTCTTGC
With Leuconostoc mesenteroides CCTCC M 2016063 (Leuconostoc mesenteroides (Leuconostoc
Mesenteroides) ZJB161 is preserved in China typical culture collection center, and preservation date is on January 25th, 2016, preservation
Numbered CCTCC M 2016063, preservation address is Wuhan, China Wuhan University, postcode 430072) in the DNA of genome be
Pcr template, carries out PCR amplification, and amplified production is that (nucleotides sequence is classified as SEQ ID to carbonyl reductase KAR gene order Seq-KAR
Shown in NO.11, aminoacid sequence is shown in SEQ ID NO.12).
Design primer is to P3-F:AGGCATATGTATAATTCTCTGAAAGGG, P3-R:
AGGCTCGAGTCAACCACGGCCAGCCTG
In Exiguobacterium sibiricum, the DNA of genome is as pcr template, carries out PCR amplification, and amplification is produced
Thing is that (nucleotides sequence is classified as shown in SEQ ID NO.13 glucose dehydrogenase gene sequence Seq-GDH, and aminoacid sequence is SEQ
Shown in ID NO.14).
Seq-KAR, Seq-GDH are successively connected with expression vector pETDuet-1, construction recombination plasmid pCDFDuet-
KAR-GDH, and proceed to E.coli BL21 (DE3), build E.coli BL21 (DE3)/pCDFDuet-KAR-GDH bacterial strain.
(3) E.coli BL21 (DE3)/pET28b-HADH/pCDFDuet-KAR-GDH bacterial strain is built
Build three expression of enzymes systems by the method for a bacterium double-mass model, respectively from bacterial strain E.coli BL21 (DE3)/
PET28b-HADH1, bacterial strain E.coli BL21 (DE3)/pET28b-HADH2, bacterial strain E.coli BL21 (DE3)/pET28b-
HADH3, bacterial strain E.coli BL21 (DE3)/pET28b-HADH4, bacterial strain E.coli BL21 (DE3)/pET28b-HADH5 and bacterium
In strain E.coli BL21 (DE3)/pCDFDuet-KAR-GDH extract plasmid pET28b-HADH1, pET28b-HADH2,
PET28b-HADH3, pET28b-HADH4, pET28b-HADH5 and pCDFDuet-KAR-GDH, by plasmid pET28b-HADH1,
PET28b-HADH2, pET28b-HADH3, pET28b-HADH4, pET28b-HADH5 press dense with pCDFDuet-KAR-GDH respectively
Spend after mixing than 1:1, proceed to E.coli BL21 (DE3)., it is respectively coated containing 50 μ g/mL streptomycins and 50 μ g/mL cards that is mould
In the dual anti-LB flat board of element, screen containing 2-hydroxy acid dehydrogenase HADH gene, carbonyl reductase KAR gene and glucose dehydrogenase
The recombination bacillus coli of GDH gene, respectively bacterial strain E.coli BL21 (DE3)/pET28b-HADH1/pCDFDuet-KAR-
GDH, bacterial strain E.coli BL21 (DE3)/pET28b-HADH2/pCDFDuet-KAR-GDH, bacterial strain E.coli BL21 (DE3)/
PET28b-HADH3/pCDFDuet-KAR-GDH, bacterial strain E.coli BL21 (DE3)/pET28b-HADH4/pCDFDuet-KAR-
GDH and bacterial strain E.coli BL21 (DE3)/pET28b-HADH5/pCDFDuet-KAR-GDH.
The positive beneficial effect of the present invention:
(1) present invention passes through a bacterium double-mass model three enzyme coexpression system by raceme 2-hydroxy acid living things catalysis cheap and easy to get
For there being the R-2-hydroxy acid of significant application value, this cascade reaction makes S-2-hydroxy acid be fully converted to its optics mapping in theory
Body, low cost, environmental protection, technique simplifies, is suitable to industrialized production.
(2) theoretical yield of the inventive method can reach 100%, is a kind of environmental friendliness, economic R-2-hydroxy acid list
One optical antipode preparation method, wherein S-2-hydroxy acid dehydrogenase, carbonyl reductase and glucose dehydrogenase gene are to be located away from
The native sequences of organism, or activity expression can be obtained in corresponding host after transformation.Reaction system is auxiliary with NADH
The factor, glucose dehydrogenase can maintain catalytic reaction order to carry out with oxidizing glucose and produce appropriate NADH.
(3) present invention one bacterium double-mass model three enzyme coexpression system, the success of innovation realizes racemic 2-hydroxy acid by one
Individual engineering bacteria is converted into (R)-2-hydroxy acid of single configuration, it is to avoid the cultivation of many thalline, reduces thalline total concentration, simplifies and reacted
Journey, decreases the extraction step of intermediate product, but also significantly improves catalytic efficiency, is more suitable for cascading the industry of catalyst system and catalyzing
Application.
(4) accompanying drawing explanation
Fig. 1 is the approach schematic diagram that biological catalysis obtains 2-hydroxy acid.
Fig. 2 is chirality hydroxy acid composition principle reaction equation.
Fig. 3 represents the connection of (S)-2-hydroxy acid dehydrogenase gene HADH4 body pET28b；
Fig. 4 represents carbonyl reductase gene KAR and the connection of glucose dehydrogenase gene GDH Yu pETDuet-1.
Fig. 5 represents that three enzyme coexpression system catalysis raceme 2-hydroxy acids are converted into (R)-2 hydroxy acid schematic diagram
Fig. 6 recombination engineering E.coli BL21 (DE3)/pCDFDuet-KAR-GDH and E.coli BL21 (DE3)/
PET28b-GDH enzyme protein expression electrophoretic analysis；1.E.coli BL21(DE3)/pCDFDuet-KAR-GDH with 0.1mM
IPTG；2.E.coli BL21(DE3)/pCDFDuet-KAR-GDH with 0mM IPTG；3.E.coli BL21(DE3)/
pET28b-GDH with 0.1mM IPTG；4.E.coli BL21(DE3)/pET28b-GDH with 0mM IPTG；
5.Empty plasmid of pET28b with 0mM IPTG.The upper arrow in lane 1 indicated
KAR (～32kDa) and the lower arrow in lane 1represented GDH (～28kDa) .The
Prominent protein band in lane 3indicated GDH (～28kDa).
Fig. 7 E.coli BL21 (DE3)/pET28b-HADH4/pCDFDuet-KAR-GDH expresses HADH4, KAR and
GDH electrophoretic analysis；1.Protein molecular weight markers；2.E.coli BL21(DE3)/pET28b-
HADH/pCDFDuet-KAR-GDH.with 0mM IPTG.3.E.coli BL21(DE3)/pET28b-HADH/pCDFDuet-
KAR-GDH.with 0.1mM IPTG.The upper arrow indicated HADH (～42kDa), the middle
Arrow indicated KAR (～32kDa) and the lower arrow represented GDH (～28kDa)..
Fig. 8 removes racemic mandelic acid reaction process.
(5) detailed description of the invention
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This:
Embodiment 1:
Build recombinant bacterial strain E.coli BL21 (DE3)/pET28b-HADH1/pCDFDuet-KAR-GDH
(1) design primer is to P1-F:GGAATTCCATATGATGATCATTTCCGCTTCCACC, P1-R:CCCAAGCTT
TCAGGCGCCCAGTTCGCGGACCA.With the DNA of genome in Pseudomonas aeruginosa CCTCCM 2011394
For pcr template, carry out PCR amplification, PCR reaction process: 95 DEG C of 5min, 95 DEG C of 1min, 57 DEG C of 1min, 72 DEG C of 1min
(30cycles)；72 DEG C of 10min, 4 DEG C of for ever.
Reaction system is as follows:
Amplified production is 2-hydroxy acid dehydrogenase 2-HADH gene order, and (nucleotides sequence is classified as SEQ ID to be designated as HADH1
Shown in NO.1, aminoacid sequence is shown in SEQ ID NO.2).PCR primer, through agarose gel electrophoresis purification, utilizes agarose
Gel DNA reclaims test kit and reclaims target stripe.It is connected with expression vector pET28b after double digestion and is transferred to E.coli
BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-HADH1 bacterial strain.
(2) design primer is to P2-F:AGGCCATGGGTAAAATCGCAATTGCCG, P2-R:
AATCTCGAGGATCTCGAAGTTCTCTTGC.With base in Leuconostoc mesenteroides CCTCC M 2016063
Because the DNA of group is pcr template, carry out PCR amplification, PCR reaction process: 95 DEG C of 5min, 95 DEG C of 1min, 65 DEG C of 1min, 72 DEG C
1min(30cycles)；72 DEG C of 10min, 4 DEG C of for ever.
Reaction system is as follows:
Amplified production be carbonyl reductase KAR gene order Seq-KAR (nucleotides sequence is classified as shown in SEQ ID NO.11,
Aminoacid sequence is shown in SEQ ID NO.12).PCR primer, through agarose gel electrophoresis purification, utilizes agarose gel DNA to return
Receive test kit and reclaim target stripe.
(3) design primer is to P3-F:AGGCATATGTATAATTCTCTGAAAGGG, P3-R:
AGGCTCGAGTCAACCACGGCCAGCCTG.In Exiguobacterium sibiricum, the DNA of genome is for PCR mould
Plate, carries out PCR amplification, PCR reaction process: 95 DEG C of 5min, 94 DEG C of 50s, 50 DEG C of 1.5min, 72 DEG C of 1min
(30cycles), 72 DEG C of 10min, 4 DEG C of for ever.
Amplified production is that (nucleotides sequence is classified as shown in SEQ ID NO.13 glucose dehydrogenase gene sequence Seq-GDH, ammonia
Base acid sequence is shown in SEQ ID NO.14).PCR primer, through agarose gel electrophoresis purification, utilizes agarose gel DNA to reclaim
Test kit reclaims target stripe.
Seq-KAR, Seq-GDH are successively connected with expression vector pETDuet-1 after double digestion, construction recombination plasmid
PCDFDuet-KAR-GDH, with reference to Fig. 4.
Three expression of enzymes systems are built, by plasmid pET28b-HADH1 and pCDFDuet-by the method for a bacterium double-mass model
KAR-GDH, after mixing by 1:1, by conventional heat shock method or electric shocking method, proceeds in E.coli BL21 (DE3) competence, coating
In the dual anti-LB flat board containing 50 μ g/mL streptomycins and 50 μ g/mL kanamycin, screen E.coli BL21 (DE3)/
PET28b-HADH1/pCDFDuet-KAR-GDH bacterial strain.
Embodiment 2:
Build recombinant bacterial strain E.coli BL21 (DE3)/pET28b-HADH2/pCDFDuet-KAR-GDH
2-hydroxy acid dehydrogenase 2-HADH base in synthesis Burkholderia xenovorans LB400 (ABE35802.1)
Because of sequence, it is designated as HADH2 (nucleotides sequence is classified as shown in SEQ ID NO.3, and aminoacid sequence is shown in SEQ ID NO.4), even
Receive pET28b and be transferred to E.coli BL21 (DE3), building E.coll BL21 (DE3)/pET28b-HADH2 bacterial strain.
The structure of recombiant plasmid pCDFDuet-KAR-GDH is with embodiment 1, with reference to Fig. 2.
Three expression of enzymes systems are built, by plasmid pET28b-HADH2 and pCDFDuet-by the method for a bacterium double-mass model
KAR-GDH, after mixing by 1:1, by conventional heat shock method or electric shocking method, proceeds in E.coli BL21 (DE3) competence, coating
In the dual anti-flat board containing streptomycin and kanamycin, screen E.coli BL21 (DE3)/pET28b-HADH2/
PCDFDuet-KAR-GDH bacterial strain, operation is with embodiment 1.
Embodiment 3:
Build recombinant bacterial strain E.coli BL21 (DE3)/pET28b-HADH3/pCDFDuet-KAR-GDH
2-hydroxy acid dehydrogenase 2-HADH gene order in synthesis Pseudomonas putida, is designated as HADH3 (nucleotide
Sequence is shown in SEQ ID NO.5, and aminoacid sequence is shown in SEQ ID NO.6), it is connected to pET28b and is transferred to
E.coli BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-HADH3 bacterial strain.
The structure of recombiant plasmid pCDFDuet-KAR-GDH is with embodiment 1, with reference to Fig. 2.
Three expression of enzymes systems are built, by plasmid pET28b-HADH3 and pCDFDuet-by the method for a bacterium double-mass model
KAR-GDH, after mixing by 1:1, by conventional heat shock method or electric shocking method, proceeds in E.coli BL21 (DE3) competence, coating
In the dual anti-flat board containing streptomycin and kanamycin, screen E.coli BL21 (DE3)/pET28b-HADH3/
PCDFDuet-KAR-GDH bacterial strain, operation is with embodiment 1.
Embodiment 4:
Build recombinant bacterial strain E.coli BL21 (DE3)/pET28b-HADH4/pCDFDuet-KAR-GDH
2-hydroxy acid dehydrogenase 2-HADH gene order in synthesis Pseudomonas aeruginosa strain NUST,
It is designated as HADH4 (nucleotides sequence is classified as shown in SEQ ID NO.7, and aminoacid sequence is shown in SEQ ID NO.8), is connected to
PET28b and be transferred to E.coli BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-HADH4 bacterial strain.
The structure of recombiant plasmid pCDFDuet-KAR-GDH is with embodiment 1, with reference to Fig. 2.
Three expression of enzymes systems are built, by plasmid pET28b-HADH4 and pCDFDuet-by the method for a bacterium double-mass model
KAR-GDH, after mixing by 1:1, by conventional heat shock method or electric shocking method, proceeds in E.coli BL21 (DE3) competence, coating
In the dual anti-flat board containing streptomycin and kanamycin, screen E.coli BL21 (DE3)/pET28b-HADH4/
PCDFDuet-KAR-GDH bacterial strain, operation is with embodiment 1.
Embodiment 5:
Build recombinant bacterial strain E.coli BL21 (DE3)/pET28b-HADH5/pCDFDuet-KAR-GDH
2-hydroxy acid dehydrogenase 2-HADH gene sequence in synthesis Pseudomonas fluorescens strain EBC191
Row, are designated as HADH5 (nucleotides sequence is classified as shown in SEQ ID NO.9, and aminoacid sequence is shown in SEQ ID NO.10), are connected to
PET28b and be transferred to E.coli BL21 (DE3), builds E.coll BL21 (DE3)/pET28b-H ADH5 bacterial strain.
The structure of recombiant plasmid pCDFDuet-KAR-GDH is with embodiment 1, with reference to Fig. 2.
Three expression of enzymes systems are built, by plasmid pET28b-HADH5 and pCDFDuet-by the method for a bacterium double-mass model
KAR-GDH, after mixing by 1:1, by conventional heat shock method or electric shocking method, proceeds in E.coli BL21 (DE3) competence, coating
In the dual anti-flat board containing streptomycin and kanamycin, screen E.coli BL21 (DE3)/pET28b-HADH5/
PCDFDuet-KAR-GDH bacterial strain, operation is with embodiment 1.
Embodiment 6: the preparation of resting cell
The restructuring double-mass model engineering bacteria that embodiment 1-5 builds is inoculated into respectively containing 50 μ g/mL streptomycins and 50 μ g/mL cards
In the LB fluid medium of that mycin, in 37 DEG C of shaking tables, rotating speed 150 revs/min, shaken cultivation 8～10h is as seed liquor, by body
Volume concentrations 2% inoculum concentration is respectively connected in the LB fluid medium containing 50 μ g/mL streptomycins and 50 μ g/mL kanamycin, 37 DEG C
Shaking table, rotating speed 150 revs/min, shaken cultivation to OD600When reaching 0.4～0.6, add IPTG to final concentration 0.1mM, shake in 28 DEG C
Bed, rotating speed 150 revs/min, shaken cultivation 10～12h.Terminate after fermentation liquid to be centrifuged, take precipitation and with brine twice,
Collected after centrifugation wet thallus cell is standby.
Embodiment 7: utilize 5 recombination engineerings to remove racemization racemic mandelic acid
Using racemic mandelic acid as benchmark substrate, in detection embodiment 1-5,5 recombination engineerings go racemization raceme flat
The catalytic efficiency of Fructus Persicae acid.Method by embodiment 6, it is thus achieved that embodiment 1 recombination engineering E.coli BL21 (DE3)/
PET28b-HADH1/pCDFDuet-KAR-GDH, embodiment 2 recombination engineering E.coli BL21 (DE3)/pET28b-HADH2/
PCDFDuet-KAR-GDH, embodiment 3 recombination engineering E.coli BL21 (DE3)/pET28b-HADH3/pCDFDuet-KAR-
GDH, embodiment 4 recombination engineering E.coli BL21 (DE3)/pET28b-HADH4/pCDFDuet-KAR-GDH and embodiment 5
The wet thallus of recombination engineering E.coli BL21 (DE3)/pET28b-HADH5/pCDFDuet-KAR-GDH, and comparison containing only
The wet thallus of thalline E.coli BL21 (the DE3)/pET28b/pCDFDuet of empty plasmid pET28b and pCDFDuet, claims respectively
Take 0.4 gram to convert in bottle in 50mL triangle, add in reaction system dissolved with substrate racemic mandelic acid 20mM, cosubstrate
The phosphate buffer 1 0ml of the 100mM of the pH7.5 of glucose 30mM, oxidation reaction and reduction reaction are carried out simultaneously, in 35 DEG C,
150rpm shaking bath converts 2h.
Reacting two hours after terminating, conversional solution centrifugal segregation thalline, supernatant carries out Liquid Detection analysis.Through detection
Analyzing, catalytic reaction does not occur in matched group, (S)-mandelic acid is not converted to (R)-mandelic acid.Embodiment 1 recombined engineering
Bacterium, embodiment 2 recombination engineering, embodiment 3 recombination engineering, embodiment 4 recombination engineering and embodiment 5 recombination engineering
(R) yield of-mandelic acid is respectively 60.2%, 90.5%, 73.0%, 95.2% and 60.4%.(R) yield of-mandelic acid is equal
More than 50%, show that engineering bacteria successfully constructs.Choose transformation efficiency the highest embodiment 4 recombination engineering E.coli BL21
(DE3)/pET28b-HADH4/pCDFDuet-KAR-GDH, as object of study, removes 19 kinds of raceme 2-hydroxy acid acid (1a-of racemization
1s)。
The enantiomeric excess value (e.e.) of substrate and the detection of conversion ratio and product keto acid use high-efficient liquid phase technique analysis inspection
Survey, specific as follows: anti-phase chiral column (model C hirobioticTMR250 × 4.6mm, Sigma, USA), flowing is 0.5% mutually
AcOH:CH3CN (20: 80, v/v), detection wavelength is 215nm, sample size 3 μ L.
The computational methods of e.e value: ee (%)=(R-S)/(R+S) × 100%；(R) computational methods of-2-hydroxy acid yield: Y
(%)=R/C × 100%.In formula, R represents that reaction terminates the concentration of rear (R)-2-hydroxy acid；S represents that reaction terminates rear (S)-2-hydroxyl
The concentration of acid；The concentration of raceme 2-hydroxy acid when C represents initial action.
Embodiment 8: differential responses condition goes racemization racemic mandelic acid to produce (R)-mandelic acid
Method by embodiment 6, it is thus achieved that embodiment 4 recombination engineering E.coli BL21 (DE3)/pET28b-HADH4/
The wet thallus of pCDFDuet-KAR-GDH, studies cell concentration 20g/L, 40g/L, 60g/L, substrate racemic mandelic acid concentration
10mM, 20mM, 30mM and cosubstrate concentration of glucose 10mM, 30mM, 50mM remove racemization benchmark substrate racemic mandelic acid.Instead
Should carry out in 50mL triangular flask, reaction system 10mL, use the phosphate buffer of 100mM of pH7.5, oxidation reaction and also
Former reaction is carried out simultaneously, in 35 DEG C, converts 2h in 150rpm shaking bath.
After reaction terminates, conversional solution centrifugal segregation thalline, supernatant uses the detection method in embodiment 7 to carry out detection point
Analysis.Detect and be analyzed as follows table:
Embodiment 9: go 19 kinds of raceme 2-hydroxy acids acid (1a-1s) of racemization to produce (R)-2-hydroxy acid
Method by embodiment 6, it is thus achieved that embodiment 4 recombination engineering E.coli BL21 (DE3)/pET28b-HADH4/
The wet thallus of pCDFDuet-KAR-GDH, weigh respectively 0.4 gram in 19 50mL trianglees convert bottle, add in reaction system
Enter dissolved with substrate raceme 2-hydroxy acid 20mM, the phosphate buffer of the 100mM of the pH7.5 of cosubstrate glucose 30mM
10ml, oxidation reaction and reduction reaction are carried out simultaneously, in 35 DEG C, convert 2-6h in 150rpm shaking bath.
After reaction terminates, conversional solution centrifugal segregation thalline, supernatant uses the detection method in embodiment 7 to carry out detection point
Analysis.Detect and be analyzed as follows table:
Reaction result shows, most of 2-hydroxy acids (1a-1c, 1e-1m and 1s), through the reaction of 2h, (R)-2-hydroxy acid
Yield reaches 92.7-98.5%, e.e value and is more than 99%, and 1d reaches 95.9% through the reaction of 4h, the yield of (R)-2-hydroxy acid,
E.e value is more than 99%.For 1p-1q, through the reaction of 6h, e.e value is also greater than 99.9%, but the yield of (R)-enantiomer is not
Height, keto acid obtains substantial amounts of accumulation, shows recombination engineering E.coli BL21 (DE3)/pET28b-HADH4/ in course of reaction
In pCDFDuet-KAR-GDH, keto acid enzyme corresponding for 1p-1q is lived the highest by KAR, it is impossible to keto acid transformation is become (R)-enantiomer, separately
The yield of (R)-2-hydroxy acid of outer 1q is less than 50%, and the content of keto acid is more than 50%, shows that HADH4 is to its selective oxidation also
Poor.For 1n-1o, through the reaction of 6h, e.e value is the highest, also has (S)-2-hydroxy acid residual, simultaneously (R)-right in reaction system
The yield reflecting body only has 35.5% and 34.6%, and reaction terminates rear keto acid content and is more than 50%, and this shows recombination engineering
In E.coli BL21 (DE3)/pET28b-HADH4/pCDFDuet-KAR-GDH, HADH4 is poor to the selectivity of 1n-1o, oxidation
Also at oxidation (R)-enantiomer while (s)-enantiomer, but the enzyme of (s)-enantiomer is lived more than the enzyme to (R)-enantiomer
Live.
The success setting up innovation of single bacterium double-mass model multienzyme cascade system realizes racemic 2-hydroxy acid by an engineering
Bacterium E.coli BL21 (DE3)/pET28b-HADH4/pCDFDuet-KAR-GDH is converted into (R)-2-hydroxy acid of single configuration, to the greatest extent
Pipe does not all show high yield and high selectivity to all of substrate, but is all demonstrated by higher to most 2-hydroxy acids
E.e value and (R)-enantiomer yield (more than 90%), much larger than the theoretical receipts to the maximum 50% that racemic 2-hydroxy acid splits
Rate.Particularly to o-chloromandelic acid, (e.e is more than 99%, (R)-o-chloromandelic acid global marketing volume second for 1f, yield 98.2%
The important chiral building block of medicine clopidogrel synthesis), (e.e is more than 99% to 4-chloro mandelic acid, (R)-4-chlorine for 1h, yield 97.7%
Mandelic acid is the important source material of novel oomycetes diseases antibacterial mandipropamid synthesis), mandelic acid (1a, yield 95.2%,
E.e be more than 99%, for the amino acid whose asymmetric synthesis of optical voidness) etc. be demonstrated by higher yield and e.e value, it is achieved that list bacterium
Double-mass model multienzyme cascade system is converted into raceme 2-hydroxy acid the approach of (R)-2-hydroxy acid.
Claims (10)
1. the method for biological enzyme synthesis (R)-2-hydroxy acid, it is characterised in that described method is sent out with recombination engineering bacteria warp
It is catalyst that ferment cultivates the wet thallus obtained, with the hydroxy acid of raceme 2-shown in formula I as substrate, with glucose as cosubstrate,
Constituted reaction system with pH6.0～9.0 buffer for reaction medium, 20～50 DEG C, carry out conversion reaction under the conditions of 150rpm,
After reaction completely, reactant liquor is isolated and purified, it is thus achieved that (R)-2-hydroxy acid；Described recombination engineering bacteria is containing 2-hydroxy acid dehydrogenase
HADH gene, carbonyl reductase KAR gene and the recombination bacillus coli of glucose dehydrogenase GDH gene；Described 2-hydroxy acid dehydrogenation
Enzyme HADH gene coding amino acid sequence is SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or
Shown in one of SEQ ID NO.10；
In formula I: m (R) represents m R group, R is hydroxyl, halogen or C1～C4 alkyl, and m is 0～2 positive integers；N is 0～5
CH2。
2. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described 2-hydroxy acid dehydrogenase
The nucleotides sequence of HADH gene is classified as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID
Shown in one of NO.9.
3. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described 2-hydroxy acid dehydrogenase
HADH gene coding amino acid sequence is shown in one of SEQ ID NO.4 or SEQ ID NO.8.
4. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described carbonyl reductase KAR
The nucleotides sequence of gene is classified as shown in SEQ ID NO.11.
5. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described glucose dehydrogenase
The nucleotides sequence of GDH gene is classified as shown in SEQ ID NO.13.
6. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that in described reaction system, urge
The consumption of agent is calculated as 20-60g/L with wet thallus weight, and Final substrate concentrations is 10-30mM, the final concentration of 10-of cosubstrate
50mM。
7. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described recombination engineering
Bacterium is prepared as follows: 2-hydroxy acid dehydrogenase HADH gene is linked expression vector pET28b and builds plasmid pET28b-HADH,
Carbonyl reductase KAR gene and glucose dehydrogenase GDH gene are connected with expression vector pETDuet-1 structure plasmid again
pCDFDuet-KAR-GDH；Then plasmid pET28b-HADH and plasmid pCDFDuet-KAR-GDH is proceeded to escherichia coli, screening
Positive colony, it is thus achieved that containing 2-hydroxy acid dehydrogenase HADH gene, carbonyl reductase KAR gene and glucose dehydrogenase GDH gene
Recombination bacillus coli.
8. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described recombination engineering
Fungus fermentation culturing method is: will contain 2-hydroxy acid dehydrogenase HADH gene, carbonyl reductase KAR gene and glucose dehydrogenase GDH
The recombination bacillus coli of gene is inoculated in the LB fluid medium containing 50 μ g/mL streptomycins and 50 μ g/mL kanamycin, in 37
DEG C, shaken cultivation 8～10h under the conditions of 150 revs/min, it is thus achieved that seed liquor；Seed liquor by volume concentration 2% inoculum concentration is accessed and contains
In the LB fluid medium of 50 μ g/mL streptomycins and 50 μ g/mL kanamycin, 37 DEG C, shaken cultivation is extremely under the conditions of 150 revs/min
OD600When reaching 0.4～0.6, add IPTG to final concentration 0.1mM, in 28 DEG C, under the conditions of 150 revs/min shaken cultivation 10～
12h, is centrifuged fermentation liquid, takes precipitation brine twice, centrifugal, collects wet thallus.
9. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that described reaction temperature is 35
℃。
10. the method that biological enzyme synthesizes (R)-2-hydroxy acid as claimed in claim 1, it is characterised in that in described reaction system,
The consumption of catalyst is calculated as 40g/L with wet thallus weight, and Final substrate concentrations is 20mM, the final concentration of 30mM of cosubstrate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610080101.3A CN105755095B (en) | 2016-02-04 | 2016-02-04 | A kind of method of biological enzyme synthesis (R) -2- hydroxy acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610080101.3A CN105755095B (en) | 2016-02-04 | 2016-02-04 | A kind of method of biological enzyme synthesis (R) -2- hydroxy acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105755095A true CN105755095A (en) | 2016-07-13 |
| CN105755095B CN105755095B (en) | 2019-10-29 |
Family
ID=56330655
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610080101.3A Active CN105755095B (en) | 2016-02-04 | 2016-02-04 | A kind of method of biological enzyme synthesis (R) -2- hydroxy acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755095B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108410831A (en) * | 2018-03-22 | 2018-08-17 | 浙江工业大学 | Ketone acid reductase, gene, engineering bacteria and the application in synthesis of chiral fragrance 2- hydroxy acids |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102660471A (en) * | 2012-04-13 | 2012-09-12 | 浙江工业大学 | Production of chiral alpha-hydroxy acid and its strain by using biological catalysis method |
| CN104263742A (en) * | 2014-08-29 | 2015-01-07 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
| CN104630242A (en) * | 2015-01-20 | 2015-05-20 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
-
2016
- 2016-02-04 CN CN201610080101.3A patent/CN105755095B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102660471A (en) * | 2012-04-13 | 2012-09-12 | 浙江工业大学 | Production of chiral alpha-hydroxy acid and its strain by using biological catalysis method |
| CN104263742A (en) * | 2014-08-29 | 2015-01-07 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
| CN104630242A (en) * | 2015-01-20 | 2015-05-20 | 浙江工业大学 | Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 钱晶等: "(R)-邻氯扁桃酸的制备技术进展", 《化工进展》 * |
| 陈艳等: "生物催化法合成R-扁桃酸的研究进展", 《精细与专用化学品》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108410831A (en) * | 2018-03-22 | 2018-08-17 | 浙江工业大学 | Ketone acid reductase, gene, engineering bacteria and the application in synthesis of chiral fragrance 2- hydroxy acids |
| CN108410831B (en) * | 2018-03-22 | 2021-07-27 | 浙江工业大学 | Ketoacid reductase, gene, engineering bacterium and application in synthesis of chiral aromatic 2-hydroxy acid |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105755095B (en) | 2019-10-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101230363B (en) | Method for preparing (R)-styrene glycol by employing asymmetric conversion of recombinant strain | |
| JP6444419B2 (en) | Sporolactobacillus terae and its use | |
| CN104388373A (en) | Construction of escherichia coli system with coexpression of carbonyl reductase Sys1 and glucose dehydrogenase Sygdh | |
| CN101535467A (en) | A levorotatory lactonohydrolase producing strain and its use for producing chiral oxyacid | |
| CN104152506A (en) | Method catalytically synthesizing (S)-N, N-dimethyl-3-hydroxy-(2-thiofuran)-1-propylamine((S)-DHTP) by aldehyde ketone reductase recombinant strain crude enzyme system | |
| CN104152478A (en) | Method for coproducing D-arginine and gamatine through biotransformation | |
| CN112126610A (en) | Engineering bacterium for producing hydroxytyrosol | |
| CN110724654B (en) | Pseudomonas aeruginosa for producing 5-hydroxymethyl-2-furancarboxylic acid and application thereof | |
| CN108410831B (en) | Ketoacid reductase, gene, engineering bacterium and application in synthesis of chiral aromatic 2-hydroxy acid | |
| CN110229796A (en) | Ketoreductase mutant and its preparing the application in Duloxetine chirality alcohol intermediate and the like | |
| CN101407780B (en) | Method for preparing (R)-styrene glycol by changing coenzyme specificity and stereoselectivity via site-directed mutagenesis | |
| CN116814572A (en) | Carbonyl reductase and mutant thereof and application of carbonyl reductase and mutant in preparation of chiral (R) -8-chloro-6-hydroxy ethyl octanoate | |
| CN105755095B (en) | A kind of method of biological enzyme synthesis (R) -2- hydroxy acid | |
| CN114350630B (en) | L-pantolactone dehydrogenase, mutant and application thereof | |
| CN103131659A (en) | Organic solvent-resistant lipase, encoding gene thereof, producing strain and application | |
| JP2010532992A (en) | Microbial kinetic resolution of ethyl 3,4-epoxybutyrate | |
| CN105950595B (en) | (-)-gamma-lactam enzyme, gene, mutant, carrier and its preparation and application | |
| CN110358804B (en) | Enzyme method production process of R-3-amino n-butanol | |
| Singh et al. | Enantioselective transesterification of (RS)-1-chloro-3-(3, 4-difluorophenoxy)-2-propanol using Pseudomonas aeruginosa lipases | |
| CN102925368B (en) | Beauveria bassiana capable of catalyzing asymmetric reduction reaction and application thereof | |
| CN102559570B (en) | Engineering bacteria for expressing L-lactate dehydrogenase subjected to orthogenetic evolution and application thereof | |
| CN101724597B (en) | Method for optimizing and improving biotransformation efficiency of (R)-carbonyl reductase by mRNA two-stage structure | |
| CN104928265B (en) | A kind of Ketoreductase mutant and its preparation and application | |
| CN114774491B (en) | Method for preparing (2S, 3R) -2- (phthalimidomethyl) -3-hydroxybutyrate | |
| CN102660624B (en) | Alpha-hydroxy acid deracemisation method and strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |