CN112342178B - Recombinant microorganism, preparation method thereof and application thereof in producing tagatose - Google Patents

Recombinant microorganism, preparation method thereof and application thereof in producing tagatose Download PDF

Info

Publication number
CN112342178B
CN112342178B CN202011224203.0A CN202011224203A CN112342178B CN 112342178 B CN112342178 B CN 112342178B CN 202011224203 A CN202011224203 A CN 202011224203A CN 112342178 B CN112342178 B CN 112342178B
Authority
CN
China
Prior art keywords
tagatose
ala
glucose
recombinant
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202011224203.0A
Other languages
Chinese (zh)
Other versions
CN112342178A (en
Inventor
马延和
石婷
宋云洪
张婷
李运杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Yihe Biotechnology Co ltd
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN202011224203.0A priority Critical patent/CN112342178B/en
Publication of CN112342178A publication Critical patent/CN112342178A/en
Priority to US18/252,001 priority patent/US20240026402A1/en
Priority to JP2023528015A priority patent/JP2023551790A/en
Priority to PCT/CN2021/124427 priority patent/WO2022095684A1/en
Priority to EP21888381.7A priority patent/EP4273224A1/en
Priority to KR1020237018501A priority patent/KR20230095120A/en
Application granted granted Critical
Publication of CN112342178B publication Critical patent/CN112342178B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01002—Glucokinase (2.7.1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01011—6-Phosphofructokinase (2.7.1.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/0104—Pyruvate kinase (2.7.1.40)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01105—6-Phosphofructo-2-kinase (2.7.1.105)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01144—Tagatose-6-phosphate kinase (2.7.1.144)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/11—Protein-serine/threonine kinases (2.7.11)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y501/00—Racemaces and epimerases (5.1)
    • C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y501/00—Racemaces and epimerases (5.1)
    • C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)
    • C12Y501/03015—Glucose-6-phosphate 1-epimerase (5.1.3.15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/01—Intramolecular oxidoreductases (5.3) interconverting aldoses and ketoses (5.3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/01—Intramolecular oxidoreductases (5.3) interconverting aldoses and ketoses (5.3.1)
    • C12Y503/01009—Glucose-6-phosphate isomerase (5.3.1.9)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/02—Phosphotransferases (phosphomutases) (5.4.2)
    • C12Y504/02002—Phosphoglucomutase (5.4.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/101—Plasmid DNA for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli

Abstract

The present disclosure relates to recombinant microorganisms, methods of making the same, and uses thereof in the production of tagatose. In particular, the present disclosure relates to a recombinant microorganism genetically engineered, a method of preparing the recombinant microorganism, an application in producing tagatose, and a tagatose-producing strain and a method of producing tagatose. The recombinant microorganisms of the present disclosure enable the production of tagatose using glucose as a substrate, or using glycerol and glucose as substrates. The efficiency of producing tagatose by recombinant microorganism conversion is high, multi-enzyme purification process steps are not needed, the raw materials are low in price and wide in source, the cost for producing tagatose and environmental pollution are reduced, and the method has important industrial application value.

Description

Recombinant microorganism, preparation method thereof and application thereof in producing tagatose
Technical Field
The disclosure belongs to the technical field of biotechnology and genetic engineering, and particularly relates to a recombinant microorganism, a preparation method of the recombinant microorganism, application of the recombinant microorganism in tagatose production, a tagatose production strain and a method for producing tagatose.
Background
Tagatose is a naturally occurring rare ketohexose that is an isomer of aldose galactose and is also an epimer of fructoseA structure body. Tagatose has a sweetness characteristic similar to sucrose with only one third of the calories of sucrose, and is called a low-calorie sweetener. The natural tagatose is mainly present in dairy products such as yogurt, milk powder and the like. Tagatose provides very fresh and pure sweetness, and its taste characteristics are similar to fructose. Researches show that the tagatose has important physiological functions of low calorie, low glycemic index, caries resistance, oxidation resistance, prebiotics, intestinal function improvement, immunoregulation, prodrug and the like, can be widely applied to the fields of food, beverage, medicine, health care and the like, and has great economic value[1]。
At present, tagatose is produced mainly by a chemical synthesis method and a biological conversion method. The chemical synthesis method mainly uses galactose as a raw material, alkaline metal salt is used as a catalyst to isomerize the galactose to generate tagatose-metal hydroxide compound precipitate, and acid is used for neutralization to obtain the tagatose. The chemical synthesis method has high energy consumption, more side reactions and complex products, which causes difficult separation and purification process of tagatose, and the chemical pollution is easily caused by the addition of acid, alkali and metal ions.
Compared with the chemical synthesis method, the biotransformation method has high transformation efficiency, strong specificity, few byproducts and simple purification steps, thereby becoming the main direction for producing tagatose. The biotransformation method mainly uses galactitol or galactose as raw material, and converts corresponding substrate into tagatose under the catalysis of enzyme or microorganism. However, galactitol is expensive and limited in its source and is not suitable for use as a raw material for industrial production. Galactose is used as a raw material, and is subjected to isomerization, desalination, decolorization, separation, concentration, crystallization and other steps to prepare a purified tagatose product, which is the mainstream production method of the tagatose. However, galactose cannot be completely converted into tagatose, and the final product is a mixture of galactose and tagatose, and a complex separation process is required to separate a pure product of tagatose from the mixture, so that the process difficulty and the cost are increased; meanwhile, the production cost of tagatose is high due to the influence of higher price of galactose[2-4]. Therefore, how to reduce the process cost and difficulty of tagatose production while ensuring the tagatose conversion efficiency is an important problem to be solved urgently at present。
Patent document 1 discloses a method for producing tagatose by multienzyme catalytic conversion, in which catalytic enzymes including fructokinase, 6-phosphate tagatose epimerase, and 6-phosphate tagatose phosphatase can convert fructose into tagatose. However, the process of converting fructose into 6-phosphofructose by fructokinase requires additional addition of ATP to phosphorylate fructose as a substrate, and the addition of expensive ATP leads to high production cost of tagatose and does not have industrial production value.
Patent document 2 discloses a hexuronic acid ester C4-epimerase variant having improved hexuronic acid ester C4-epimerase conversion activity, which can convert fructose into tagatose using the hexuronic acid ester C4-epimerase variant. However, the modified hexuronic acid ester C4-epimerase variant still has the problems of low activity, low conversion efficiency of tagatose and incapability of meeting the requirements of industrial production.
Patent document 3 discloses tagatose-6-phosphate phosphatase that can be used in a process for producing tagatose by converting it with starch, maltodextrin, sucrose, or the like as a substrate. However, the tagatose-6-phosphate phosphatase still has a problem of low enzyme activity and low utility value in actual industrial production.
Patent document 4 discloses a method for producing tagatose, in which a multi-enzyme molecular machine is established by adding a substance containing a-glucan phosphatase, glucose phosphate mutase, glucose phosphate isomerase, 6-tagatose phosphate epimerase, 6-tagatose phosphate phosphatase and inorganic phosphate ions to starch or a starch derivative as a substrate, and a multi-enzyme catalytic reaction is performed to obtain tagatose. Although the preparation method of cited document 4 improves the conversion rate of the raw material and the yield of tagatose, it is necessary to purify tagatose from a mixed solution of a plurality of enzymes after synthesizing tagatose, which increases the steps and difficulty of the purification process.
Cited documents:
[1]Oh D-K:Tagatose:properties,applications,and biotechnological processes.App.Microbiol.Biotechnol.2007,76:1-8.
[2]Rhimi M,Aghajari N,Juy M,Chouayekh H,Maguin E,Haser R,Bejar S:Rational design of Bacillus stearothermophilus US100l-arabinose isomerase:Potential applications for d-tagatose production.Biochim.2009,91:650-653.
[3]Oh H-J,Kim H-J,Oh D-K:Increase in d-tagatose production rate by site-directed mutagenesis of l-arabinose isomerase from Geobacillus thermodenitrificans.Biotechnol.Lett.2006,28:145-149.
[4]Bosshart A,Hee CS,Bechtold M,Schirmer T,Panke S:Directed divergent evolution of a thermostable D-tagatose epimerase towards improved activity for two hexose substrates.ChemBioChem 2015,16:592-601.
patent document 1: WO2015016544A1
Patent document 2: CN109415715A
Patent document 3: WO2018004310A1
Patent document 4: CN106399427A
Disclosure of Invention
Problems to be solved by the invention
In view of the technical problems in the prior art, for example: the existing production method of tagatose has the defects of high raw material cost, low conversion rate, requirement of multi-enzyme purification step and complex production process of the tagatose. Therefore, the recombinant microorganism can convert glycerol and glucose as substrates to produce tagatose, has the advantages of high conversion efficiency, high environmental friendliness, no need of multi-enzyme purification and low production cost, and is suitable for industrial production of tagatose.
Means for solving the problems
(1) A recombinant microorganism, wherein the recombinant microorganism has properties comprising at least one of the following (a) to (c) as compared to a wild-type microorganism:
(a) a reduced or abolished protein activity of a glucose-specific transfer protein of the phosphotransferase system and/or the expression level of a gene encoding the same;
(b) enhanced enzymatic activity of tagatose-6-phosphate epimerase and/or expression level of a gene encoding the same;
(c) enhanced enzymatic activity of tagatose-6-phosphate phosphatase and/or expression level of a gene encoding the same.
(2) The recombinant microorganism according to (1), wherein the glucose-specific transfer protein is selected from the group consisting of (a)1)-(a3) Any one of the groups:
(a1) Comprises the amino acid sequence shown as SEQ ID NO: 1 or SEQ ID NO: 3 and having glucose-specific transfer protein activity;
(a2) As shown in SEQ ID NO: 1 or SEQ ID NO: 3 through substituting, repeating, deleting or adding one or more amino acids, and has glucose specificity transfer protein activity;
(a3) Consisting of SEQ ID NO: 2 or SEQ ID NO: 4, or a polypeptide encoded by the nucleotide sequence shown in the figure;
alternatively, the tagatose-6-phosphate epimerase is selected from the group consisting of (b)1)-(b3) Any one of the groups:
(b1) Comprises the amino acid sequence shown as SEQ ID NO: 5 and having tagatose-6-phosphate epimerase activity;
(b2) As shown in SEQ ID NO: 5, and has tagatose-6-phosphate epimerase activity through substitution, repetition, deletion or addition of one or more amino acids;
(b3) Consisting of SEQ ID NO: 6;
optionally, the tagatose-6-phosphate phosphatase is selected from the following (c)1)-(c3) Any one of the groups:
(c1) Comprises the amino acid sequence shown as SEQ ID NO: 7 or SEQ ID NO: 53 and having tagatose-6-phosphate phosphatase activity;
(c2) As shown in SEQ ID NO: 7 or SEQ ID NO: 53 by substituting, repeating, deleting or adding one or more amino acids, and has tagatose-6-phosphate phosphatase activity;
(c3) Consisting of SEQ ID NO: 8 or SEQ ID NO: 54, or a pharmaceutically acceptable salt thereof.
(3) The recombinant microorganism according to (1) or (2), wherein the recombinant microorganism further has a property including at least one of the following (d) to (j) as compared with a wild-type microorganism:
(d) enhanced glucokinase enzymatic activity and/or expression level of a gene encoding the same;
(e) enhanced enzymatic activity of glucose-6-phosphate isomerase and/or expression level of a gene encoding the same;
(f) reduced or abolished enzymatic activity of fructose-6-phosphate kinase and/or expression level of a gene encoding it;
(g) a reduced or abolished pyruvate kinase enzymatic activity and/or expression level of a gene encoding the same;
(h) a reduced or abolished enzymatic activity of phosphoglucomutase and/or the expression level of a gene encoding it;
(i) a reduced or abolished enzymatic activity of glucose-6-phosphate dehydrogenase and/or expression level of a gene encoding the same;
(j) reduced or abolished enzymatic activity of HPr kinase and/or expression level of its encoding gene.
(4) The recombinant microorganism according to (3), wherein the glucokinase is selected from the following (d)1)-(d3) Any one of the groups:
(d1) Comprises the amino acid sequence shown as SEQ ID NO: 9 or SEQ ID NO: 11 and having glucokinase activity;
(d2) As shown in SEQ ID NO: 9 or SEQ ID NO: 11, and has glucokinase activity through substitution, repetition, deletion or addition of one or more amino acids;
(d3) Consisting of SEQ ID NO: 10 or SEQ ID NO: 12;
alternatively, the glucose-6-phosphate isomerase is selected from the group consisting of (e)1)-(e3) Any one of the groups:
(e1) Comprises the amino acid sequence shown as SEQ ID NO: 13 or SEQ ID NO: 15 and having glucose-6-phosphate isomerase activity;
(e2) As shown in SEQ ID NO: 13 or SEQ ID NO: 15 by substitution, repetition, deletion or addition of one or more amino acids, and has glucose-6-phosphate isomerase activity;
(e3) Consisting of SEQ ID NO: 14 or SEQ ID NO: 16, or a pharmaceutically acceptable salt thereof.
(5) The recombinant microorganism according to any one of (1) to (4), wherein the recombinant microorganism is derived from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, lactic acid bacteria, or Saccharomyces cerevisiae.
(6) A method for producing a recombinant microorganism according to any one of (1) to (5), comprising the steps of:
a step of gene knockout or knockdown of a gene encoding a glucose-specific transfer protein of a phosphotransferase system in a wild-type microorganism;
a step of introducing a recombinant expression vector expressing tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase into the recombinant microorganism, or a step of introducing a recombinant expression vector expressing the tagatose-6-phosphate epimerase and the tagatose-6-phosphate phosphatase, respectively, into the recombinant microorganism.
(7) The production method according to (6), further comprising at least one of the following steps:
a step of enhancing the expression level of a gene encoding glucokinase in the recombinant microorganism;
a step of enhancing the expression level of a gene encoding glucose-6-phosphate isomerase in the recombinant microorganism;
knocking out or knocking down a gene encoding fructose-6-phosphate kinase in the recombinant microorganism;
knocking out or knocking down a gene encoding pyruvate kinase in the recombinant microorganism;
knocking out or knocking down a gene encoding phosphoglucomutase in the recombinant microorganism;
a step of knocking out or knocking down a gene encoding glucose-6-phosphate dehydrogenase in the recombinant microorganism;
knocking out or knocking down a gene encoding HPr kinase in the recombinant microorganism.
(8) Use of the recombinant microorganism according to any one of (1) to (5), or the recombinant microorganism produced by the method according to (6) or (7) for producing tagatose.
(9) A tagatose-producing strain according to any one of (1) to (5) or the recombinant microorganism produced by the method of (6) or (7).
(10) The tagatose-producing strain of (9), wherein the tagatose-producing strain has glucose or glucose and glycerol as a substrate;
preferably, the tagatose-producing strain is derived from escherichia coli, corynebacterium glutamicum, bacillus subtilis, lactobacillus, or saccharomyces cerevisiae.
(11) A method of producing tagatose, comprising: a step of performing a fermentation reaction using glucose or glucose and glycerol as substrates, using the recombinant microorganism described in any one of (1) to (5), the recombinant microorganism produced by the method described in (6) or (7), or the tagatose-producing strain described in any one of (9) to (10).
(12) The method for producing tagatose according to (11), further comprising: and separating tagatose from the fermentation reaction liquid after the fermentation reaction is finished.
ADVANTAGEOUS EFFECTS OF INVENTION
In one embodiment, the present disclosure provides a recombinant microorganism, which reduces or eliminates the glucose-specific transfer protein activity of the phosphotransferase system, and which can reduce or eliminate the inhibitory effect of glucose on the utilization of glycerol as a substrate by the recombinant microorganism, thereby allowing the recombinant microorganism to produce tagatose using glycerol and glucose as substrates. The raw materials are low in price and wide in source, the efficiency of producing tagatose by conversion is high, multiple enzyme purification process steps are not needed, the production cost and the environmental pollution are reduced, and the method has an important industrial application value.
In one embodiment, the present disclosure provides a method for preparing a recombinant microorganism, which is simple and easy to implement, and can obtain a recombinant microorganism that produces tagatose using glucose and glycerol as substrates.
In one embodiment, the present disclosure provides a tagatose-producing strain that uses glycerol and glucose as substrates, wherein glycerol is used as a carbon source for the growth of the strain for the metabolic supply, and that performs the tagatose synthesis pathway using glucose under conditions suitable for growth, resulting in increased yield of tagatose.
In one embodiment, the method for producing tagatose, provided by the present disclosure, uses a recombinant microorganism or a tagatose-producing strain for fermentation production, has the advantages of high raw material conversion efficiency, high tagatose yield, simplified process and reduced cost, and is suitable for industrial large-scale production of tagatose.
Drawings
FIG. 1 shows a schematic diagram of the metabolic process of producing tagatose by recombinant microorganisms using glucose and glycerol as substrates;
FIGS. 2A-2D show maps of vectors pTKSCS, pTKRed, pACYCDuet, pETDuet, respectively. Wherein FIG. 2A is a vector map of pTKSCS, FIG. 2B is a vector map of pTKRed, FIG. 2C is a vector map of pACYCDuet, and FIG. 2D is a vector map of pETDuet;
FIGS. 3A-3B show maps of the vectors pSS and pWB980, respectively, wherein FIG. 3A is the vector map of pSS and FIG. 3B is the vector map of pWB 980;
FIG. 4 shows the HPLC analysis results of the tagatose-producing engineering strain of Escherichia coli YH6-2 fermenting glycerol and glucose.
FIG. 5 shows the HPLC analysis results of tagatose production by fermentation of glycerol and glucose using the Bacillus subtilis engineering strain YJ 14-1.
Detailed Description
Definition of
The terms "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification can mean "one," but can also mean "one or more," at least one, "and" one or more than one.
As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
Throughout this specification, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.
Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.
When used in the claims or specification, the term "range of values" is selected/preferred to include both the end points of the range and all natural numbers subsumed within the middle of the end points of the range with respect to the aforementioned end points of values.
As used in this disclosure, the term "converting" refers to a chemical conversion from one molecule to another catalyzed primarily by one or more polypeptides (enzymes), although other organic or inorganic catalysts may be used; it may also refer to the ratio (in%) between the molar amount of the desired product and the molar amount of the limiting substrate
As used in this disclosure, the terms "polypeptide", "enzyme", "polypeptide or enzyme", "polypeptide/enzyme" have the same meaning, which are interchangeable in this disclosure. The foregoing term refers to a polymer consisting of a number of amino acids via peptide bonds, which may or may not contain modifications such as phosphate groups and formyl groups.
As used in this disclosure, the term "glucose-specific transfer protein of a Phosphotransferase system" refers to a glucose-specific transfer protein that participates in a Phosphotransferase system (PTS). The PTS system is widely present in bacteria, fungi and some archaea, but not in animals and plants. The PTS system mediates the regulation of carbon metabolism in an organism and the phenomenon of Inducer repression (Inducer exclusion) exists. Inducer repression means that when one preferred carbon source (e.g., PTS carbon source-glucose) undergoes transport metabolism, uptake and utilization of other non-preferred carbon sources are inhibited. In the case of Escherichia coli, when glucose and other carbon sources (e.g., lactose, maltose, glycerol, etc.) are present in the medium at the same time, glucose is preferentially utilized, resulting in cascade transfer of phosphate groups between glucose-specific transfer proteins of the PTS system, and increased dephosphorylation of the glucose-specific transfer proteins. The unphosphorylated glucose-specific transfer proteins inhibit the transport and phosphorylation of carbon sources such as lactose, maltose and glycerol by binding to the respective transporters or kinases (e.g., LacY, MalK, GlpK).
As used in this disclosure, the term "Tagatose-6-phosphate epimerase", also known as Tagatose-6-phosphate epimerase (T6 PE), is capable of catalyzing the interconversion of fructose-6-phosphate and Tagatose-6-phosphate. In some embodiments, the tagatose-6-phosphate epimerase of the present disclosure is derived from Agrobacterium tumefaciens. In a specific embodiment, the tagatose-6-phosphate epimerase in the present disclosure is derived from the strain Agrobacterium tumefaciens str.C58.
As used in this disclosure, the term "Tagatose-6-phosphate phosphatase," also known as Tagatose-6-phosphate phosphatase (T6 PP), is capable of catalyzing the conversion of Tagatose-6-phosphate to Tagatose. In some embodiments, the tagatose-6-phosphate phosphatase of the present disclosure is derived from Archaeoglobus fulgidus, Archaeoglobus profundus, belonging to the genus Archaeoglobus.
As used in this disclosure, the term "Glucokinase" (glk) is one of the hexokinase isozymes, and is involved in the process of phosphorylation of Glucose to produce Glucose-6-phosphate (G6P), which consumes one ATP and converts it to ADP, and requires Mg2+Is involved. In some embodiments, the glucose of the present disclosureThe kinase is derived from Escherichia coli; in other embodiments, the glucokinase may be derived from a strain that undergoes glucose metabolism using glucose as a substrate, such as Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.
As used in this disclosure, the term "Glucose-6-phosphate isomerase," also known as Glucose-6-phosphate isomerase (G6 PI, pgi), is present in the cytoplasm and extracellular fluids and its primary function is to catalyze the interchange between D-Glucose-6-phosphate and D-fructose-6-phosphate, an important enzyme for glycolysis and gluconeogenesis, in addition to having enzymatic activity, as well as cellular and growth factor activity. In some embodiments, the glucose-6-phosphate isomerase of the present disclosure is derived from escherichia coli; in some embodiments, the glucose-6-phosphate isomerase of the present disclosure is derived from bacillus subtilis; in other embodiments, the glucose-6-phosphate isomerase may be derived from a strain that metabolizes glucose using Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.
As used in this disclosure, the term "Phosphoglucomutase," also known as Phosphoglucomutase (pgm), catalyzes the interconversion of glucose-1-phosphate and glucose-6-phosphate, and plays an important role in sugar metabolism. In some embodiments, the phosphoglucomutase of the present disclosure is derived from escherichia coli; in some embodiments, the phosphoglucomutase of the present disclosure is derived from bacillus subtilis; in other embodiments, the phosphoglucomutase can also be derived from a strain that undergoes glucose metabolism using glucose as a substrate, such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.
As used in this disclosure, the term "Glucose-6-phosphate dehydrogenase" (Glucose 6-phosphate dehydrogenase) is an oxidoreductase acting on a donor CH-OH group with NAD + or NADP + as acceptor. This enzyme catalyzes the following enzymatic reactions: d-glucose-6-phosphate + NADP+D-glucono-1, 5-lactone-6-phosphate + NADPH + H+. Glucose-6-phosphate dehydrogenase is mainly involved in the pentose phosphate pathway and can also act slowly on beta-D-glucose and other saccharides. In some embodiments, the glucose-6-phosphate dehydrogenase of the present disclosure is derived from Escherichia coli; in some embodiments, the glucose-6-phosphate dehydrogenase of the present disclosure is derived from bacillus subtilis; in other embodiments, the glucose-6-phosphate dehydrogenase may be derived from a strain that undergoes glucose metabolism using glucose as a substrate, such as Corynebacterium glutamicum, Lactobacillus, or Saccharomyces cerevisiae.
As used in this disclosure, the term "fructose-6-phosphate kinase," also known as Phosphofructokinase (pfk), is a type of kinase that acts on fructose-6-phosphate and fructose-1, 6-diphosphate is obtained by the action of Phosphofructokinase 1 (pfk-1). Fructose-2, 6-diphosphate can be obtained by the action of Phosphofructokinase 2 (pfk-2). In some embodiments, the fructose-6-phosphate kinase of the present disclosure is derived from escherichia coli, including pfkA and pfkB; in some embodiments, the fructose-6-phosphate kinase of the present disclosure is derived from bacillus subtilis, including pfkA; in other embodiments, glucokinase may also be derived from strains that undergo glycometabolism such as C.glutamicum, lactic acid bacteria, or Saccharomyces cerevisiae.
As used in this disclosure, the term "Pyruvate kinase" (PK), also known as Pyruvate phosphotransferase, phosphopyruvate kinase, catalyzes the reaction of the transfer of phosphate groups from phosphoenolpyruvate (PEP) to ADP, generating a molecule of Pyruvate and a molecule of ATP. Pyruvate kinase converts phosphoenolpyruvate and ADP to ATP and pyruvate, one of the major rate-limiting enzymes in the glycolysis process. In some embodiments, the pyruvate kinase of the present disclosure is derived from escherichia coli, including pykA and pykF. In other embodiments, the pyruvate kinase can be derived from a strain of Corynebacterium glutamicum, Bacillus subtilis, Lactobacillus, or Saccharomyces cerevisiae.
As used in this disclosure, the term "HPr kinase" (HPrK) refers to a specific transfer protein element involved in the Phosphotransferase system (PTS). Under the condition of the existence of sugar transported by PTS such as glucose, fructose-1, 6-diphosphate promotes Hpr kinase (HPrK) to phosphorylate serine at position 46 of HPr, and a phosphorylation product P-Ser-HPr is generated. The phosphorylation product P-Ser-HPr further binds to a catabolite control protein (CcpA), and the binding product acts in front of the gene encoding HPr kinase in the region of the catabolite response element (cre) to exert a catabolite repression effect, rendering the cell incapable of transporting glycerol into the cell for metabolism.
As used in this disclosure, the terms "enzyme activity", "protein activity" are also expressed as "specific activity" or "specific activity", which have the same meaning in this disclosure and may be used interchangeably. It refers to the enzyme activity (U/mg) and protein activity (U/mg) per mg of polypeptide (enzyme, protein).
The term "expression" in the present disclosure includes any step involving RNA production and protein production, including but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
The term "coding gene" in the present disclosure refers to a synthetic DNA molecule capable of directing protein synthesis by a certain rule, and the process of directing protein synthesis by a protein coding gene generally includes a transcription process using double-stranded DNA as a template and a translation process using mRNA as a template. The Coding gene contains a CDS Sequence (Coding Sequence) which directs the production of mRNA encoding the protein. The coding gene related to the present disclosure includes glucose-specific transfer protein of phosphotransferase system, tagatose-6-phosphate epimerase, tagatose-6-phosphate phosphatase, glucokinase, glucose-6-phosphate isomerase, fructose-6-phosphate kinase, pyruvate kinase, phosphoglucomutase, glucose-6-phosphate dehydrogenase, HPr kinase and other proteins and coding genes of enzymes.
As used in this disclosure, the term "wild-type" refers to an object that can be found in nature. For example, a polypeptide, polynucleotide sequence, or microorganism that can be isolated from a source in nature and not intentionally modified by man in the laboratory is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonyms.
As used in this disclosure, the term "microorganism" is a generic term for micro-organisms that are difficult to observe by the naked eye, including bacteria, fungi, and the like. Because the surface area to volume ratio of the microorganism is very large, the microorganism can rapidly exchange substances with the external environment to generate metabolites. The microorganism in the present disclosure is particularly a fermentation microorganism capable of fermentation culture to produce metabolites such as sugars, lipids, amino acids, nucleotides, and the like.
As used in this disclosure, the term "recombinant microorganism" is a modified microorganism obtained by genetically engineering a recombinant microorganism. Embodiments include, but are not limited to, introduction of recombinant genes, knock-out of endogenous genes of microorganisms, knock-down treatment, and the like. The term "recombinant gene" is a gene that does not occur in nature and includes a protein coding sequence operably linked to an expression control sequence. Embodiments include, but are not limited to, exogenous genes introduced into the microorganism, endogenous protein coding sequences operably linked to heterologous promoters, and genes with modified protein coding sequences. The recombinant gene is stored in the genome of the microorganism, a plasmid in the microorganism, or a phage in the microorganism.
In some embodiments, the reduced or abolished protein activity, reduced or abolished expression level of a gene encoding a protein, reduced or abolished enzyme activity, reduced or abolished expression level of a gene encoding an enzyme in a recombinant microorganism comprises engineering the resulting recombinant microorganism by: introducing weak promoter and weak ribosome binding site into microbial cell, knocking out or knocking down protein and enzyme coding gene, and inserting random segment into protein and enzyme coding gene to make them lose activity.
In some embodiments, the enhanced protein activity, the enhanced expression level of a gene encoding a protein, the enhanced enzyme activity, the enhanced expression level of a gene encoding an enzyme in a recombinant microorganism comprises engineering the resulting recombinant microorganism by: introducing strong promoter and strong ribosome binding site into cells of the microorganism, introducing non-integrative protein and enzyme recombinant expression vectors, and introducing chromosome integrative protein and enzyme recombinant expression vectors.
In some embodiments, the recombinant microorganisms of the present disclosure are genetically engineered recombinant strains of escherichia coli as a wild-type microorganism; in some embodiments, the recombinant microorganism of the present disclosure is a genetically engineered recombinant strain of bacillus subtilis as a wild-type microorganism; in other embodiments, the recombinant microorganism of the present disclosure may also be a recombinant strain genetically engineered with a fermentation strain of corynebacterium glutamicum, lactobacillus, or saccharomyces cerevisiae as a wild-type microorganism.
As used in this disclosure, the term "operably linked" refers to a configuration as follows: the control sequences are positioned at an appropriate location relative to the coding sequence of the polynucleotide such that the control sequences direct expression of the coding sequence. Illustratively, the regulatory sequence may be selected from sequences encoded by promoters and/or enhancers.
As used in this disclosure, the term "endogenous" refers to a polynucleotide, polypeptide, or other compound that is naturally expressed or produced within an organism or cell. That is, the endogenous polynucleotide, polypeptide, or other compound is not exogenous. For example, when a cell is initially isolated from nature, an "endogenous" polynucleotide or polypeptide is present in the cell.
As used in this disclosure, the term "exogenous" refers to any polynucleotide or polypeptide naturally found or expressed in a particular cell or organism in which expression is desired. The exogenous polynucleotide, polypeptide, or other compound is not endogenous.
As used in this disclosure, the term "amino acid mutation" or "nucleotide mutation" includes "substitution, duplication, deletion or addition of one or more amino acids or nucleotides". In the present disclosure, the term "mutation" refers to a change in a nucleotide sequence or an amino acid sequence. In a specific embodiment, the term "mutation" refers to "substitution".
In one embodiment, a "mutation" of the present disclosure may be selected from a "conservative mutation". In the present disclosure, the term "conservative mutation" refers to a mutation that can normally maintain the function of a protein. A representative example of conservative mutations is conservative substitutions.
As used in this disclosure, the term "conservative substitution" refers to the replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include those having basic side chains (e.g., lysine, arginine, and histidine), acidic side chains (e.g., aspartic acid and glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan), beta-branches (e.g., threonine, valine, and isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, and histidine). As used in this disclosure, "conservative substitutions" typically exchange one amino acid at one or more positions in a protein. Such substitutions may be conservative. As a substitution regarded as a conservative substitution, a conservative mutation includes a naturally occurring mutation caused by individual differences in the origin of a gene, differences in strains, species, and the like.
As used in this disclosure, the term "polynucleotide" refers to a polymer composed of nucleotides. Polynucleotides may be in the form of individual fragments, or may be a component of a larger nucleotide sequence structure, derived from nucleotide sequences that have been isolated at least once in quantity or concentration, and which are capable of being recognized, manipulated, and recovered in sequence, and their component nucleotide sequences, by standard molecular biology methods (e.g., using cloning vectors). When a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T". In other words, a "polynucleotide" refers to a polymer of nucleotides removed from other nucleotides (either individual fragments or whole fragments), or may be an integral part or component of a larger nucleotide structure, such as an expression vector or a polycistronic sequence. Polynucleotides include DNA, RNA, and cDNA sequences. A "recombinant polynucleotide" belongs to one of the "polynucleotides".
As used in this disclosure, the term "vector" refers to a DNA construct containing a DNA sequence operably linked to suitable control sequences for expression of a gene of interest in a suitable host. "recombinant expression vector" refers to a DNA construct used to express, for example, a polynucleotide encoding a desired polypeptide. Recombinant expression vectors can include, for example, a collection comprising i) genetic elements that have a regulatory effect on gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into protein; and iii) transcriptional subunits of appropriate transcriptional and translational initiation and termination sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not critical and any vector may be used, including plasmids, viruses, phages and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40 and pseudorabies.
As used in this disclosure, the term "transduction" has the meaning generally understood by those skilled in the art, i.e., the process of introducing exogenous DNA into a host. The method of transformation includes any method of introducing nucleic acid into a cell including, but not limited to, electroporation, calcium phosphate (CaPO)4) Precipitation method, calcium chloride (CaCl)2) Precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran, cationic liposome, and lithium acetate-DMSO.
As used in this disclosure, the term "tagatose yield" has the meaning commonly understood by those skilled in the art, i.e., the percentage of substrate consumed to produce tagatose to the total substrate. In the present disclosure, "tagatose yield" and "substrate conversion" may be used instead of each other.
The cultivation of the recombinant microorganism of the present disclosure may be performed according to a conventional method in the art, including, but not limited to, a well plate culture, a shake flask culture, a batch culture, a continuous culture, a fed-batch culture, and the like, and various culture conditions such as temperature, time, pH of a medium, and the like may be appropriately adjusted according to actual circumstances.
Unless defined otherwise or clearly indicated by the background, all technical and scientific terms used in this disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
Tagatose-producing strain
In one technical scheme, the recombinant microorganism is obtained by genetically modifying a wild microorganism, and tagatose is produced.
In a specific embodiment, the recombinant microorganism employed in the present disclosure is derived from escherichia coli, corynebacterium glutamicum, bacillus subtilis, lactic acid bacteria, or saccharomyces cerevisiae.
In a specific embodiment, the present disclosure genetically engineered escherichia coli and bacillus subtilis, respectively, with escherichia coli and bacillus subtilis as wild-type microorganisms.
In a specific embodiment, the present disclosure deprives the enzymatic activity of the PTS system glucose-specific transfer protein by eliminating the enzymatic activity of the PTS system glucose-specific transfer protein, for example, by knocking out the gene encoding the PTS system glucose-specific transfer protein, or inserting a random fragment into the gene encoding the PTS system glucose-specific transfer protein.
In a specific embodiment, the present disclosure aims to eliminate the inhibitory effect of glucose on the substrate utilization of glycerol, and recombinant strains of escherichia coli or bacillus subtilis use glycerol as a carbon source to grow into a cell metabolism supply strain and glucose as a carbon source to synthesize tagatose in the intracellular tagatose synthesis pathway under conditions enabling growth by using glucose as a carbon source to simultaneously use glycerol and glucose as substrates (fig. 1).
In a specific embodiment, the present disclosure enhances the enzymatic activity of glucokinase and glucose-6-phosphate isomerase, for example, by introducing a strong promoter or increasing the expression intensity of genes encoding glucokinase and glucose-6-phosphate isomerase in a plasmid-free expression form, or integrating genes encoding glucokinase and glucose-6-phosphate isomerase originating in other species with higher enzymatic activity by means of chromosomal integration.
In a specific embodiment, the present disclosure abolishes the enzymatic activity of fructose-6-phosphate kinase by eliminating the enzymatic activity of fructose-6-phosphate kinase, for example by knocking out the gene encoding fructose-6-phosphate kinase or inserting a random fragment into the gene encoding fructose-6-phosphate kinase.
In a specific embodiment, the present disclosure enhances the expression intensity of genes encoding tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase by enhancing the enzymatic activities of the tagatose-6-phosphate epimerase and the tagatose-6-phosphate phosphatase, for example, by using a strong promoter, a strong ribosome binding site, chromosomal integration, or plasmid-free expression form.
In a specific embodiment, the present disclosure provides for the loss of pyruvate kinase enzymatic activity by eliminating pyruvate kinase enzymatic activity, for example by knocking out the gene encoding pyruvate kinase or inserting a random fragment into the gene encoding pyruvate kinase.
The phosphoenolpyruvate is provided with high-energy phosphate group by PEP in the glycerol metabolic pathway, namely the step of leading glycerol to enter cells to generate glycerate-3-phosphate (G3P), so that the glycerol is promoted to generate G3P, thereby accelerating the glycerol metabolic capability, and the step is helpful for the growth of strains depending on the glycerol.
In a specific embodiment, the present disclosure abolishes phosphoglucomutase enzymatic activity by eliminating it, for example by knocking out the gene encoding phosphoglucomutase, or inserting a random fragment into the gene encoding phosphoglucomutase.
In a specific embodiment, the present disclosure provides for the loss of glucose-6-phosphate dehydrogenase enzyme activity by decreasing the enzyme activity of glucose-6-phosphate dehydrogenase, for example, by knocking out the gene encoding glucose-6-phosphate dehydrogenase, or inserting a random fragment into the gene encoding glucose-6-phosphate dehydrogenase; the transcriptional expression level of a gene encoding glucose-6-phosphate dehydrogenase is decreased by a weak promoter or a weak ribosome binding site, thereby decreasing the enzymatic activity of glucose-6-phosphate dehydrogenase.
In a specific embodiment, the present disclosure abolishes the enzymatic activity of HPr kinase by eliminating the enzymatic activity of HPr kinase, for example by knocking out the gene encoding HPr kinase, or inserting a random fragment into the gene encoding HPr kinase. The aim of eliminating HPr kinase was to eliminate the inhibitory effect of glucose on glycerol substrate utilization.
Construction method of engineering strain for producing tagatose escherichia coli
In one embodiment, the present disclosure provides a method for constructing an engineered strain of escherichia coli for producing tagatose.
In a specific embodiment, the method comprises the steps of designing primers containing upstream and downstream homologous arms of a PTS system glucose specific transfer protein coding gene ptsG of Escherichia coli, amplifying a SceI-tet-SceI fragment on a vector pTKSCS (shown in figure 2A) by using a PCR (polymerase chain reaction) technology, transforming a homologous recombination fragment into Escherichia coli MG1655(DE3), knocking out the PTS system glucose specific transfer protein coding gene ptsG gene by using a lambda-Red homologous recombination technology, and obtaining a recombinant strain YH 1;
in a specific embodiment, the method comprises the steps of amplifying a glucose kinase coding gene glcK derived from Escherichia coli and a glucose-6-phosphate isomerase coding gene pgi derived from Escherichia coli, constructing the genes into an expression vector pACYCDuet to obtain a recombinant expression vector pACYCDuet-glcK-pgi, and transforming the recombinant expression vector pACYCDuet-glcK-pgi into Escherichia coli YH1 to obtain a recombinant strain YH 2;
in a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of fructose-6-phosphokinase coding gene pfkA of Escherichia coli, amplifies SceI-tet-SceI fragment on vector pTKSCS (FIG. 2A) by PCR technology, transforms the homologous recombinant fragment into recombinant strain YH1, knocks out fructose-6-phosphokinase coding gene pfkA gene by lambda-Red homologous recombination technology to obtain recombinant strain YH3, transforms recombinant expression vector pAYH 3 by recombinant expression vector CYCYCYCYUE-glcK-i, and obtains recombinant strain YH 3-1;
in a specific embodiment, the method comprises the steps of designing primers containing upstream and downstream homologous arms of pyruvate kinase coding gene pykF of Escherichia coli, amplifying a SceI-tet-SceI fragment on a vector pTKSCS (shown in figure 2A) by using a PCR (polymerase chain reaction) technology, transforming a homologous recombination fragment into a recombinant strain YH3, knocking out the pyruvate kinase coding gene pykF gene by using a lambda-Red homologous recombination technology to obtain a recombinant strain YH4, transforming a recombinant expression vector pACYCDuet-glcK-pgi into Escherichia coli YH4 to obtain a recombinant strain YH 4-1;
in a specific embodiment, the method comprises the steps of designing primers containing upstream and downstream homology arms of a phosphoglucomutase coding gene pgm of Escherichia coli, amplifying a SceI-tet-SceI fragment on a vector pTKSCS (shown in figure 2A) by using a PCR (polymerase chain reaction) technology, transforming a homologous recombination fragment into a recombinant strain YH4, knocking out the gene of the phosphoglucomutase coding gene pgm by using a lambda-Red homologous recombination technology to obtain a recombinant strain YH5, transforming the recombinant expression vector pACYCDuet-glcK-pgi into Escherichia coli YH5, and obtaining a recombinant strain YH 5-1;
in a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of a glucose-6-phosphate dehydrogenase encoding gene zwf of Escherichia coli, amplifies a SceI-tet-SceI fragment on a vector pTKSCS (fig. 2A) by using a PCR technique, transforms the homologous recombinant fragment into a recombinant strain YH5, knocks out the glucose-6-phosphate dehydrogenase encoding gene zwf by using a lambda-Red homologous recombination technique to obtain a recombinant strain YH6, transforms a recombinant expression vector paccycit-glcK-i into Escherichia coli YH6, and obtains a recombinant strain YH 6-1;
in a specific embodiment, the present disclosure amplifies tagatose-6-phosphate epimerase T6PE derived from Agrobacterium tumefaciens str.c58 and tagatose-6-phosphate phosphatase T6PP gene derived from archaea Archaeoglobus fulgidus and/or Archaeoglobus profundus, and constructs it into expression vector petdue to obtain recombinant expression vector petdue-T6 PE-T6PP, and transforms recombinant expression vector petdue-T6 PE-T6PP into escherichia coli MG1655(DE3) to obtain recombinant strain MG 1655-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector petsuet-T6 PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YH1 to obtain recombinant strain YH 1-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector petsuet-T6 PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YH2 to obtain recombinant strain YH 2-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector petsuet-T6 PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YH3-1 to obtain recombinant strain YH 3-2;
in a specific embodiment, the present disclosure constructs a recombinant expression vector petsuet-T6 PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YH4-1 to obtain recombinant strain YH 4-2;
in a specific embodiment, the present disclosure constructs a recombinant expression vector petsuet-T6 PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YH5-1 to obtain recombinant strain YH 5-2;
in a specific embodiment, the present disclosure constructs a recombinant expression vector petsuet-T6 PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YH6-1 to obtain recombinant strain YH 6-2;
in some specific embodiments of the present disclosure, the recombinant strains BMG1655-1, YH1-1, YH2-1, YH3-2, YH4-2, YH5-2 and YH6-2 can be used as engineering strains of E.coli for producing tagatose, and glucose or a mixed medium of glucose and glycerol is fermented to produce tagatose.
Construction method of engineering strain for producing tagatose bacillus subtilis
In one technical scheme, the disclosure provides a construction method of a bacillus subtilis engineering strain for producing tagatose. In a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of Bacillus subtilis 168 uracil phosphoribosyltransferase encoding gene upp, amplifies the upstream and downstream homology arms of uracil phosphoribosyltransferase encoding gene upp by using a PCR technique, constructs the upstream and downstream homology arms into an integration vector pSS to obtain a recombinant integration vector pSS-upp-FR, converts the recombinant integration vector pSS-upp-FR into Bacillus subtilis SCK6, and obtains a recombinant engineering strain YJ8 with uracil phosphoribosyltransferase encoding gene upp knocked out by using an intramolecular homologous recombination technique;
in a specific embodiment, the present disclosure designs primers of upstream and downstream homology arms of PTS system glucose specific transfer protein coding gene ptsG containing Bacillus subtilis 168, amplifies the upstream and downstream homology arms of PTS system glucose specific transfer protein coding gene ptsG by using PCR technology, constructs the upstream and downstream homology arms into integration vector pSS to obtain recombinant integration vector pSS-ptsG-FR, transforms the recombinant integration vector pSS-ptsG-FR into Bacillus subtilis YJ8, and obtains recombinant engineering strain YJ9 with PTS system glucose specific transfer protein coding gene ptsG knocked out by using intramolecular homologous recombination technology;
in a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of HPr kinase coding gene hprK of Bacillus subtilis 168, amplifies the upstream and downstream homology arms of HPr kinase coding gene hprK by PCR technology, constructs the upstream and downstream homology arms into integration vector pSS to obtain recombinant integration vector pSS-hprK-FR, transforms the recombinant integration vector pSS-hprK-FR into Bacillus subtilis YJ9, and obtains recombinant engineering strain YJ10 with HPr kinase coding gene hprK gene knocked out by intramolecular homology recombination technology;
in a specific embodiment, the present disclosure amplifies a glucokinase coding gene glcK derived from Bacillus subtilis 168 and a glucose-6-phosphate isomerase coding gene pgi derived from Bacillus subtilis 168, constructs the genes into an integration vector pSS-ptsG-FR to obtain a recombinant integration vector pSS-ptsG-FR-glcK-pgi, transforms the recombinant integration vector pSS-ptsG-FR-glcK-pgi into Bacillus subtilis YJ10, and obtains a recombinant engineered strain YJ11 in which the glucokinase coding gene glcK and the glucose-6-phosphate isomerase coding gene pgi are integrated on a genome by an intramolecular homologous recombination technology;
in a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of a fructose-6-phosphate kinase coding gene pfkA of Bacillus subtilis 168, amplifies the upstream and downstream homology arms of the fructose-6-phosphate kinase coding gene pfkA by using a PCR technique, constructs the upstream and downstream homology arms into an integration vector pSS to obtain a recombinant integration vector pSS-pfkA-FR, transforms the recombinant integration vector pSS-pfkA-FR into Bacillus subtilis YJ11, and obtains a recombinant engineered strain YJ12 with the fructose-6-phosphate kinase coding gene pfkA knocked out by using an intramolecular homologous recombination technique;
in a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of pgm of a Bacillus subtilis 168 glucose phosphate mutase encoding gene, amplifies the upstream and downstream homology arms of the pgm of the glucose phosphate mutase encoding gene by a PCR technique, constructs the upstream and downstream homology arms into an integration vector pSS to obtain a recombinant integration vector pSS-pgm-FR, transforms the recombinant integration vector pSS-pgm-FR into Bacillus subtilis YJ12, and obtains a recombinant engineered strain YJ13 with the pgm gene of the glucose phosphate mutase encoding gene knocked out by an intramolecular homologous recombination technique;
in a specific embodiment, the present disclosure designs primers containing upstream and downstream homology arms of zwf of a Bacillus subtilis 168 glucose-6-phosphate dehydrogenase encoding gene, amplifies the upstream and downstream homology arms of zwf of the glucose 6-phosphate dehydrogenase encoding gene by using a PCR technique, constructs the upstream and downstream homology arms into an integration vector pSS to obtain a recombinant integration vector pSS-zwf-FR, transforms the recombinant integration vector pSS-zwf-FR into Bacillus subtilis YJ13, and obtains a recombinant engineered strain YJ14 with the zwf gene of the glucose-6-phosphate dehydrogenase encoding gene knocked out by using an intramolecular homologous recombination technique;
in a specific embodiment, the present disclosure amplifies tagatose-6-phosphate epimerase T6PE derived from Agrobacterium tumefaciens str.c58 and tagatose-6-phosphate phosphatase T6PP gene derived from archaeococcus Archaeoglobus fulgidus and/or Archaeoglobus profundus, and constructs it into expression vector pWB980 to obtain recombinant expression vector pWB980-T6PE-T6PP, and transforms recombinant expression vector pWB980-T6PE-T6PP into bacillus subtilis SCK6 to obtain recombinant strain SCK 6-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ8 to obtain recombinant strain YJ 8-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ9 to obtain recombinant strain YJ 9-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ10 to obtain recombinant strain YJ 10-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ11 to obtain recombinant strain YJ 11-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ12 to obtain recombinant strain YJ 12-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ13 to obtain recombinant strain YJ 13-1;
in a specific embodiment, the present disclosure constructs a recombinant expression vector pWB980-T6PE-T6PP carrying tagatose-6-phosphate epimerase T6PE and tagatose-6-phosphate phosphatase T6PP genes into recombinant strain YJ14 to obtain recombinant strain YJ 14-1;
in some specific embodiments of the present disclosure, recombinant strains SCK6-1, YJ8-1, YJ9-1, YJ10-1, YJ11-1, YJ12-1, YJ13-1, and YJ14-1 can be used as engineered strains of Bacillus subtilis for producing tagatose, and glucose or a mixed medium of glucose and glycerol can be fermented to produce tagatose.
Production method of tagatose
In one aspect, the present disclosure provides a method of producing tagatose.
In a specific embodiment, the production method of tagatose provided by the present disclosure may include the steps of:
(1) carrying out fermentation culture on the tagatose production strain;
(2) and after the fermentation reaction is finished, collecting the fermentation reaction liquid, and separating the tagatose from the fermentation reaction liquid.
In the production process, the tagatose producing strain can efficiently convert and produce tagatose by taking glucose and glycerol as substrates to obtain high-yield tagatose. The tagatose production method disclosed by the invention takes glucose and glycerol as substrates, has the advantages of wide raw material source, low price, no need of a multi-enzyme separation process, high environmental friendliness, low production cost and important process application value.
In some embodiments, the culture medium for fermentation culture of the tagatose-producing engineered E.coli strain is LB medium (10g/L peptone, 5g/L yeast extract and 10g/L sodium chloride, kanamycin 25ng/mL, ampicillin 100ng/mL) and glucose is added to a final concentration of 20 g/L.
In some embodiments, the culture medium for fermentation culture of the tagatose-producing engineered Escherichia coli strain is M9Y medium (10g/L glycerol, 20g/L glucose, 6g/L Na)2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extractFetching).
In some embodiments, the culture medium for fermentation culture of the tagatose-producing engineered strain of Bacillus subtilis is SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K)2HPO4Kanamycin 25ng/mL) and glucose was added to a final concentration of 20 g/L.
In some embodiments, the culture medium for fermentation culture of the tagatose-producing engineered strain of Bacillus subtilis is SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K)2HPO4Kanamycin 25ng/mL) and glucose was added to a final concentration of 20g/L and glycerol was added to a final concentration of 20 g/L.
In some embodiments, the tagatose-producing strain is cultured under fermentation culture conditions of 200rmp at 37 ℃ for 12-24 hours.
In some embodiments, the method of isolating tagatose can be performed by methods commonly used in the art, including but not limited to: filtering, decolorizing, desalting, concentrating, crystallizing and detecting by HPLC.
Methods for manipulating microorganisms are known in the art, such as modern methods in molecular biology (Online ISBN: 9780471142720, John Wiley and Sons, Inc.), [ metabolic engineering of microorganisms: methods and protocols (Qiong Cheng ed., Springer) and "systemic metabolic engineering: methods and protocols (Hal s. alper ed., Springer) etc. publications.
In the present disclosure, SEQ ID NO: 1 to SEQ ID NO: 17. SEQ ID NO: 53 to SEQ ID NO: 54, the numbering of nucleotides or amino acids has the following meaning:
SEQ ID NO: 1 is the amino acid sequence of the Escherichia coli glucose specific transfer protein;
SEQ ID NO: 2 is a nucleotide sequence for coding the Escherichia coli glucose specific transfer protein;
SEQ ID NO: 3 is the amino acid sequence of the glucose specific transfer protein of the bacillus subtilis;
SEQ ID NO: 4 is a nucleotide sequence for coding the glucose-specific transfer protein of the bacillus subtilis;
SEQ ID NO: 5 is the amino acid sequence of the tagatose-6-phosphate epimerase of agrobacterium tumefaciens;
SEQ ID NO: 6 is a nucleotide sequence for coding tagatose-6-phosphate epimerase of agrobacterium tumefaciens;
SEQ ID NO: 7 is an amino acid sequence of a tagatose-6-phosphate phosphatase belonging to the genus Archaeoglobus fulgidus;
SEQ ID NO: 8 is a nucleotide sequence encoding a tagatose-6-phosphate phosphatase belonging to the genus Archaeoglobus fulgidus;
SEQ ID NO: 9 is the amino acid sequence of Escherichia coli glucokinase;
SEQ ID NO: 10 is a nucleotide sequence encoding Escherichia coli glucokinase;
SEQ ID NO: 11 is the amino acid sequence of bacillus subtilis glucokinase;
SEQ ID NO: 12 is a nucleotide sequence encoding bacillus subtilis glucokinase;
SEQ ID NO: 13 is the amino acid sequence of the escherichia coli glucose-6-phosphate isomerase;
SEQ ID NO: 14 is a nucleotide sequence encoding the glucose-6-phosphate isomerase of escherichia coli;
SEQ ID NO: 15 is the amino acid sequence of bacillus subtilis glucose-6-phosphate isomerase;
SEQ ID NO: 16 is a nucleotide sequence encoding a bacillus subtilis glucose-6-phosphate isomerase;
SEQ ID NO: 17 is the nucleotide sequence of the SceI-tet-SceI fragment;
SEQ ID NO: 53 is an amino acid sequence of a phosphatase of Archaeoglobus profundus tagatose-6-phosphate of the genus Archaeoglobus;
SEQ ID NO: 54 is a nucleotide sequence encoding a phosphatase of Archaeoglobus profundus tagatose-6-phosphate.
Examples
Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
The experimental techniques and experimental procedures used in this example are, unless otherwise specified, conventional techniques, e.g., those in the following examples, in which specific conditions are not specified, and generally according to conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. The materials, reagents and the like used in the examples are commercially available from normal sources unless otherwise specified.
Example 1 construction of E.coli recombinant Strain YH1
(1) According to the PTS system glucose-specific transfer protein coding gene ptsG derived from Escherichia coli MG1655 in KEGG database, a primer 1 and a primer 2 which comprise an upstream 65bp homologous fragment and a downstream 65bp homologous fragment of the PTS system glucose-specific transfer protein coding gene ptsG are designed, and a SceI-tet-SceI fragment (the nucleotide sequence of the SceI-tet-SceI fragment is shown in SEQ ID NO: 17) on a pTKSCS vector is amplified through PCR to obtain a resistance fragment 1 containing the upstream and downstream homologous fragments of the ptsG gene. The specific primer sequences are shown as follows:
primer 1, the sequence is shown as SEQ ID NO: 18, and:
CAGGAGCACTCTCAATTATGTTTAAGAATGCATTTGCTAACCTGCAAAAGGTCGGTAAATCGCTGTACGGCCCCAAGGTCCAAACGGTGA
and the sequence of the primer 2 is shown as SEQ ID NO: 19, and:
GCCATCTGGCTGCCTTAGTCTCCCCAACGTCTTACGGATTAGTGGTTACGGATGTACTCATCCATCAGCGATTTACCGACCTTTTGCAGGTTAGCTTGGCTTCAGGGATGAGGCGCCATC
(2) construction of E.coli recombinant Strain YH1
Coli MG1655(DE3) competent cells (100uL) were prepared, transformed with the plasmid pTKRed (temperature sensitive plasmid) required for Red recombination (FIG. 2B), plated on a resistance plate containing spectinomycin, and cultured overnight at 30 ℃. Then, single colonies were picked from the plate, transferred to liquid LB containing spectinomycin and IPTG, and cultured at 30 ℃ to prepare MG1655(DE3) electrotransformation competence (100uL) containing pTKRed.
And (3) uniformly mixing the fragment 1 obtained in the step (1) with electrotransformation competence, coating the mixture on a double-antibody plate containing spectinomycin and chloramphenicol after electric shock, and culturing the mixture for 30 hours at the temperature of 30 ℃. The single clone was picked and subjected to colony PCR verification (primers 3 and 4 were verified), and the strain with a PCR product size of about 1775bp (containing the upstream segment of ptsG gene on the genome, the SceI-tet-SceI segment and the downstream segment of ptsG gene on the genome) was the correct double-crossover strain.
And (3) selecting the positive clone, transferring the positive clone into an LB liquid culture medium containing spectinomycin, IPTG and arabinose, culturing for 8-12h, and then diluting and coating the bacterial liquid on a flat plate containing spectinomycin, IPTG and arabinose for overnight culture. The purpose of this step was to induce the expression of SceI with arabinose, cut DNA containing SceI recognition sites, promote intramolecular homologous recombination of positive transformants, and remove the tet-resistant fragment. Several single clones were picked from the plate and colony PCR was performed again (primers 3 and 4 were verified), and transformants with DNA of approximately 382bp of the PCR product were positive clones. The positive clones were transferred to liquid LB without antibody and cultured at 37 ℃ for 8-12 hours to remove pTKRed plasmid. The transformant PCR is sent to sequencing verification and a correct strain is stored, namely an escherichia coli recombinant engineering strain with the glucose-specific transfer protein coding gene of the PTS system knocked out, namely an escherichia coli recombinant engineering strain without the activity of the glucose-specific transfer protein of the PTS system is named YH 1. The specific primer sequences are shown as follows:
and 3, the sequence of the primer is shown as SEQ ID NO: 20, and: CGTCAAACAAATTGGCACTG
Primer 4, having a sequence shown in SEQ ID NO: 21, and: GAACGTCAATAACCTGTTCG
Example 2 construction of E.coli recombinant Strain YH2
(1) Construction of recombinant expression vector pACYCDuet-glk-pgi
According to a glucokinase coding gene glk and a glucose-6-phosphate isomerase coding gene pgi which are derived from escherichia coli in a KEGG database, primers 5 and 6 are designed to amplify glk, and primers 7 and 8 are designed to amplify pgi. Design primer 9 and primer 10 to amplify plasmid backbone pACYCDuet (FIG. 2C) by simple cloning ligation[5]Constructing a recombinant expression vector pACYCDuet-glcK; then, primer 11 and primer 12 are designed to amplify plasmid skeleton pACYCDuet-glk, and a simple cloning method is adopted to obtain a recombinant expression vector pACYCDuet-glk-pgi. The specific primer sequences are shown as follows:
primer 5, the sequence is shown as SEQ ID NO: 22, in which:
GTTTAACTTTAATAAGGAGATATACCATGACAAAGTATGCATTAGTCGGTG
primer 6, the sequence of which is shown as SEQ ID NO: 23, in the following steps:
CGATTACTTTCTGTTCGACTTAAGCATTACAGAATGTGACCTAAGGTCTG
primer 7, having the sequence shown in SEQ ID NO: 24, showing:
GTTAAGTATAAGAAGGAGATATACATATGAAAAACATCAATCCAACGCAG
primer 8, the sequence is shown as SEQ ID NO: 25, and:
TCAGCGGTGGCAGCAGCCTAGGTTAATTAACCGCGCCACGCTTTATAGCG
primer 9, having a sequence shown in SEQ ID NO: 26, as shown:
CAGACCTTAGGTCACATTCTGTAATGCTTAAGTCGAACAGAAAGTAATCG
primer 10, having the sequence shown in SEQ ID NO: 27 shows that:
CACCGACTAATGCATACTTTGTCATGGTATATCTCCTTATTAAAGTTAAAC
primer 11, having the sequence shown in SEQ ID NO: 28, and:
GCTATAAAGCGTGGCGCGGTTAATTAACCTAGGCTGCTGCCACCGCTGAG
primer 12, having the sequence shown in SEQ ID NO: 29, and:
CTGCGTTGGATTGATGTTTTTCATATGTATATCTCCTTCTTATACTTAAC
(2) construction of E.coli recombinant Strain YH2
The recombinant expression vector pACYCDuet-glk-pgi was transformed into recombinant strain YH1 to obtain recombinant strain YH 2.
Example 3 construction of E.coli recombinant Strain YH3-1
(1) Construction of pfkA Gene knockout recombinant fragment
Based on a fructose-6-phosphate kinase coding gene pfkA derived from Escherichia coli MG1655 in a KEGG database, a primer 13 and a primer 14 of an upstream 65bp homologous fragment and a downstream 65bp homologous fragment of the pfkA are designed, and a SceI-tet-SceI fragment on a pTKSCS vector is amplified by PCR to obtain a resistance fragment 2 containing the upstream and downstream homologous fragments of the pfkA gene. The specific primer sequences are shown as follows:
primer 13, having the sequence shown in SEQ ID NO: 30, and (b):
CATTCCAAAGTTCAGAGGTAGTCATGATTAAGAAAATCGGTGTGTTGACAAGCGGCGGTGATGCGtacggccccaaggtccaaacggtga
primer 14, having a sequence as shown in SEQ ID NO: 31, in the following:
GCCTTTTTCCGAAATCATTAATACAGTTTTTTCGCGCAGTCCAGCCAGTCACCTTTGAACGGACGCGCATCACCGCCGCTTGTCAACACACCGATttggcttcagggatgaggcgccatc
(2) construction of E.coli recombinant Strain YH3
Coli YH2 competent cells (100uL) were prepared, transformed with pTKRed (temperature sensitive plasmid) which is a plasmid required for Red recombination, spread on a resistance plate containing spectinomycin, and cultured overnight at 30 ℃. Then, single colonies were picked from the plate, transferred to liquid LB containing spectinomycin and IPTG, and cultured at 30 ℃ to prepare YH2 electrotransformation competence (100uL) containing pTKRed.
And (3) uniformly mixing the fragment 2 obtained in the step (1) with electrotransformation competence, coating the mixture on a double-antibody plate containing spectinomycin and chloramphenicol after electric shock, and culturing for 30 hours at the temperature of 30 ℃. The single clone was picked and subjected to colony PCR verification (verification primers were primer 15 and primer 16), and the strain whose PCR product size was about 1757bp (containing the upstream fragment of the pfkA gene on the genome, the SceI-tet-SceI fragment, and the downstream fragment of the pfkA gene on the genome) was the correct double-crossover strain.
And (3) selecting the positive clone, transferring the positive clone into an LB liquid culture medium containing spectinomycin, IPTG and arabinose, culturing for 8-12h, and then diluting and coating the bacterial liquid on a flat plate containing spectinomycin, IPTG and arabinose for overnight culture. The purpose of this step was to induce the expression of SceI with arabinose, cut DNA containing SceI recognition sites, promote intramolecular homologous recombination of positive transformants, and remove the tet-resistant fragment. Several single clones were picked from the plate and colony PCR was performed again (primers 15 and 16 were verified), and transformants with DNA of approximately 364bp of PCR product were positive clones. The positive clones were transferred to liquid LB without antibody and cultured at 37 ℃ for 8-12 hours to remove pTKRed plasmid. The transformant PCR was subjected to sequencing verification and the correct strain, i.e., the recombinant engineered Escherichia coli strain with the fructose 6-phosphokinase encoding gene pfkA knocked out, i.e., the recombinant engineered Escherichia coli strain without the fructose 6-phosphokinase encoding gene pfkA, was named YH 3. The specific primer sequences are shown as follows:
primer 15, having a sequence as shown in SEQ ID NO: 32, shown in the figure: CATTTGGCCTGACCTGAATC
Primer 16, having the sequence shown in SEQ ID NO: 33: CGAACGCCTTATCCGGCCTAC
(3) Construction of Escherichia coli recombinant Strain YH3-1
The recombinant expression vector pACYCDuet-glk-pgi was transformed into recombinant strain YH3 to obtain recombinant strain YH 3-1.
Example 4 construction of E.coli recombinant Strain YH4-1
(1) Construction of a pykF Gene knock-out recombinant fragment
Based on a pyruvate kinase coding gene pykF derived from escherichia coli in a KEGG database, primers 17 and 18 of an upstream 65bp homologous fragment and a downstream 65bp homologous fragment of pykF are designed, and a SceI-tet-SceI fragment on a pTKSCS vector is amplified through PCR to obtain a resistance fragment 3 containing the upstream and downstream homologous fragments of the pykF gene. The specific primer sequences are shown as follows:
primer 17, having the sequence shown in SEQ ID NO: 34, and:
AGACTGTCATGAAAAAGACCAAAATTGTTTGCACCATCGGACCGAAAACCGAATCTGAAGAGATGtacggccccaaggtccaaacggtga
primer 18, having the sequence shown in SEQ ID NO: 35 is as follows:
CAAAAGCAATATTACAGGACGTGAACAGATGCGGTGTTAGTAGTGCCGCTCGGTACCAGTGCACCCATCTCTTCAGATTCGGTTTTCGGTCCGATttggcttcagggatgaggcgccatc
(2) construction of E.coli recombinant Strain YH4
Coli YH3 competent cells (100uL) were prepared, transformed with pTKRed (temperature sensitive plasmid) which is a plasmid required for Red recombination, spread on a resistance plate containing spectinomycin, and cultured overnight at 30 ℃. Then, single colonies were picked from the plate, transferred to liquid LB containing spectinomycin and IPTG, and cultured at 30 ℃ to prepare YH3 electrotransformation competence (100uL) containing pTKRed.
And (3) uniformly mixing the fragment 3 obtained in the step (1) with electrotransformation competence, coating the mixture on a double-antibody plate containing spectinomycin and chloramphenicol after electric shock, and culturing the mixture for 30 hours at the temperature of 30 ℃. The single clone was picked and subjected to colony PCR verification (primers 19 and 20 were verified), and the strain whose PCR product size was about 2310bp (containing the upstream fragment of pykF gene on the genome, the SceI-tet-SceI fragment and the downstream fragment of pykF gene on the genome) was the correct double-crossover strain.
And (3) selecting the positive clone, transferring the positive clone into an LB liquid culture medium containing spectinomycin, IPTG and arabinose, culturing for 8-12h, and then diluting and coating the bacterial liquid on a flat plate containing spectinomycin, IPTG and arabinose for overnight culture. The purpose of this step was to induce the expression of SceI with arabinose, cut DNA containing SceI recognition sites, promote intramolecular homologous recombination of positive transformants, and remove the tet-resistant fragment. Several single clones were picked from the plate and colony PCR was performed again (primers 15 and 16 were verified), and transformants with DNA of approximately 364bp of PCR product were positive clones. The positive clones were transferred to liquid LB without antibody and cultured at 37 ℃ for 8-12 hours to remove pTKRed plasmid. The transformant PCR is sent to sequence verification and a correct strain is preserved, namely an Escherichia coli recombinant engineering strain with the pyruvate kinase coding gene pykF knocked out, namely an Escherichia coli recombinant engineering strain without the pyruvate kinase coding gene pykF, is named as YH 4. The specific primer sequences are shown as follows:
primer 19, having the sequence shown in SEQ ID NO: 36, shown in the figure: AACTTCGGCACCAGACGTTG
Primer 20, having the sequence shown in SEQ ID NO: 37, shown in the figure: TCTGAACGTCAGAAGACAGC
(3) Construction of Escherichia coli recombinant Strain YH4-1
The recombinant expression vector pACYCDuet-glk-pgi was transformed into recombinant strain YH4 to obtain recombinant strain YH 4-1.
Example 5 construction of E.coli recombinant Strain YH5-1
(1) Construction of a pgm Gene knockout recombinant fragment
According to a glucose phosphate mutase coding gene pgm derived from escherichia coli in a KEGG database, primers 21 and 22 of upstream 65bp homologous fragments and downstream 65bp homologous fragments of the pgm are designed, and a SceI-tet-SceI fragment on a pTKSCS vector is amplified through PCR to obtain a resistance fragment 4 containing the upstream and downstream homologous fragments of the pgm gene. The specific primer sequences are shown as follows:
primer 21, having the sequence shown in SEQ ID NO: 38, shown in the figure:
AAACGTTGCAGACAAAGGACAAAGCAATGGCAATCCACAATCGTGCAGGCCAACCTGCACAACAGtacggccccaaggtccaaacggtga
primer 22, having the sequence shown in SEQ ID NO: 39:
GTGTTTACGCGTTTTTCAGAACTTCGCTAACAATCTCAACCGCTTCTTTCTCAATCTGCTTGCGCTGTTGTGCAGGTTGGCCTGCACGATTGTGttggcttcagggatgaggcgccatc
(2) construction of E.coli recombinant Strain YH5
Coli YH4 competent cells (100. mu.L) were prepared, transformed with plasmid pTKRed (temperature sensitive plasmid) required for Red recombination, spread on a resistance plate containing spectinomycin, and cultured overnight at 30 ℃. Then, single colonies were picked from the plate, transferred to liquid LB containing spectinomycin and IPTG, and cultured at 30 ℃ to prepare YH4 electrotransformation competence (100. mu.L) containing pTKRed.
And (3) uniformly mixing the fragment 4 obtained in the step (1) with electrotransformation competence, coating the mixture on a double-antibody plate containing spectinomycin and chloramphenicol after electric shock, and culturing the mixture for 30 hours at the temperature of 30 ℃. The single clone was picked and subjected to colony PCR verification (verification primers: primer 23 and primer 24) to verify that the strain with a PCR product size of about 2200bp (containing upstream fragment of pgm gene on genome, SceI-tet-SceI fragment and downstream fragment of pgm gene on genome) was the correct double-crossover strain.
And (3) selecting the positive clone, transferring the positive clone into an LB liquid culture medium containing spectinomycin, IPTG and arabinose, culturing for 8-12h, and then diluting and coating the bacterial liquid on a flat plate containing spectinomycin, IPTG and arabinose for overnight culture. The purpose of this step was to induce the expression of SceI with arabinose, cut DNA containing SceI recognition sites, promote intramolecular homologous recombination of positive transformants, and remove the tet-resistant fragment. Several single clones were picked from the plate and colony PCR was performed again (primers 15 and 16 were verified), and transformants with DNA of about 807bp in PCR product were positive clones. The positive clones were transferred to liquid LB without antibody and cultured at 37 ℃ for 8-12 hours to remove pTKRed plasmid. The transformant PCR is subjected to sequencing verification and the correct strain is stored, namely the Escherichia coli recombinant engineering strain with the glucose phosphoglucomutase coding gene pgm knocked out, namely the Escherichia coli recombinant engineering strain without the glucose phosphoglucomutase coding gene pgm is named YH 5. The specific primer sequences are shown as follows:
primer 23, having the sequence shown in SEQ ID NO: 40 is as follows: CGGTCAAAACGATTAAAGACAAG
Primer 24, having the sequence shown in SEQ ID NO: 41, the following steps: CCAGTCGCCAGCTAATGATG
(3) Construction of Escherichia coli recombinant Strain YH5-1
The recombinant expression vector pACYCDuet-glk-pgi was transformed into recombinant strain YH5 to obtain recombinant strain YH 5-1.
Example 6 construction of E.coli recombinant Strain YH6-1
(1) Construction of zwf Gene knockout recombinant fragments
According to a glucose-6-phosphate dehydrogenase coding gene zwf derived from escherichia coli in a KEGG database, a primer 21 and a primer 22 of an upstream 65bp homologous fragment and a downstream 65bp homologous fragment of the zwf are designed, and a SceI-tet-SceI fragment on a pTKSCS vector is amplified through PCR (polymerase chain reaction) to obtain a resistance fragment 5 containing the upstream and downstream homologous fragments of the zwf gene. The specific primer sequences are shown as follows:
primer 25, having the sequence shown in SEQ ID NO: 42, shown in the figure:
GTTAACTTAAGGAGAATGACATGGCGGTAACGCAAACAGCCCAGGCCTGTGACCTGGTCATTTTCtacggccccaaggtccaaacggtga
primer 26, having the sequence shown in SEQ ID NO: 43 is shown as follows:
AAGCGCAGATATTACTCAAACTCATTCCAGGAACGACCATCACGGGTAATCATCGCCACCGAGGCGAAAATGACCAGGTCACAGGCCTGGGCTGTttggcttcagggatgaggcgccatc
(2) construction of E.coli recombinant Strain YH6
Coli YH5 competent cells (100uL) were prepared, transformed with pTKRed (temperature sensitive plasmid) which is a plasmid required for Red recombination, spread on a resistance plate containing spectinomycin, and cultured overnight at 30 ℃. Then, single colonies were picked from the plate, transferred to liquid LB containing spectinomycin and IPTG, and cultured at 30 ℃ to prepare YH5 electrotransformation competence (100uL) containing pTKRed.
And (3) uniformly mixing the fragment 5 obtained in the step (1) with electrotransformation competence, coating the mixture on a double-antibody plate containing spectinomycin and chloramphenicol after electric shock, and culturing the mixture for 30 hours at the temperature of 30 ℃. The single clone was picked and subjected to colony PCR verification (verification primers were primer 27 and primer 28) and the strain whose PCR product size was about 2306bp (containing upstream fragment of zwf gene on genome, SceI-tet-SceI fragment and downstream fragment of zwf gene on genome) was the correct double-crossover strain.
And (3) selecting the positive clone, transferring the positive clone into an LB liquid culture medium containing spectinomycin, IPTG and arabinose, culturing for 8-12h, and then diluting and coating the bacterial liquid on a flat plate containing spectinomycin, IPTG and arabinose for overnight culture. The purpose of this step was to induce the expression of SceI with arabinose, cut DNA containing SceI recognition sites, promote intramolecular homologous recombination of positive transformants, and remove the tet-resistant fragment. Several single clones were picked from the plate and colony PCR was performed again (primers 27 and 28 were verified), and transformants with DNA of approximately 913bp of the PCR product were positive clones. The positive clones were transferred to liquid LB without antibody and cultured at 37 ℃ for 8-12 hours to remove pTKRed plasmid. The transformant PCR was subjected to sequencing verification and the correct strain, i.e., the E.coli recombinant engineered strain with the glucose-6-phosphate dehydrogenase encoding gene zwf knocked out, i.e., the E.coli recombinant engineered strain without the glucose-6-phosphate dehydrogenase encoding gene zwf was named YH 6. The specific primer sequences are shown as follows:
primer 27, having the sequence shown in SEQ ID NO: 44, shown in the figure: GATTTGCTCAAATGTTCCAGC
And a primer 28, the sequence of which is shown as SEQ ID NO: 45, and: GCAACATGCTTTTCAAAGAG
(3) Construction of Escherichia coli recombinant Strain YH6-1
The recombinant expression vector pACYCDuet-glk-pgi was transformed into recombinant strain YH6 to obtain recombinant strain YH 6-1.
Example 7 construction of recombinant Escherichia coli Strain MG1655-1
(1) Construction of recombinant expression vector pETDuet-t6pe-t6pp
Based on tagatose-6-phosphate epimerase T6PE derived from Agrobacterium tumefaciens str.C58 and tagatose-6-phosphate phosphatase T6PP gene derived from Archaeoglobus fulgidus or Archaeoglobus profundus in KEGG database, primer 29 and primer 30 were designed to amplify T6pe, and primer 31 and primer 32 were designed to amplify T6 pp. Design of primers 33 and 34 amplification of plasmid backbone pETDuet (FIG. 2D), Single cloning ligation[5]Constructing a recombinant expression vector pETDuet-t6 pe; then, a plasmid skeleton pETDuet-t6pe is amplified by designing a primer 35 and a primer 36, and a recombinant expression vector pETDuet-t6pe-t6pp is obtained by a simple cloning method. The specific primer sequences are shown as follows:
primer 29, having the sequence shown in SEQ ID NO: 46 is shown as follows:
GTTAAGTATAAGAAGGAGATATACATATGAACACCGAACATCCGCTGAAAAATG
primer 30, having the sequence shown in SEQ ID NO: 47, shown in the figure:
CGGTGGCAGCAGCCTAGGTTAATTACTCGAGAATCAGTTTGAATTCACCG
primer 31, having the sequence shown in SEQ ID NO: 48, and:
GTTTAACTTTAAGAAGGAGATATACCATGTTCAAGCCGAAAGCGATCGCG
primer 32, having the sequence shown in SEQ ID NO: 49 shows:
GATTACTTTCTGTTCGACTTAAGCATTAACGCAGCAGGCCCAGAAACTGCAG
primer 33, having the sequence shown in SEQ ID NO: 50 is as follows:
CATTTTTCAGCGGATGTTCGGTGTTCATATGTATATCTCCTTCTTATACTTAAC
primer 34, having the sequence shown in SEQ ID NO: 51, shown in the figure:
CGGTGAATTCAAACTGATTCTCGAGTAATTAACCTAGGCTGCTGCCACCG
primer 35, having the sequence shown in SEQ ID NO: 52, shown in the figure:
CTGCAGTTTCTGGGCCTGCTGCGTTAATGCTTAAGTCGAACAGAAAGTAATC
primer 36, having the sequence shown in SEQ ID NO: 53, shown in the figure:
CGCGATCGCTTTCGGCTTGAACATGGTATATCTCCTTCTTAAAGTTAAAC
(2) construction of recombinant Escherichia coli Strain MG1655-1
The recombinant expression vector pETDuet-t6pe-t6pp was transformed into Escherichia coli MG1655(DE3) to obtain recombinant strain MG 1655-1.
In the same way, recombinant expression vector pETDuet-t6pe-t6pp was introduced into E.coli recombinant strains YH1, YH2, YH3-1, YH4-1, YH5-1 and YH6-1 to obtain E.coli recombinant strains YH1-1, YH2-1, YH3-2, YH4-2, YH5-2 and YH6-2 which enhance the enzymatic activities of tagatose 6-phosphate epimerase and tagatose 6-phosphate phosphatase.
Example 8 application of recombinant Strain of Escherichia coli MG1655-1 in production of tagatose
(1) Synthesis of tagatose from glucose by fermentation of escherichia coli recombinant strain MG1655-1
100mL of LB medium (10g/L peptone, 5g/L yeast extract, 10g/L sodium chloride and 25ng/mL kanamycin) is selected, 20g/L glucose is added, the Escherichia coli recombinant strain MG1655-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp, and the filtrate is filtered by a 0.22 mu m microfiltration membrane for high performance liquid chromatography. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Escherichia coli recombinant strain MG1655-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the recombinant Escherichia coli strain MG1655-1 at 37 deg.C and 200rmp for 12-24h, centrifuging the sample at 14000rmp for 20min after fermentation, filtering with 0.22 μm microporous membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 9 application of E.coli recombinant Strain YH1-1 in tagatose production
(1) Synthesis of tagatose by fermenting glucose with escherichia coli recombinant strain YH1-1
100mL of LB medium (10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride and 25ng/mL of kanamycin) is selected, 20g/L of glucose is added, the Escherichia coli recombinant strain YH1-1 is cultured for 12-24h at 37 ℃ and 200rmp, after fermentation is finished, the sample is centrifuged for 20min at 14000rmp, and is filtered by a 0.22 mu m microporous filter membrane, and the filtrate is subjected to high performance liquid phase analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Escherichia coli recombinant strain YH1-1 for synthesizing tagatose by fermenting glucose and glycerol
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the Escherichia coli recombinant strain YH1-1 for 12-24h at 37 ℃ under 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering with a 0.22 μm microporous filter membrane, and performing high performance liquid analysis on the filtrate. The following items were used for HPLC analysisCarrying out: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 10 application of E.coli recombinant Strain YH2-1 in tagatose production
(1) Synthesis of tagatose by fermenting glucose with escherichia coli recombinant strain YH2-1
100mL of LB medium (10g/L of peptone, 5g/L of yeast extract, 10g/L of sodium chloride and 25ng/mL of kanamycin) is selected, 20g/L of glucose is added, the Escherichia coli recombinant strain YH2-1 is cultured for 12-24h at 37 ℃ and 200rmp, after fermentation is finished, the sample is centrifuged for 20min at 14000rmp, and is filtered by a 0.22 mu m microporous filter membrane, and the filtrate is subjected to high performance liquid phase analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Escherichia coli recombinant strain YH2-1 for synthesizing tagatose by fermenting glucose and glycerol
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the Escherichia coli recombinant strain YH2-1 for 12-24h at 37 ℃ under 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering with a 0.22 μm microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 11 application of E.coli recombinant Strain YH3-2 in tagatose production
(1) Synthesis of tagatose by fermenting glucose with escherichia coli recombinant strain YH3-2
100mL of LB culture medium (10g/L of peptone, 5g/L of yeast extract and 5g/L of sodium chloride, 25ng/mL of kanamycin, and 100ng/mL of ampicillin) is selected, glucose with the final concentration of 20g/L is added, the recombinant Escherichia coli strain YH3-2 is cultured for 12-24h at 37 ℃ and under the condition of 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22-micron microfiltration membrane, and the filtrate is subjected to high performance liquid phase analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Escherichia coli recombinant strain YH3-2 for synthesizing tagatose by fermenting glucose and glycerol
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the Escherichia coli recombinant strain YH3-2 at 37 ℃ under 200rmp for 12-24h, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering with a 0.22 μm microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 12 application of E.coli recombinant Strain YH4-2 in tagatose production
(1) Synthesis of tagatose by fermenting glucose with escherichia coli recombinant strain YH4-2
Selecting 100mL LB culture medium (10g/L peptone, 5g/L yeast extract and 5g/L sodium chloride, 25ng/mL kanamycin, 100ng/mL ampicillin), adding 20g/L glucose, culturing the Escherichia coli recombinant strain YH4-2 at 37 ℃ under 200rmp for 12-24h, and fermentingAfter that, the sample was centrifuged at 14000rmp for 20min and filtered through a 0.22 μm microfiltration membrane, and the filtrate was subjected to HPLC analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Escherichia coli recombinant strain YH4-2 for synthesizing tagatose by fermenting glucose and glycerol
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the Escherichia coli recombinant strain YH4-2 at 37 ℃ under 200rmp for 12-24h, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering with a 0.22 μm microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 13 application of E.coli recombinant Strain YH5-2 in tagatose production
(1) Synthesis of tagatose by fermenting glucose with escherichia coli recombinant strain YH5-2
100mL of LB culture medium (10g/L of peptone, 5g/L of yeast extract and 5g/L of sodium chloride, 25ng/mL of kanamycin, and 100ng/mL of ampicillin) is selected, glucose with the final concentration of 20g/L is added, the recombinant Escherichia coli strain YH5-2 is cultured for 12-24h at 37 ℃ and under the condition of 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22-micron microfiltration membrane, and the filtrate is subjected to high performance liquid phase analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: differential refractive detectionThe sample loading amount was 20. mu.l.
(2) Escherichia coli recombinant strain YH5-2 for synthesizing tagatose by fermenting glucose and glycerol
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the Escherichia coli recombinant strain YH5-2 at 37 ℃ under 200rmp for 12-24h, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering with a 0.22 μm microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 14 application of E.coli recombinant Strain YH6-2 in tagatose production
(1) Synthesis of tagatose by fermenting glucose with escherichia coli recombinant strain YH6-2
100mL of LB culture medium (10g/L of peptone, 5g/L of yeast extract and 5g/L of sodium chloride, 25ng/mL of kanamycin, and 100ng/mL of ampicillin) is selected, glucose with the final concentration of 20g/L is added, the recombinant Escherichia coli strain YH6-2 is cultured for 12-24h at 37 ℃ and under the condition of 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22-micron microfiltration membrane, and the filtrate is subjected to high performance liquid phase analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l. The tagatose yield was 41%.
(2) Escherichia coli recombinant strain YH6-2 for synthesizing tagatose by fermenting glucose and glycerol
100mL of M9Y medium (10g/L of glycerol, 20g/L of glucose, 6g/L of Na) was selected2HPO4，0.5g/L NaCl，3g/L KH2PO4，1g/L NH4Cl，1mM MgSO4，0.1mM CaCl2And 2g/L yeast extract), culturing the Escherichia coli recombinant strain YH6-2 at 37 ℃ under 200rmp for 12-24h, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering with a 0.22 μm microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l. The tagatose yield was 79%.
FIG. 4 shows the HPLC analysis results of the recombinant Escherichia coli strain YH6-2 fermenting glucose and glycerol to produce tagatose, wherein the recombinant Escherichia coli strain can simultaneously utilize glucose and glycerol to ferment, and efficiently produce tagatose, and the components in the fermentation reaction solution are simple, and the separation and purification of tagatose are easy.
Example 15 construction of recombinant Strain of Bacillus subtilis YJ8
(1) Construction of recombinant integration vector pSS-upp-FR
According to a uracil phosphoribosyltransferase encoding gene upp gene sequence derived from Bacillus subtilis 168 in a KEGG database, primers are designed, 500bp upstream homologous fragments and 500bp downstream homologous fragments of the uracil phosphoribosyltransferase encoding gene are obtained through PCR amplification, and a simple cloning connection mode is adopted to construct the uracil phosphoribosyltransferase encoding gene into an integration vector pSS, so that a recombinant integration vector pSS-upp-FR is obtained.
(2) Construction of Bacillus subtilis recombinant Strain YJ8
Preparation of Bacillus subtilis Strain SCK6 super competent cells[6](200. mu.L), the recombinant integration vector pSS-upp-FR (1. mu.g) and the super competent cells (200. mu.L) of the Bacillus subtilis SCK6 strain are mixed uniformly, then put into a shaking table at 37 ℃ for resuscitation for 90min, the bacterial liquid is spread on a solid culture medium LB (yeast extract 5g/L, peptone 10g/L, sodium chloride 10g/L) containing chloramphenicol (5. mu.g/mL), and placed in an incubator at 37 ℃ for culture for 14-16 h.
The colony of the positive single-exchange transformant growing on a chloramphenicol resistant plate is picked for colony PCR verification, and two strips of a 1000bp DNA fragment and a 2000bp DNA fragment (wherein the size of the 1000bp DNA fragment is the size of the fragments of the upstream and downstream homology arms of the upp coding gene in the vector of the vector pSS-upp-FR, and the size of the 2000bp DNA fragment is the size of the fragments comprising the upstream homology arm of the upp coding gene, the upp coding gene and the downstream homology arm of the upp coding gene on the genome) are obtained through PCR amplification and are used as positive clones.
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the culture was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on solid plates of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XPizzen 100.0mL/L,1000 XPS 1.0mL/L), and incubated at 37 ℃ for 24 h. The aim of the step is to promote the intramolecular homologous recombination of the positive transformant through the LB culture medium without adding antibiotics, and then obtain the upp knockout target transformant through the screening culture of the 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 1000bp as a positive clone through PCR amplification. And sending the transformant PCR to a sequencing verification to verify and store a correct strain, namely a bacillus subtilis recombinant engineering strain with a uracil phosphoribosyltransferase coding gene knocked out, namely a bacillus subtilis recombinant engineering strain without the activity of the uracil phosphoribosyltransferase, and named as YJ 8.
Example 16 construction of recombinant Strain of Bacillus subtilis YJ9
(1) Construction of recombinant integration vector pSS-ptsG-FR
According to a PTS system glucose specific transfer protein coding gene ptsG gene sequence derived from Bacillus subtilis 168 in a KEGG database, primers are designed, a 500bp upstream homologous fragment and a 500bp downstream homologous fragment of the PTS system glucose specific transfer protein coding gene are obtained through PCR amplification, and a simple cloning connection mode is adopted to construct an integration vector pSS to obtain a recombinant integration vector pSS-ptsG-FR.
(2) Construction of Bacillus subtilis recombinant Strain YJ9
Preparing super competent cells (200 mu L) of a bacillus subtilis strain YJ8, uniformly mixing a recombinant integration vector pSS-ptsG-FR (1 mu g) with the super competent cells (200 mu L) of the bacillus subtilis strain YJ8, then putting the mixture into a shaking table at 37 ℃ for resuscitation for 90min, coating the bacterial liquid into a solid culture medium LB (5 g/L of yeast extract, 10g/L of peptone and 10g/L of sodium chloride) containing chloramphenicol (5 mu g/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h.
And (3) selecting a colony of a positive single-exchange transformant growing on a chloramphenicol resistant plate for colony PCR verification, and obtaining two strips of a 1000bp DNA fragment and a 2000bp DNA fragment through PCR amplification (wherein the size of the 1000bp DNA fragment is the size of a fragment of an upstream and downstream homology arm of a ptsG coding gene in a vector pSS-ptsG-FR, and the size of the 2000bp DNA fragment is the size of a fragment of a genome comprising an upstream homology arm of the ptsG coding gene, the ptsG coding gene and a downstream homology arm of the ptsG coding gene), wherein the two strips are positive clones.
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the culture was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on solid plates of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XPizzen 100.0mL/L,1000 XPS 1.0mL/L), and incubated at 37 ℃ for 24 h. The aim of the step is to promote the intramolecular homologous recombination of positive transformants by LB culture medium without adding antibiotics, and then obtain ptsG knocked-out target transformants by screening culture in 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 1000bp as a positive clone through PCR amplification. And sending the transformant PCR to sequencing verification to verify and store a correct strain, namely a Bacillus subtilis recombinant engineering strain with a PTS system glucose specific transfer protein coding gene knocked out, namely a Bacillus subtilis recombinant engineering strain without PTS system glucose specific transfer protease activity, and naming the strain as YJ 9.
Example 17 construction of recombinant Strain of Bacillus subtilis YJ10
(1) Construction of recombinant integration vector pSS-hprK-FR
According to the HPr kinase coding gene hprK gene sequence derived from Bacillus subtilis 168 in a KEGG database, primers are designed, a 500bp upstream homologous fragment and a 500bp downstream homologous fragment of the HPr kinase coding gene are obtained through PCR amplification, and a simple cloning connection mode is adopted to construct the integration vector pSS, so that the recombinant integration vector pSS-hprK-FR is obtained.
(2) Construction of Bacillus subtilis recombinant Strain YJ10
Preparing a bacillus subtilis strain YJ9 super competent cell (200uL), uniformly mixing a recombinant integration vector pSS-hprK-FR (1ug) and the bacillus subtilis strain YJ9 super competent cell (200uL), then putting the mixture into a shaker at 37 ℃ for resuscitation for 90min, coating the bacterial liquid into a solid culture medium LB (5 g/L of yeast extract, 10g/L of peptone and 10g/L of sodium chloride) containing chloramphenicol (5ug/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h.
The colony of the positive single-crossover transformant growing on a chloramphenicol resistant plate is picked up for colony PCR verification, two strips of a 1000bp DNA fragment and a 2000bp DNA fragment are obtained by PCR amplification (wherein the size of the 1000bp DNA fragment is the size of the fragments of the upstream and downstream homology arms of the hprK coding gene in the vector of the vector pSS-hprK-FR, and the size of the 2000bp DNA fragment is the size of the fragments of the upstream homology arm of the hprK coding gene, the hprK coding gene and the downstream homology arm of the hprK coding gene on the genome) are taken as positive clones.
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the culture was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on solid plates of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XPizzen 100.0mL/L,1000 XPS 1.0mL/L), and incubated at 37 ℃ for 24 h. The aim of the step is to promote the intramolecular homologous recombination of positive transformants by LB culture medium without adding antibiotics, and then obtain ptsG knocked-out target transformants by screening culture in 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 1000bp as a positive clone through PCR amplification. And sending the transformant to a sequencing verification PCR for verifying and storing a correct strain, namely a Bacillus subtilis recombinant engineering strain with a gene with a knocked-out HPr kinase coding gene, namely a Bacillus subtilis recombinant engineering strain without the activity of the HPr kinase enzyme, and naming the strain as YJ 10.
EXAMPLE 18 construction of recombinant Strain YJ11 of Bacillus subtilis
(1) Construction of recombinant integration vector pSS-ptsG-FR-glcK-pgi
According to a glcK gene sequence of a glucose kinase coding gene derived from Bacillus subtilis 168 and a pgi gene sequence of a glucose 6-phosphate isomerase coding gene derived from Bacillus subtilis 168 in a KEGG database, primers are designed to amplify the glcK gene and the pgi gene, and the glcK gene and the pgi gene are constructed into an integration vector pSS-ptsG-FR in a simple cloning connection mode, so that a recombinant integration vector pSS-ptsG-FR-glcK-pgi is obtained.
(2) Construction of Bacillus subtilis recombinant Strain YJ11
Preparing super competent cells (200 mu L) of a bacillus subtilis strain YJ10, uniformly mixing a recombinant integration vector pSS-ptsG-FR-glcK-pgi (1ug) with the super competent cells (200uL) of the bacillus subtilis strain YJ10, then putting the mixture into a shaker at 37 ℃ for recovery for 90min, spreading the bacterial solution in a solid culture medium LB (5 g/L of yeast extract, 10g/L of peptone and 10g/L of sodium chloride) containing chloramphenicol (5ug/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h.
The colony of the positive single-crossover transformant growing on a chloramphenicol resistant plate is picked up for colony PCR verification, and two strips of a 2000bp DNA fragment and a 4000bp DNA fragment are obtained through PCR amplification (wherein the size of the 2000bp DNA fragment is the size of the fragment comprising the upstream homology arm of a ptsG encoding gene, the ptsG encoding gene and the downstream homology arm of the ptsG encoding gene in a genome, and the size of the 4000bp DNA fragment is the size of the fragment comprising the upstream homology arm of the ptsG encoding gene, the glcK gene, the pgi gene and the downstream homology arm of the ptsG encoding gene in a vector pSS-ptsG-FR-glcK-pgi).
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the bacterial solution was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on a solid plate of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XSizen 100.0mL/L,1000 XScale 1.0mL/L), and incubated at 37 ℃ for 24h in an incubator. The aim of the step is to promote the intramolecular homologous recombination of positive transformants by LB culture medium without adding antibiotics, and then obtain the target transformants with the glcK gene and the pgi gene integrated to the ptsG gene site by screening culture in 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 4000bp as a positive clone through PCR amplification. And (3) sending the transformant to sequencing for verification and storing a correct strain, namely a bacillus subtilis recombinant engineering strain integrating a glucokinase coding gene glcK gene sequence and a glucose-6-phosphate isomerase coding gene pgi into a ptsG site, namely a bacillus subtilis recombinant engineering strain for enhancing the activity of glucokinase and glucose-6-phosphate isomerase, and is named as YJ 11.
Example 19 construction of recombinant Strain of Bacillus subtilis YJ12
(1) Construction of recombinant integration vector pSS-pfkA-FR
According to a gene sequence of a fructose-6-phosphokinase coding gene pfkA derived from Bacillus subtilis 168 in a KEGG database, primers are designed, a homologous fragment of 500bp at the upstream and a homologous fragment of 500bp at the downstream of the fructose-6-phosphokinase coding gene are obtained through PCR amplification, and a simple cloning connection mode is adopted to construct an integration vector pSS to obtain a recombinant integration vector pSS-pfkA-FR.
(2) Construction of Bacillus subtilis recombinant Strain YJ12
Preparing a bacillus subtilis strain YJ11 super competent cell (200uL), uniformly mixing a recombinant integration vector pSS-pfkA-FR (1ug) with the bacillus subtilis strain YJ11 super competent cell (200uL), then putting the mixture into a shaker at 37 ℃ for resuscitation for 90min, coating the bacterial liquid into a solid culture medium LB (5 g/L of yeast extract, 10g/L of peptone and 10g/L of sodium chloride) containing chloramphenicol (5ug/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h.
The colony of the positive single-crossover transformant growing on a chloramphenicol resistant plate is picked up for colony PCR verification, two strips of a 1000bp DNA fragment and a 2000bp DNA fragment are obtained by PCR amplification (wherein the size of the 1000bp DNA fragment is the size of the fragments of the upstream and downstream homology arms of the pfkA coding gene in the vector of the vector pSS-pfkA-FR, and the size of the 2000bp DNA fragment is the size of the fragments of the upstream homology arm of the pfkA coding gene, the pfkA coding gene and the downstream homology arm of the pfkA coding gene on the genome) and is a positive clone.
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the culture was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on solid plates of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XPizzen 100.0mL/L,1000 XPS 1.0mL/L), and incubated at 37 ℃ for 24 h. The aim of the step is to promote the intramolecular homologous recombination of positive transformants by LB culture medium without adding antibiotics, and then obtain pfkA knockout objective transformants by screening culture in 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 1000bp as a positive clone through PCR amplification. And sending the transformant PCR to a sequencing verification to verify and store a correct strain, namely a fructose-6-phosphokinase coding gene knocked-out bacillus subtilis recombinant engineering strain, namely a bacillus subtilis recombinant engineering strain without fructose-6-phosphokinase enzymatic activity, which is named as YJ 12.
Example 20 construction of recombinant Strain of Bacillus subtilis YJ13
(1) Construction of recombinant integration vector pSS-pgm-FR
According to a pgm gene sequence of a glucose phosphoglucomutase encoding gene derived from Bacillus subtilis 168 in a KEGG database, primers are designed, a 500bp upstream homologous fragment and a 500bp downstream homologous fragment of the glucose phosphoglucomutase encoding gene are obtained through PCR amplification, and a simple cloning connection mode is adopted to construct the integrated vector pSS to obtain the recombinant integrated vector pSS-pgm-FR.
(2) Construction of Bacillus subtilis recombinant Strain YJ13
Preparing super competent cells (200 mu L) of a bacillus subtilis strain YJ12, uniformly mixing a recombinant integration vector pSS-pgm-FR (1 mu g) and the super competent cells (200 mu L) of the bacillus subtilis strain YJ12, then putting the mixture into a shaker at 37 ℃ for resuscitation for 90min, coating the bacterial liquid into a solid culture medium LB (yeast extract 5g/L, peptone 10g/L and sodium chloride 10g/L) containing chloramphenicol (5 mu g/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h.
The colony of the positive single-crossover transformant growing on a chloramphenicol resistant plate is picked up for colony PCR verification, two strips of a 1000bp DNA fragment and a 2000bp DNA fragment are obtained by PCR amplification (wherein the size of the 1000bp DNA fragment is the size of the fragments of upstream and downstream homology arms of a pgm coding gene in a vector pSS-pgm-FR in the vector, and the size of the 2000bp DNA fragment is the size of the fragments comprising the upstream homology arm of the pgm coding gene, the pgm coding gene and the downstream homology arm of the pgm coding gene on a genome) and are used as positive clones.
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the culture was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on solid plates of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XPizzen 100.0mL/L,1000 XPS 1.0mL/L), and incubated at 37 ℃ for 24 h. The aim of the step is to promote the intramolecular homologous recombination of positive transformants by LB culture medium without adding antibiotics, and then obtain pgm knockout objective transformants by screening culture in 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 1000bp as a positive clone through PCR amplification. And sending the transformant PCR to a sequencing verification to verify and store a correct strain, namely a bacillus subtilis recombinant engineering strain with a glucose phosphoglucomutase coding gene knocked out, namely a bacillus subtilis recombinant engineering strain without the activity of the glucose phosphoglucomutase enzyme, and naming the strain as YJ 13.
Example 21 construction of recombinant Strain of Bacillus subtilis YJ14
(1) Construction of recombinant integration vector pSS-zwf-FR
According to a Zwf gene sequence of a glucose 6-phosphate dehydrogenase encoding gene derived from Bacillus subtilis 168 in a KEGG database, primers are designed, a 500bp upstream homologous fragment and a 500bp downstream homologous fragment of the glucose 6-phosphate dehydrogenase encoding gene are obtained through PCR amplification, and a simple cloning connection mode is adopted to construct an integration vector pSS to obtain a recombinant integration vector pSS-zwf-FR.
(2) Construction of Bacillus subtilis recombinant Strain YJ14
Preparing super competent cells (200 mu L) of a bacillus subtilis strain YJ13, uniformly mixing a recombinant integration vector pSS-zwf-FR (1 mu g) with the super competent cells (200 mu L) of the bacillus subtilis strain YJ13, then putting the mixture into a shaking table at 37 ℃ for resuscitation for 90min, coating the bacterial liquid into a solid culture medium LB (5 g/L of yeast extract, 10g/L of peptone and 10g/L of sodium chloride) containing chloramphenicol (5 mu g/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h.
The colony of the positive single-crossover transformant growing on a chloramphenicol resistant plate is picked for colony PCR verification, and two strips of a 1000bp DNA fragment and a 2000bp DNA fragment (wherein the size of the 1000bp DNA fragment is the size of the fragments of the upstream and downstream homology arms of the zwf coding gene in the vector of the vector pSS-pgm-FR, and the size of the 2000bp DNA fragment is the size of the fragments of the upstream homology arm of the zwf coding gene, the zwf coding gene and the downstream homology arm of the zwf coding gene on the genome) are obtained by PCR amplification as positive clones.
The positive clones were picked and transferred to LB medium without antibiotic for 8-12h, 200uL of the culture was centrifuged to remove the supernatant, and then resuspended in sterile water and spread on solid plates of 5-FU basic salt medium (40% glucose 20.0mL/L, 4% glutamine 50.0mL/L, 0.5% histadine 10.0mL/L, 1% vitamin B11.0 mL/L,20mM5-FU 500. mu.L/L, 10 XPizzen 100.0mL/L,1000 XPS 1.0mL/L), and incubated at 37 ℃ for 24 h. The aim of the step is to promote the intramolecular homologous recombination of positive transformants by LB culture medium without adding antibiotics, and then obtain the target transformants with zwf knockout by screening culture in 5-FU basic salt culture medium.
Selecting a plurality of colonies from the solid plate of the 5-FU basic salt culture medium, carrying out colony PCR verification again, and obtaining a transformant with a DNA fragment of only 1000bp as a positive clone through PCR amplification. And sending the transformant PCR to a sequencing verification to verify and store a correct strain, namely a glucose 6-phosphate dehydrogenase coding gene knocked-out bacillus subtilis recombinant engineering strain, namely a bacillus subtilis recombinant engineering strain without the activity of the glucose 6-phosphate dehydrogenase enzyme, and naming the strain as YJ 14.
Example 22 construction of recombinant Bacillus subtilis SKC6-1
(1) Construction of recombinant expression vector pWB980-T6PE-T6PP
According to tagatose-6-phosphate epimerase T6PE derived from Agrobacterium tumefaciens str.C58 and tagatose-6-phosphate phosphatase T6PP genes derived from Archaeoglobus fulgidus or Archaeoglobus profundus in a KEGG database, primers are designed, gene fragments of the tagatose-6-phosphate epimerase and the tagatose-6-phosphate phosphatase are obtained through PCR amplification, and a single cloning connection mode is adopted to construct an expression vector pWB980 so as to obtain a recombinant expression vector pWB980-T6PE-T6 PP.
(2) Construction of recombinant Bacillus subtilis Strain SCK6-1
Preparing super competent cells (200 mu L) of a bacillus subtilis strain SCK6, uniformly mixing a recombinant expression vector pWB980-T6PE-T6PP (1 mu g) with the super competent cells (200 mu L) of the bacillus subtilis strain SCK6, then putting the mixture into a shaker at 37 ℃ for recovery for 90min, coating the bacterial liquid into a solid culture medium LB (yeast extract 5g/L, peptone 10g/L and sodium chloride 10g/L) containing kanamycin (25ug/mL), and putting the solid culture medium LB into an incubator at 37 ℃ for culture for 14-16 h. The colony of the positive single-crossover transformant growing on the kanamycin-resistant plate is selected for colony PCR verification, and the transformant of the DNA fragment of 2000bp obtained by PCR amplification is a positive clone. The transformant was subjected to PCR sequencing for verification and the correct strain was stored, i.e., the recombinant engineered strain of Bacillus subtilis with enhanced activity of tagatose-6-phosphate epimerase and tagatose 6-phosphate phosphatase, was named SCK 6-1.
The plasmid pWB980-T6PE-T6PP was introduced into Bacillus subtilis recombinant strains YJ8, YJ9, YJ10, YJ11, YJ12, YJ13 and YJ14 in the same manner, and thus Bacillus subtilis recombinant engineered strains YJ8-1, YJ9-1, YJ10-1, YJ11-1, YJ12-1, YJ13-1 and YJ14-1, which enhance the enzymatic activities of tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase, were obtained.
Example 23 application of recombinant engineered Bacillus subtilis strain SCK6-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain SCK6-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain SCK6-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain SCK6-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L and glycerol with the final concentration of 20g/L, culturing the recombinant engineering strain SCK6-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, and fermentingAfter that, the sample was centrifuged at 14000rmp for 20min and filtered through a 0.22 μm microfiltration membrane, and the filtrate was subjected to HPLC analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 24 application of Bacillus subtilis recombinant engineered Strain YJ8-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ8-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ8-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain YJ8-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin (25 ng/mL) is added with 20g/L glucose and 20g/L glycerol, the bacillus subtilis recombinant engineering strain YJ8-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22 mu m microfiltration membrane, and the filtrate is subjected to high performance liquid analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: differential refractive detector, sample loading20 μ l.
Example 25 application of Bacillus subtilis recombinant engineered Strain YJ9-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ9-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ9-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain YJ9-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin (25 ng/mL) is added with 20g/L glucose and 20g/L glycerol, the bacillus subtilis recombinant engineering strain YJ9-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22 mu m microfiltration membrane, and the filtrate is subjected to high performance liquid analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 26 application of Bacillus subtilis recombinant engineered Strain YJ10-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ10-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ10-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain YJ10-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin (25 ng/mL) is added with 20g/L glucose and 20g/L glycerol, the bacillus subtilis recombinant engineering strain YJ10-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22 mu m microfiltration membrane, and the filtrate is subjected to high performance liquid analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 27 application of Bacillus subtilis recombinant engineered Strain YJ11-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ11-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ11-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the apparatus isAn Agilent high performance liquid chromatograph 1200, an analytical column: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain YJ11-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin (25 ng/mL) is added with 20g/L glucose and 20g/L glycerol, the bacillus subtilis recombinant engineering strain YJ11-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22 mu m microfiltration membrane, and the filtrate is subjected to high performance liquid analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 28 application of Bacillus subtilis recombinant engineered Strain YJ12-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ12-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ12-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain YJ12-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin (25 ng/mL) is added with 20g/L glucose and 20g/L glycerol, the bacillus subtilis recombinant engineering strain YJ12-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22 mu m microfiltration membrane, and the filtrate is subjected to high performance liquid analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 29 application of Bacillus subtilis recombinant engineered Strain YJ13-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ13-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ13-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
(2) Bacillus subtilis recombinant engineering strain YJ13-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding 20g/L glucose and 20g/L glycerol, culturing the recombinant engineered strain YJ13-1 of the bacillus subtilis at 37 ℃ under 200rmp for 12-24h, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, and filtering by using 0.22 mu m milliporeFiltering with membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l.
Example 30 application of Bacillus subtilis recombinant engineered Strain YJ14-1 in tagatose production
(1) Bacillus subtilis recombinant engineering strain YJ14-1 for fermenting glucose to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin 25ng/mL), adding glucose with the final concentration of 20g/L, culturing the recombinant engineering strain YJ14-1 of the bacillus subtilis for 12-24h under the conditions of 37 ℃ and 200rmp, centrifuging the sample at 14000rmp for 20min after the fermentation is finished, filtering the sample by using a 0.22 mu m microporous filter membrane, and performing high performance liquid analysis on the filtrate. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l. The tagatose yield was 33%.
(2) Bacillus subtilis recombinant engineering strain YJ14-1 for fermenting glucose and glycerol to synthesize tagatose
100mL of SR medium (15g/L peptone, 25g/L yeast extract and 3g/L K) was selected2HPO4Kanamycin (25 ng/mL) is added with 20g/L glucose and 20g/L glycerol, the bacillus subtilis recombinant engineering strain YJ14-1 is cultured for 12-24h under the conditions of 37 ℃ and 200rmp, after the fermentation is finished, the sample is centrifuged for 20min at 14000rmp and filtered by a 0.22 mu m microfiltration membrane, and the filtrate is subjected to high performance liquid analysis. The HPLC analysis was performed under the following conditions: the instrument is an Agilent high performance liquid chromatograph 1200, and the analysis column comprises: HPX-87H, mobile phase: 5mM H2SO4Flow rate: 0.6mL/min, column temperature: 60 ℃, detector: a differential refractometer was used in an amount of 20. mu.l. The tagatose yield was 70%.
FIG. 5 shows the HPLC analysis results of Bacillus subtilis strain YJ14-1 for fermenting glucose and glycerol to produce tagatose, the Bacillus subtilis strain can be fermented with glucose and glycerol to produce tagatose with high efficiency, and the fermentation reaction solution has simple components and is easy to separate and purify tagatose.
[5]You,C.,Zhang,X.Z.,&Zhang,Y.H.(2012).Simple cloning via direct transformation of PCR product(DNA Multimer)to Escherichia coli and Bacillus subtilis.Appl.Environ.Microbiol.,78(5),1593-1595.doi:10.1128/AEM.07105-11.
[6]Zhang,X.Z.,&Zhang,Y.H.P.(2011).Simple,fast and high-efficiency transformation system for directed evolution of cellulase in Bacillus subtilis.Microb.Biotechnol.,4(1),98-105.doi:10.1111/j.1751-7915.2010.00230.x.
All technical features disclosed in the present specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is one example only of a generic series of equivalent or similar features.
Furthermore, from the foregoing description, one skilled in the art can readily appreciate the key features of the disclosure from the present disclosure, that numerous modifications can be made to adapt the invention to various usages and conditions without departing from the spirit and scope of the disclosure, and therefore, such modifications are intended to fall within the scope of the appended claims.
Sequence listing
<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences
<120> recombinant microorganism, preparation method thereof and application thereof in producing tagatose
<130> 6A17-2083360I
<141> 2020-11-05
<160> 55
<170> SIPOSequenceListing 1.0
<210> 1
<211> 477
<212> PRT
<213> Escherichia coli
<400> 1
Met Phe Lys Asn Ala Phe Ala Asn Leu Gln Lys Val Gly Lys Ser Leu
1 5 10 15
Met Leu Pro Val Ser Val Leu Pro Ile Ala Gly Ile Leu Leu Gly Val
20 25 30
Gly Ser Ala Asn Phe Ser Trp Leu Pro Ala Val Val Ser His Val Met
35 40 45
Ala Glu Ala Gly Gly Ser Val Phe Ala Asn Met Pro Leu Ile Phe Ala
50 55 60
Ile Gly Val Ala Leu Gly Phe Thr Asn Asn Asp Gly Val Ser Ala Leu
65 70 75 80
Ala Ala Val Val Ala Tyr Gly Ile Met Val Lys Thr Met Ala Val Val
85 90 95
Ala Pro Leu Val Leu His Leu Pro Ala Glu Glu Ile Ala Ser Lys His
100 105 110
Leu Ala Asp Thr Gly Val Leu Gly Gly Ile Ile Ser Gly Ala Ile Ala
115 120 125
Ala Tyr Met Phe Asn Arg Phe Tyr Arg Ile Lys Leu Pro Glu Tyr Leu
130 135 140
Gly Phe Phe Ala Gly Lys Arg Phe Val Pro Ile Ile Ser Gly Leu Ala
145 150 155 160
Ala Ile Phe Thr Gly Val Val Leu Ser Phe Ile Trp Pro Pro Ile Gly
165 170 175
Ser Ala Ile Gln Thr Phe Ser Gln Trp Ala Ala Tyr Gln Asn Pro Val
180 185 190
Val Ala Phe Gly Ile Tyr Gly Phe Ile Glu Arg Cys Leu Val Pro Phe
195 200 205
Gly Leu His His Ile Trp Asn Val Pro Phe Gln Met Gln Ile Gly Glu
210 215 220
Tyr Thr Asn Ala Ala Gly Gln Val Phe His Gly Asp Ile Pro Arg Tyr
225 230 235 240
Met Ala Gly Asp Pro Thr Ala Gly Lys Leu Ser Gly Gly Phe Leu Phe
245 250 255
Lys Met Tyr Gly Leu Pro Ala Ala Ala Ile Ala Ile Trp His Ser Ala
260 265 270
Lys Pro Glu Asn Arg Ala Lys Val Gly Gly Ile Met Ile Ser Ala Ala
275 280 285
Leu Thr Ser Phe Leu Thr Gly Ile Thr Glu Pro Ile Glu Phe Ser Phe
290 295 300
Met Phe Val Ala Pro Ile Leu Tyr Ile Ile His Ala Ile Leu Ala Gly
305 310 315 320
Leu Ala Phe Pro Ile Cys Ile Leu Leu Gly Met Arg Asp Gly Thr Ser
325 330 335
Phe Ser His Gly Leu Ile Asp Phe Ile Val Leu Ser Gly Asn Ser Ser
340 345 350
Lys Leu Trp Leu Phe Pro Ile Val Gly Ile Gly Tyr Ala Ile Val Tyr
355 360 365
Tyr Thr Ile Phe Arg Val Leu Ile Lys Ala Leu Asp Leu Lys Thr Pro
370 375 380
Gly Arg Glu Asp Ala Thr Glu Asp Ala Lys Ala Thr Gly Thr Ser Glu
385 390 395 400
Met Ala Pro Ala Leu Val Ala Ala Phe Gly Gly Lys Glu Asn Ile Thr
405 410 415
Asn Leu Asp Ala Cys Ile Thr Arg Leu Arg Val Ser Val Ala Asp Val
420 425 430
Ser Lys Val Asp Gln Ala Gly Leu Lys Lys Leu Gly Ala Ala Gly Val
435 440 445
Val Val Ala Gly Ser Gly Val Gln Ala Ile Phe Gly Thr Lys Ser Asp
450 455 460
Asn Leu Lys Thr Glu Met Asp Glu Tyr Ile Arg Asn His
465 470 475
<210> 2
<211> 1431
<212> DNA
<213> Escherichia coli
<400> 2
atgtttaaga atgcatttgc taacctgcaa aaggtcggta aatcgctgat gctgccggta 60
tccgtactgc ctatcgcagg tattctgctg ggcgtcggtt ccgcgaattt cagctggctg 120
cccgccgttg tatcgcatgt tatggcagaa gcaggcggtt ccgtctttgc aaacatgcca 180
ctgatttttg cgatcggtgt cgccctcggc tttaccaata acgatggcgt atccgcgctg 240
gccgcagttg ttgcctatgg catcatggtt aaaaccatgg ccgtggttgc gccactggta 300
ctgcatttac ctgctgaaga aatcgcctct aaacacctgg cggatactgg cgtactcgga 360
gggattatct ccggtgcgat cgcagcgtac atgtttaacc gtttctaccg tattaagctg 420
cctgagtatc ttggcttctt tgccggtaaa cgctttgtgc cgatcatttc tggcctggct 480
gccatcttta ctggcgttgt gctgtccttc atttggccgc cgattggttc tgcaatccag 540
accttctctc agtgggctgc ttaccagaac ccggtagttg cgtttggcat ttacggtttc 600
atcgaacgtt gcctggtacc gtttggtctg caccacatct ggaacgtacc tttccagatg 660
cagattggtg aatacaccaa cgcagcaggt caggttttcc acggcgacat tccgcgttat 720
atggcgggtg acccgactgc gggtaaactg tctggtggct tcctgttcaa aatgtacggt 780
ctgccagctg ccgcaattgc tatctggcac tctgctaaac cagaaaaccg cgcgaaagtg 840
ggcggtatta tgatctccgc ggcgctgacc tcgttcctga ccggtatcac cgagccgatc 900
gagttctcct tcatgttcgt tgcgccgatc ctgtacatca tccacgcgat tctggcaggc 960
ctggcattcc caatctgtat tcttctgggg atgcgtgacg gtacgtcgtt ctcgcacggt 1020
ctgatcgact tcatcgttct gtctggtaac agcagcaaac tgtggctgtt cccgatcgtc 1080
ggtatcggtt atgcgattgt ttactacacc atcttccgcg tgctgattaa agcactggat 1140
ctgaaaacgc cgggtcgtga agacgcgact gaagatgcaa aagcgacagg taccagcgaa 1200
atggcaccgg ctctggttgc tgcatttggt ggtaaagaaa acattactaa cctcgacgca 1260
tgtattaccc gtctgcgcgt cagcgttgct gatgtgtcta aagtggatca ggccggcctg 1320
aagaaactgg gcgcagcggg cgtagtggtt gctggttctg gtgttcaggc gattttcggt 1380
actaaatccg ataacctgaa aaccgagatg gatgagtaca tccgtaacca c 1431
<210> 3
<211> 699
<212> PRT
<213> Bacillus subtilis
<400> 3
Met Phe Lys Ala Leu Phe Gly Val Leu Gln Lys Ile Gly Arg Ala Leu
1 5 10 15
Met Leu Pro Val Ala Ile Leu Pro Ala Ala Gly Ile Leu Leu Ala Ile
20 25 30
Gly Asn Ala Met Gln Asn Lys Asp Met Ile Gln Val Leu His Phe Leu
35 40 45
Ser Asn Asp Asn Val Gln Leu Val Ala Gly Val Met Glu Ser Ala Gly
50 55 60
Gln Ile Val Phe Asp Asn Leu Pro Leu Leu Phe Ala Val Gly Val Ala
65 70 75 80
Ile Gly Leu Ala Asn Gly Asp Gly Val Ala Gly Ile Ala Ala Ile Ile
85 90 95
Gly Tyr Leu Val Met Asn Val Ser Met Ser Ala Val Leu Leu Ala Asn
100 105 110
Gly Thr Ile Pro Ser Asp Ser Val Glu Arg Ala Lys Phe Phe Thr Glu
115 120 125
Asn His Pro Ala Tyr Val Asn Met Leu Gly Ile Pro Thr Leu Ala Thr
130 135 140
Gly Val Phe Gly Gly Ile Ile Val Gly Val Leu Ala Ala Leu Leu Phe
145 150 155 160
Asn Arg Phe Tyr Thr Ile Glu Leu Pro Gln Tyr Leu Gly Phe Phe Ala
165 170 175
Gly Lys Arg Phe Val Pro Ile Val Thr Ser Ile Ser Ala Leu Ile Leu
180 185 190
Gly Leu Ile Met Leu Val Ile Trp Pro Pro Ile Gln His Gly Leu Asn
195 200 205
Ala Phe Ser Thr Gly Leu Val Glu Ala Asn Pro Thr Leu Ala Ala Phe
210 215 220
Ile Phe Gly Val Ile Glu Arg Ser Leu Ile Pro Phe Gly Leu His His
225 230 235 240
Ile Phe Tyr Ser Pro Phe Trp Tyr Glu Phe Phe Ser Tyr Lys Ser Ala
245 250 255
Ala Gly Glu Ile Ile Arg Gly Asp Gln Arg Ile Phe Met Ala Gln Ile
260 265 270
Lys Asp Gly Val Gln Leu Thr Ala Gly Thr Phe Met Thr Gly Lys Tyr
275 280 285
Pro Phe Met Met Phe Gly Leu Pro Ala Ala Ala Leu Ala Ile Tyr His
290 295 300
Glu Ala Lys Pro Gln Asn Lys Lys Leu Val Ala Gly Ile Met Gly Ser
305 310 315 320
Ala Ala Leu Thr Ser Phe Leu Thr Gly Ile Thr Glu Pro Leu Glu Phe
325 330 335
Ser Phe Leu Phe Val Ala Pro Val Leu Phe Ala Ile His Cys Leu Phe
340 345 350
Ala Gly Leu Ser Phe Met Val Met Gln Leu Leu Asn Val Lys Ile Gly
355 360 365
Met Thr Phe Ser Gly Gly Leu Ile Asp Tyr Phe Leu Phe Gly Ile Leu
370 375 380
Pro Asn Arg Thr Ala Trp Trp Leu Val Ile Pro Val Gly Leu Gly Leu
385 390 395 400
Ala Val Ile Tyr Tyr Phe Gly Phe Arg Phe Ala Ile Arg Lys Phe Asn
405 410 415
Leu Lys Thr Pro Gly Arg Glu Asp Ala Ala Glu Glu Thr Ala Ala Pro
420 425 430
Gly Lys Thr Gly Glu Ala Gly Asp Leu Pro Tyr Glu Ile Leu Gln Ala
435 440 445
Met Gly Asp Gln Glu Asn Ile Lys His Leu Asp Ala Cys Ile Thr Arg
450 455 460
Leu Arg Val Thr Val Asn Asp Gln Lys Lys Val Asp Lys Asp Arg Leu
465 470 475 480
Lys Gln Leu Gly Ala Ser Gly Val Leu Glu Val Gly Asn Asn Ile Gln
485 490 495
Ala Ile Phe Gly Pro Arg Ser Asp Gly Leu Lys Thr Gln Met Gln Asp
500 505 510
Ile Ile Ala Gly Arg Lys Pro Arg Pro Glu Pro Lys Thr Ser Ala Gln
515 520 525
Glu Glu Val Gly Gln Gln Val Glu Glu Val Ile Ala Glu Pro Leu Gln
530 535 540
Asn Glu Ile Gly Glu Glu Val Phe Val Ser Pro Ile Thr Gly Glu Ile
545 550 555 560
His Pro Ile Thr Asp Val Pro Asp Gln Val Phe Ser Gly Lys Met Met
565 570 575
Gly Asp Gly Phe Ala Ile Leu Pro Ser Glu Gly Ile Val Val Ser Pro
580 585 590
Val Arg Gly Lys Ile Leu Asn Val Phe Pro Thr Lys His Ala Ile Gly
595 600 605
Leu Gln Ser Asp Gly Gly Arg Glu Ile Leu Ile His Phe Gly Ile Asp
610 615 620
Thr Val Ser Leu Lys Gly Glu Gly Phe Thr Ser Phe Val Ser Glu Gly
625 630 635 640
Asp Arg Val Glu Pro Gly Gln Lys Leu Leu Glu Val Asp Leu Asp Ala
645 650 655
Val Lys Pro Asn Val Pro Ser Leu Met Thr Pro Ile Val Phe Thr Asn
660 665 670
Leu Ala Glu Gly Glu Thr Val Ser Ile Lys Ala Ser Gly Ser Val Asn
675 680 685
Arg Glu Gln Glu Asp Ile Val Lys Ile Glu Lys
690 695
<210> 4
<211> 2097
<212> DNA
<213> Bacillus subtilis
<400> 4
atgtttaaag cattattcgg cgttcttcaa aaaattgggc gtgcgcttat gcttccagtt 60
gcgatccttc cggctgcggg tattttgctt gcgatcggga atgcgatgca aaataaggac 120
atgattcagg tcctgcattt cttgagcaat gacaatgttc agcttgtagc aggtgtgatg 180
gaaagtgctg ggcagattgt tttcgataac cttccgcttc ttttcgcagt aggtgtagcc 240
atcgggcttg ccaatggtga tggagttgca gggattgcag caattatcgg ttatcttgta 300
atgaatgtat ccatgagtgc ggttcttctt gcaaacggaa ccattccttc ggattcagtt 360
gaaagagcca agttctttac ggaaaaccat cctgcatatg taaacatgct tggtatacct 420
accttggcga caggggtgtt cggcggtatt atcgtcggtg tgttagctgc attattgttt 480
aacagatttt acacaattga actgccgcaa taccttggtt tctttgcggg taaacgtttc 540
gttccaattg ttacgtcaat ttctgcactg attctgggtc ttattatgtt agtgatctgg 600
cctccaatcc agcatggatt gaatgccttt tcaacaggat tagtggaagc gaatccaacc 660
cttgctgcat ttatcttcgg ggtgattgaa cgttcgctta tcccattcgg attgcaccat 720
attttctatt caccgttctg gtatgaattc ttcagctata agagtgcagc aggagaaatc 780
atccgcgggg atcagcgtat ctttatggcg cagattaaag acggcgtaca gttaacggca 840
ggtacgttca tgacaggtaa atatccattt atgatgttcg gtctgcctgc tgcggcgctt 900
gccatttatc atgaagcaaa accgcaaaac aaaaaactcg ttgcaggtat tatgggttca 960
gcggccttga catctttctt aacggggatc acagagccat tggaattttc tttcttattc 1020
gttgctccag tcctgtttgc gattcactgt ttgtttgcgg gactttcatt catggtcatg 1080
cagctgttga atgttaagat tggtatgaca ttctccggcg gtttaattga ctacttccta 1140
ttcggtattt taccaaaccg gacggcatgg tggcttgtca tccctgtcgg cttagggtta 1200
gcggtcattt actactttgg attccgattt gccatccgca aatttaatct gaaaacacct 1260
ggacgcgagg atgctgcgga agaaacagca gcacctggga aaacaggtga agcaggagat 1320
cttccttatg agattctgca ggcaatgggt gaccaggaaa acatcaaaca ccttgatgct 1380
tgtatcactc gtctgcgtgt gactgtaaac gatcagaaaa aggttgataa agaccgtctg 1440
aaacagcttg gcgcttccgg agtgctggaa gtcggcaaca acattcaggc tattttcgga 1500
ccgcgttctg acgggttaaa aacacaaatg caagacatta ttgcgggacg caagcctaga 1560
cctgagccga aaacatctgc tcaagaggaa gtaggccagc aggttgagga agtgattgca 1620
gaaccgctgc aaaatgaaat cggcgaggaa gttttcgttt ctccgattac cggggaaatt 1680
cacccaatta cggatgttcc tgaccaagtc ttctcaggga aaatgatggg tgacggtttt 1740
gcgattctcc cttctgaagg aattgtcgta tcaccggttc gcggaaaaat tctcaatgtg 1800
ttcccgacaa aacatgcgat cggcctgcaa tccgacggcg gaagagaaat tttaatccac 1860
tttggtattg ataccgtcag cctgaagggc gaaggattta cgtctttcgt atcagaagga 1920
gaccgcgttg agcctggaca aaaacttctt gaagttgatc tggatgcagt caaaccgaat 1980
gtaccatctc tcatgacacc gattgtattt acaaaccttg ctgaaggaga aacagtcagc 2040
attaaagcaa gcggttcagt caacagagaa caagaagata ttgtgaagat tgaaaaa 2097
<210> 5
<211> 425
<212> PRT
<213> Agrobacterium tumefaciens
<400> 5
Met Thr Ala Ile Leu Glu Asn Leu Ala Ala Ala Arg Arg Ala Gly Lys
1 5 10 15
Pro Ala Gly Ile Thr Ser Val Cys Ser Ala His Pro Val Val Leu Arg
20 25 30
Ala Ala Ile Arg Arg Ala Ala Ala Ser Gln Thr Ala Val Leu Ile Glu
35 40 45
Ala Thr Cys Asn Gln Val Asn His Leu Gly Gly Tyr Thr Gly Met Thr
50 55 60
Pro Arg Asp Phe Val Ala Phe Val Asn Ser Ile Ala Ala Glu Glu Gly
65 70 75 80
Leu Pro Ala Glu Leu Leu Ile Phe Gly Gly Asp His Leu Gly Pro Asn
85 90 95
Pro Trp Arg Arg Glu Lys Ala Glu Asp Ala Leu Thr Lys Ala Ala Ala
100 105 110
Met Val Asp Ala Tyr Val Thr Ala Gly Phe Arg Lys Ile His Leu Asp
115 120 125
Ala Ser Met Gly Cys Ala Gly Glu Pro Ala Ala Leu Asp Asp Val Thr
130 135 140
Ile Ala His Arg Ala Ala Lys Leu Thr Ala Val Ala Glu Lys Ala Ala
145 150 155 160
Thr Glu Ala Gly Leu Pro Lys Pro Leu Tyr Ile Leu Gly Thr Glu Val
165 170 175
Pro Val Pro Gly Gly Ala Asp His Val Leu Glu Thr Val Ala Pro Thr
180 185 190
Glu Pro Gln Ala Ala Arg Asn Thr Ile Asp Leu His Arg Glu Ile Phe
195 200 205
Ala Gln His Gly Leu Ser Asp Ala Phe Glu Arg Val Ile Ala Phe Val
210 215 220
Val Gln Pro Gly Val Glu Phe Gly Ser Asp Asn Val Val Ala Tyr Asp
225 230 235 240
Pro Gln Ala Ala Gln Ser Leu Ser Ala Val Leu Asp Gly Glu Pro Arg
245 250 255
Leu Val Phe Glu Ala His Ser Thr Asp Tyr Gln Thr Glu Pro Ala Leu
260 265 270
Ala Ala Leu Val Arg Asp Gly Tyr Pro Ile Leu Lys Val Gly Pro Gly
275 280 285
Leu Thr Phe Ala Tyr Arg Glu Ala Leu Tyr Ala Leu Asp Met Ile Ala
290 295 300
Ser Glu Met Val Gly Thr Tyr Gly Asp Arg Pro Leu Ala Arg Thr Met
305 310 315 320
Glu Lys Leu Met Leu Ser Ala Pro Gly Asp Trp Gln Gly His Tyr His
325 330 335
Gly Asp Asp Ile Thr Leu Arg Leu Gln Arg His Tyr Ser Tyr Ser Asp
340 345 350
Arg Ile Arg Tyr Tyr Trp Thr Arg Pro Glu Ala Leu Ala Ala Val Ser
355 360 365
Thr Leu His Lys Ala Leu Asp Gly Lys Thr Ile Pro Glu Thr Leu Leu
370 375 380
Arg Gln Tyr Leu Gly Glu Leu Pro Leu Ala Ala Val Ala Gly Lys Glu
385 390 395 400
Pro Glu Glu Val Leu Val Ala Ala Val Asp Gln Val Leu Ala Thr Tyr
405 410 415
His Ala Ala Thr Gly Glu Gly Arg His
420 425
<210> 6
<211> 1275
<212> DNA
<213> Agrobacterium tumefaciens
<400> 6
atgaccgcca ttttggaaaa tctcgccgcc gcgcgccgcg ccggcaaacc tgcgggcatc 60
acttcggtct gctcggccca ccccgttgtc ctgcgcgccg caatccgccg cgccgccgcc 120
agtcaaacgg ccgtactgat cgaggccacc tgcaatcagg tcaatcatct cggtggttat 180
accggcatga caccgcgtga cttcgttgcc ttcgtcaaca gcatcgccgc ggaagaagga 240
ctgcccgccg aactgctgat ctttggcggc gatcatctcg gccccaatcc ctggcgcagg 300
gagaaggccg aggacgcgct gacaaaagcc gccgccatgg tcgacgccta tgtcacagct 360
ggttttcgca agatccacct tgatgcatcg atgggctgcg ccggtgagcc ggcagccctg 420
gatgacgtca ccatcgccca ccgcgccgcg aaactcacag ccgttgccga aaaggcagcc 480
actgaggctg gcctgccaaa accgctttat attctgggca ccgaagtgcc ggtgcccggc 540
ggtgccgacc atgtgcttga gaccgtcgca ccgaccgaac cgcaggcggc gcgcaacacc 600
atcgatcttc atcgcgaaat ctttgcgcag cacggtcttt ccgatgcgtt cgaacgggtc 660
atcgcctttg tcgtgcagcc gggtgtggaa ttcggcagcg acaatgtcgt cgcttatgat 720
ccgcaggcag cgcagagcct gagcgccgtg ctggatggcg aaccgcgact ggtcttcgaa 780
gcccattcga ccgattacca gaccgagcct gcccttgcgg cactggtacg cgacggatat 840
ccgatcctca aagttggacc gggcctcacc ttcgcttacc gggaagcgct ttatgcactc 900
gacatgatcg cctccgaaat ggtcggcacc tatggcgacc gaccgctggc gcggactatg 960
gaaaaattga tgttaagcgc gccgggcgac tggcagggcc attaccatgg cgacgacatc 1020
acgctccgat tgcaacgcca ttacagctac agcgaccgca tccgttacta ctggacgcga 1080
ccggaagcgc tcgcggccgt ttccaccttg cataaggcac tggatgggaa gacaattccc 1140
gaaaccctgc tgcgccaata tctcggcgaa ttgccgctcg cggcggttgc gggaaaggaa 1200
ccggaggagg ttctggtcgc ggcggtggat caggtgctgg cgacctatca cgcggcgacg 1260
ggcgaaggcc gccac 1275
<210> 7
<211> 223
<212> PRT
<213> Archaeoglobus fulgidus
<400> 7
Met Phe Lys Pro Lys Ala Ile Ala Val Asp Ile Asp Gly Thr Leu Thr
1 5 10 15
Asp Arg Lys Arg Ala Leu Asn Cys Arg Ala Val Glu Ala Leu Arg Lys
20 25 30
Val Lys Ile Pro Val Ile Leu Ala Thr Gly Asn Ile Ser Cys Phe Ala
35 40 45
Arg Ala Ala Ala Lys Leu Ile Gly Val Ser Asp Val Val Ile Cys Glu
50 55 60
Asn Gly Gly Val Val Arg Phe Glu Tyr Asp Gly Glu Asp Ile Val Leu
65 70 75 80
Gly Asp Lys Glu Lys Cys Val Glu Ala Val Arg Val Leu Glu Lys His
85 90 95
Tyr Glu Val Glu Leu Leu Asp Phe Glu Tyr Arg Lys Ser Glu Val Cys
100 105 110
Met Arg Arg Ser Phe Asp Ile Asn Glu Ala Arg Lys Leu Ile Glu Gly
115 120 125
Met Gly Val Lys Leu Val Asp Ser Gly Phe Ala Tyr His Ile Met Asp
130 135 140
Ala Asp Val Ser Lys Gly Lys Ala Leu Lys Phe Val Ala Glu Arg Leu
145 150 155 160
Gly Ile Ser Ser Ala Glu Phe Ala Val Ile Gly Asp Ser Glu Asn Asp
165 170 175
Ile Asp Met Phe Arg Val Ala Gly Phe Gly Ile Ala Val Ala Asn Ala
180 185 190
Asp Glu Arg Leu Lys Glu Tyr Ala Asp Leu Val Thr Pro Ser Pro Asp
195 200 205
Gly Glu Gly Val Val Glu Ala Leu Gln Phe Leu Gly Leu Leu Arg
210 215 220
<210> 8
<211> 669
<212> DNA
<213> Archaeoglobus fulgidus
<400> 8
atgttcaaac caaaggccat cgcagttgac atagatggca ccctcaccga cagaaagagg 60
gctctgaact gcagggctgt tgaagctctc cgcaaggtaa aaattcccgt gattttggcc 120
actggtaaca tatcttgttt tgcgagggct gcagcaaagc tgattggagt ctcagacgtg 180
gtaatctgcg agaatggggg cgtggtgagg ttcgagtacg atggggagga tattgtttta 240
ggagataaag agaaatgcgt tgaggctgtg agggtgcttg agaaacacta tgaggttgag 300
ctgctggact tcgaatacag gaagtcggaa gtgtgcatga ggaggagctt tgacatcaac 360
gaggcgagaa agctcattga ggggatgggg gttaagcttg tggattcagg ctttgcctac 420
cacattatgg atgctgatgt tagcaaggga aaagctttga agttcgttgc cgagaggctt 480
ggtatcagtt cagcggagtt tgcagttatc ggcgactcag agaacgacat agacatgttc 540
agagttgctg gattcggaat tgctgttgcc aatgccgatg agaggctgaa ggagtatgct 600
gatttagtta cgccatcacc agacggcgag ggggttgttg aggctttgca gtttctggga 660
ttgttgcgg 669
<210> 9
<211> 321
<212> PRT
<213> Escherichia coli
<400> 9
Met Thr Lys Tyr Ala Leu Val Gly Asp Val Gly Gly Thr Asn Ala Arg
1 5 10 15
Leu Ala Leu Cys Asp Ile Ala Ser Gly Glu Ile Ser Gln Ala Lys Thr
20 25 30
Tyr Ser Gly Leu Asp Tyr Pro Ser Leu Glu Ala Val Ile Arg Val Tyr
35 40 45
Leu Glu Glu His Lys Val Glu Val Lys Asp Gly Cys Ile Ala Ile Ala
50 55 60
Cys Pro Ile Thr Gly Asp Trp Val Ala Met Thr Asn His Thr Trp Ala
65 70 75 80
Phe Ser Ile Ala Glu Met Lys Lys Asn Leu Gly Phe Ser His Leu Glu
85 90 95
Ile Ile Asn Asp Phe Thr Ala Val Ser Met Ala Ile Pro Met Leu Lys
100 105 110
Lys Glu His Leu Ile Gln Phe Gly Gly Ala Glu Pro Val Glu Gly Lys
115 120 125
Pro Ile Ala Val Tyr Gly Ala Gly Thr Gly Leu Gly Val Ala His Leu
130 135 140
Val His Val Asp Lys Arg Trp Val Ser Leu Pro Gly Glu Gly Gly His
145 150 155 160
Val Asp Phe Ala Pro Asn Ser Glu Glu Glu Ala Ile Ile Leu Glu Ile
165 170 175
Leu Arg Ala Glu Ile Gly His Val Ser Ala Glu Arg Val Leu Ser Gly
180 185 190
Pro Gly Leu Val Asn Leu Tyr Arg Ala Ile Val Lys Ala Asp Asn Arg
195 200 205
Leu Pro Glu Asn Leu Lys Pro Lys Asp Ile Thr Glu Arg Ala Leu Ala
210 215 220
Asp Ser Cys Thr Asp Cys Arg Arg Ala Leu Ser Leu Phe Cys Val Ile
225 230 235 240
Met Gly Arg Phe Gly Gly Asn Leu Ala Leu Asn Leu Gly Thr Phe Gly
245 250 255
Gly Val Phe Ile Ala Gly Gly Ile Val Pro Arg Phe Leu Glu Phe Phe
260 265 270
Lys Ala Ser Gly Phe Arg Ala Ala Phe Glu Asp Lys Gly Arg Phe Lys
275 280 285
Glu Tyr Val His Asp Ile Pro Val Tyr Leu Ile Val His Asp Asn Pro
290 295 300
Gly Leu Leu Gly Ser Gly Ala His Leu Arg Gln Thr Leu Gly His Ile
305 310 315 320
Leu
<210> 10
<211> 963
<212> DNA
<213> Escherichia coli
<400> 10
atgacaaagt atgcattagt cggtgatgtg ggcggcacca acgcacgtct tgctctgtgt 60
gatattgcca gtggtgaaat ctcgcaggct aagacctatt cagggcttga ttaccccagc 120
ctcgaagcgg tcattcgcgt ttatcttgaa gaacataagg tcgaggtgaa agacggctgt 180
attgccatcg cttgcccaat taccggtgac tgggtggcga tgaccaacca tacctgggcg 240
ttctcaattg ccgaaatgaa aaagaatctc ggttttagcc atctggaaat tattaacgat 300
tttaccgctg tatcgatggc gatcccgatg ctgaaaaaag agcatctgat tcagtttggt 360
ggcgcagaac cggtcgaagg taagcctatt gcggtttacg gtgccggaac ggggcttggg 420
gttgcgcatc tggtccatgt cgataagcgt tgggtaagct tgccaggcga aggcggtcac 480
gttgattttg cgccgaatag tgaagaagag gccattatcc tcgaaatatt gcgtgcggaa 540
attggtcatg tttcggcgga gcgcgtgctt tctggccctg ggctggtgaa tttgtatcgc 600
gcaattgtga aagctgacaa ccgcctgcca gaaaatctca agccaaaaga tattaccgaa 660
cgcgcgctgg ctgacagctg caccgattgc cgccgcgcat tgtcgctgtt ttgcgtcatt 720
atgggccgtt ttggcggcaa tctggcgctc aatctcggga catttggcgg cgtgtttatt 780
gcgggcggta tcgtgccgcg cttccttgag ttcttcaaag cctccggttt ccgtgccgca 840
tttgaagata aagggcgctt taaagaatat gtccatgata ttccggtgta tctcatcgtc 900
catgacaatc cgggccttct cggttccggt gcacatttac gccagacctt aggtcacatt 960
ctg 963
<210> 11
<211> 321
<212> PRT
<213> Bacillus subtilis
<400> 11
Met Asp Glu Ile Trp Phe Ala Gly Ile Asp Leu Gly Gly Thr Thr Ile
1 5 10 15
Lys Leu Ala Phe Ile Asn Gln Tyr Gly Glu Ile Gln His Lys Trp Glu
20 25 30
Val Pro Thr Asp Lys Thr Gly Asp Thr Ile Thr Val Thr Ile Ala Lys
35 40 45
Thr Ile Asp Ser Lys Leu Asp Glu Leu Gln Lys Pro Lys His Ile Ile
50 55 60
Lys Tyr Ile Gly Met Gly Ala Pro Gly Pro Val Asp Met Ala Ala Gly
65 70 75 80
Val Val Tyr Glu Thr Val Asn Leu Gly Trp Lys Asn Tyr Ala Leu Lys
85 90 95
Asn His Leu Glu Thr Glu Thr Gly Ile Pro Ala Val Ile Glu Asn Asp
100 105 110
Ala Asn Ile Ala Ala Leu Gly Glu Met Trp Lys Gly Ala Gly Asp Gly
115 120 125
Ala Lys Asp Val Ile Leu Val Thr Leu Gly Thr Gly Val Gly Gly Gly
130 135 140
Ile Ile Ala Asn Gly Glu Ile Val His Gly Ile Asn Gly Ala Gly Gly
145 150 155 160
Glu Ile Gly His Ile Cys Ser Ile Pro Glu Gly Gly Ala Pro Cys Asn
165 170 175
Cys Gly Lys Thr Gly Cys Ile Glu Thr Ile Ala Ser Ala Thr Gly Ile
180 185 190
Val Arg Ile Ala Lys Glu Lys Ile Ala Asn Ala Lys Lys Thr Thr Arg
195 200 205
Leu Lys Ala Thr Glu Gln Leu Ser Ala Arg Asp Val Phe Glu Ala Ala
210 215 220
Gly Glu Asn Asp Glu Ile Ala Leu Glu Val Val Asp Tyr Val Ala Lys
225 230 235 240
His Leu Gly Leu Val Leu Gly Asn Leu Ala Ser Ser Leu Asn Pro Ser
245 250 255
Lys Ile Val Leu Gly Gly Gly Val Ser Arg Ala Gly Glu Leu Leu Arg
260 265 270
Ser Lys Val Glu Lys Thr Phe Arg Lys Cys Ala Phe Pro Arg Ala Ala
275 280 285
Gln Ala Ala Asp Ile Ser Ile Ala Ala Leu Gly Asn Asp Ala Gly Val
290 295 300
Ile Gly Gly Ala Trp Ile Ala Lys Asn Glu Trp Leu Lys His Gln Asn
305 310 315 320
Cys
<210> 12
<211> 963
<212> DNA
<213> Bacillus subtilis
<400> 12
atggacgaga tatggtttgc gggcattgac ctgggaggaa cgacgattaa actcgctttt 60
attaatcaat atggcgaaat tcagcataag tgggaagttc cgacagataa aaccggcgac 120
acgattactg tcacaattgc aaaaacaatc gacagcaagc tggatgagct gcaaaaaccg 180
aagcacatca tcaaatacat cggaatgggt gcaccaggcc ctgtagatat ggcggcagga 240
gtggtttatg aaacagtaaa tctagggtgg aaaaattatg ctttgaaaaa ccatctggag 300
acagaaaccg gcatcccagc tgttatagaa aatgacgcga atattgctgc gctcggggaa 360
atgtggaagg gagcgggtga tggcgcaaaa gacgtcattc tcgtgacgct tggcacagga 420
gttggcggcg gcatcattgc aaatggtgaa attgtacatg gtataaatgg cgccggcgga 480
gaaatcggcc atatttgcag catccctgaa ggcggagcgc cctgcaactg cggcaaaacg 540
ggctgtatcg aaacaattgc gtcagcaacc ggaattgtaa gaattgcaaa agaaaaaata 600
gcaaatgcta aaaagacgac acgtttaaaa gcaaccgaac aattgtcagc gcgagatgtg 660
tttgaagcgg cgggtgaaaa tgatgaaatt gcccttgagg tggttgatta tgtagccaag 720
catcttggtt tggtgctcgg aaatttggca agctcgctta atccatccaa aatcgttctt 780
ggcggcggcg tatcgagagc cggagaactg ctgagatcaa aagtcgagaa aacattccgc 840
aaatgcgcgt ttccgcgggc agcccaagct gctgatattt caatcgcagc acttggaaat 900
gatgccggcg ttatcggagg cgcttggatc gctaaaaatg aatggctgaa acatcaaaat 960
tgt 963
<210> 13
<211> 549
<212> PRT
<213> Escherichia coli
<400> 13
Met Lys Asn Ile Asn Pro Thr Gln Thr Ala Ala Trp Gln Ala Leu Gln
1 5 10 15
Lys His Phe Asp Glu Met Lys Asp Val Thr Ile Ala Asp Leu Phe Ala
20 25 30
Lys Asp Gly Asp Arg Phe Ser Lys Phe Ser Ala Thr Phe Asp Asp Gln
35 40 45
Met Leu Val Asp Tyr Ser Lys Asn Arg Ile Thr Glu Glu Thr Leu Ala
50 55 60
Lys Leu Gln Asp Leu Ala Lys Glu Cys Asp Leu Ala Gly Ala Ile Lys
65 70 75 80
Ser Met Phe Ser Gly Glu Lys Ile Asn Arg Thr Glu Asn Arg Ala Val
85 90 95
Leu His Val Ala Leu Arg Asn Arg Ser Asn Thr Pro Ile Leu Val Asp
100 105 110
Gly Lys Asp Val Met Pro Glu Val Asn Ala Val Leu Glu Lys Met Lys
115 120 125
Thr Phe Ser Glu Ala Ile Ile Ser Gly Glu Trp Lys Gly Tyr Thr Gly
130 135 140
Lys Ala Ile Thr Asp Val Val Asn Ile Gly Ile Gly Gly Ser Asp Leu
145 150 155 160
Gly Pro Tyr Met Val Thr Glu Ala Leu Arg Pro Tyr Lys Asn His Leu
165 170 175
Asn Met His Phe Val Ser Asn Val Asp Gly Thr His Ile Ala Glu Val
180 185 190
Leu Lys Lys Val Asn Pro Glu Thr Thr Leu Phe Leu Val Ala Ser Lys
195 200 205
Thr Phe Thr Thr Gln Glu Thr Met Thr Asn Ala His Ser Ala Arg Asp
210 215 220
Trp Phe Leu Lys Ala Ala Gly Asp Glu Lys His Val Ala Lys His Phe
225 230 235 240
Ala Ala Leu Ser Thr Asn Ala Lys Ala Val Gly Glu Phe Gly Ile Asp
245 250 255
Thr Ala Asn Met Phe Glu Phe Trp Asp Trp Val Gly Gly Arg Tyr Ser
260 265 270
Leu Trp Ser Ala Ile Gly Leu Ser Ile Val Leu Ser Ile Gly Phe Asp
275 280 285
Asn Phe Val Glu Leu Leu Ser Gly Ala His Ala Met Asp Lys His Phe
290 295 300
Ser Thr Thr Pro Ala Glu Lys Asn Leu Pro Val Leu Leu Ala Leu Ile
305 310 315 320
Gly Ile Trp Tyr Asn Asn Phe Phe Gly Ala Glu Thr Glu Ala Ile Leu
325 330 335
Pro Tyr Asp Gln Tyr Met His Arg Phe Ala Ala Tyr Phe Gln Gln Gly
340 345 350
Asn Met Glu Ser Asn Gly Lys Tyr Val Asp Arg Asn Gly Asn Val Val
355 360 365
Asp Tyr Gln Thr Gly Pro Ile Ile Trp Gly Glu Pro Gly Thr Asn Gly
370 375 380
Gln His Ala Phe Tyr Gln Leu Ile His Gln Gly Thr Lys Met Val Pro
385 390 395 400
Cys Asp Phe Ile Ala Pro Ala Ile Thr His Asn Pro Leu Ser Asp His
405 410 415
His Gln Lys Leu Leu Ser Asn Phe Phe Ala Gln Thr Glu Ala Leu Ala
420 425 430
Phe Gly Lys Ser Arg Glu Val Val Glu Gln Glu Tyr Arg Asp Gln Gly
435 440 445
Lys Asp Pro Ala Thr Leu Asp Tyr Val Val Pro Phe Lys Val Phe Glu
450 455 460
Gly Asn Arg Pro Thr Asn Ser Ile Leu Leu Arg Glu Ile Thr Pro Phe
465 470 475 480
Ser Leu Gly Ala Leu Ile Ala Leu Tyr Glu His Lys Ile Phe Thr Gln
485 490 495
Gly Val Ile Leu Asn Ile Phe Thr Phe Asp Gln Trp Gly Val Glu Leu
500 505 510
Gly Lys Gln Leu Ala Asn Arg Ile Leu Pro Glu Leu Lys Asp Asp Lys
515 520 525
Glu Ile Ser Ser His Asp Ser Ser Thr Asn Gly Leu Ile Asn Arg Tyr
530 535 540
Lys Ala Trp Arg Gly
545
<210> 14
<211> 1647
<212> DNA
<213> Escherichia coli
<400> 14
atgaaaaaca tcaatccaac gcagaccgct gcctggcagg cactacagaa acacttcgat 60
gaaatgaaag acgttacgat cgccgatctt tttgctaaag acggcgatcg tttttctaag 120
ttctccgcaa ccttcgacga tcagatgctg gtggattact ccaaaaaccg catcactgaa 180
gagacgctgg cgaaattaca ggatctggcg aaagagtgcg atctggcggg cgcgattaag 240
tcgatgttct ctggcgagaa gatcaaccgc actgaaaacc gcgccgtgct gcacgtagcg 300
ctgcgtaacc gtagcaatac cccgattttg gttgatggca aagacgtaat gccggaagtc 360
aacgcggtgc tggagaagat gaaaaccttc tcagaagcga ttatttccgg tgagtggaaa 420
ggttataccg gcaaagcaat cactgacgta gtgaacatcg ggatcggcgg ttctgacctc 480
ggcccataca tggtgaccga agctctgcgt ccgtacaaaa accacctgaa catgcacttt 540
gtttctaacg tcgatgggac tcacatcgcg gaagtgctga aaaaagtaaa cccggaaacc 600
acgctgttct tggtagcatc taaaaccttc accactcagg aaactatgac caacgcccat 660
agcgcgcgtg actggttcct gaaagcggca ggtgatgaaa aacacgttgc aaaacacttt 720
gcggcgcttt ccaccaatgc caaagccgtt ggcgagtttg gtattgatac tgccaacatg 780
ttcgagttct gggactgggt tggcggccgt tactctttgt ggtcagcgat tggcctgtcg 840
attgttctct ccatcggctt tgataacttc gttgaactgc tttccggcgc acacgcgatg 900
gacaagcatt tctccaccac gcctgccgag aaaaacctgc ctgtactgct ggcgctgatt 960
ggcatctggt acaacaattt ctttggtgcg gaaactgaag cgattctgcc gtatgaccag 1020
tatatgcacc gtttcgcggc gtacttccag cagggcaata tggagtccaa cggtaagtat 1080
gttgaccgta acggtaacgt tgtggattac cagactggcc cgattatctg gggtgaacca 1140
ggcactaacg gtcagcacgc gttctaccag ctgatccacc agggaaccaa aatggtaccg 1200
tgcgatttca tcgctccggc tatcacccat aacccgctct ctgatcatca ccagaaactg 1260
ctgtctaact tcttcgccca gaccgaagcg ctggcgtttg gtaaatcccg cgaagtggtt 1320
gagcaggaat atcgtgatca gggtaaagat ccggcaacgc ttgactacgt ggtgccgttc 1380
aaagtattcg aaggtaaccg cccgaccaac tccatcctgc tgcgtgaaat cactccgttc 1440
agcctgggtg cgttgattgc gctgtatgag cacaaaatct ttactcaggg cgtgatcctg 1500
aacatcttca ccttcgacca gtggggcgtg gaactgggta aacagctggc gaaccgtatt 1560
ctgccagagc tgaaagatga taaagaaatc agcagccacg atagctcgac caatggtctg 1620
attaaccgct ataaagcgtg gcgcggt 1647
<210> 15
<211> 450
<212> PRT
<213> Bacillus subtilis
<400> 15
Met Thr His Val Arg Phe Asp Tyr Ser Lys Ala Leu Thr Phe Phe Asn
1 5 10 15
Glu His Glu Leu Thr Tyr Leu Arg Asp Phe Val Lys Thr Ala His His
20 25 30
Asn Ile His Glu Lys Thr Gly Ala Gly Ser Asp Phe Leu Gly Trp Val
35 40 45
Asp Leu Pro Glu His Tyr Asp Lys Glu Glu Phe Ala Arg Ile Lys Lys
50 55 60
Ser Ala Glu Lys Ile Lys Ser Asp Ser Asp Val Leu Leu Val Val Gly
65 70 75 80
Ile Gly Gly Ser Tyr Leu Gly Ala Arg Ala Ala Ile Glu Ala Leu Asn
85 90 95
His Ala Phe Tyr Asn Thr Leu Pro Lys Ala Lys Arg Gly Asn Pro Gln
100 105 110
Val Ile Phe Ile Gly Asn Asn Ile Ser Ser Ser Tyr Met Arg Asp Val
115 120 125
Met Asp Leu Leu Glu Asp Val Asp Phe Ser Ile Asn Val Ile Ser Lys
130 135 140
Ser Gly Thr Thr Thr Glu Pro Ala Ile Ala Phe Arg Ile Phe Arg Lys
145 150 155 160
Leu Leu Glu Glu Lys Tyr Gly Lys Glu Glu Ala Lys Ala Arg Ile Tyr
165 170 175
Ala Thr Thr Asp Lys Glu Arg Gly Ala Leu Lys Thr Leu Ser Asn Glu
180 185 190
Glu Gly Phe Glu Ser Phe Val Ile Pro Asp Asp Val Gly Gly Arg Tyr
195 200 205
Ser Val Leu Thr Ala Val Gly Leu Leu Pro Ile Ala Val Ser Gly Val
210 215 220
Asn Ile Asp Asp Met Met Lys Gly Ala Leu Asp Ala Ser Lys Asp Phe
225 230 235 240
Ala Thr Ser Glu Leu Glu Asp Asn Pro Ala Tyr Gln Tyr Ala Val Val
245 250 255
Arg Asn Val Leu Tyr Asn Lys Gly Lys Thr Ile Glu Met Leu Ile Asn
260 265 270
Tyr Glu Pro Ala Leu Gln Tyr Phe Ala Glu Trp Trp Lys Gln Leu Phe
275 280 285
Gly Glu Ser Glu Gly Lys Asp Glu Lys Gly Ile Tyr Pro Ser Ser Ala
290 295 300
Asn Tyr Ser Thr Asp Leu His Ser Leu Gly Gln Tyr Val Gln Glu Gly
305 310 315 320
Arg Arg Asp Leu Phe Glu Thr Val Leu Asn Val Glu Lys Pro Lys His
325 330 335
Glu Leu Thr Ile Glu Glu Ala Asp Asn Asp Leu Asp Gly Leu Asn Tyr
340 345 350
Leu Ala Gly Lys Thr Val Asp Phe Val Asn Lys Lys Ala Phe Gln Gly
355 360 365
Thr Met Leu Ala His Thr Asp Gly Asn Val Pro Asn Leu Ile Val Asn
370 375 380
Ile Pro Glu Leu Asn Ala Tyr Thr Phe Gly Tyr Leu Val Tyr Phe Phe
385 390 395 400
Glu Lys Ala Cys Ala Met Ser Gly Tyr Leu Leu Gly Val Asn Pro Phe
405 410 415
Asp Gln Pro Gly Val Glu Ala Tyr Lys Val Asn Met Phe Ala Leu Leu
420 425 430
Gly Lys Pro Gly Phe Glu Glu Lys Lys Ala Glu Leu Glu Lys Arg Leu
435 440 445
Glu Asp
450
<210> 16
<211> 1350
<212> DNA
<213> Bacillus subtilis
<400> 16
atgacgcatg tacgctttga ctactcaaaa gcgttgactt tcttcaacga acatgaactt 60
acatacctgc gggactttgt aaaaacagca caccataata tccatgagaa aacaggcgcg 120
ggcagcgatt ttctaggctg ggtggacctc cctgaacatt atgataaaga agaattcgcg 180
cgcatcaaaa aaagcgcgga aaaaatcaaa tctgactctg atgtcttgct tgttgtcggc 240
atcggcggtt cttatcttgg agcgcgggca gcgattgaag cgctgaatca cgcgttttat 300
aacactttgc caaaagcaaa acgcggcaat ccgcaagtca tttttatcgg gaacaacatc 360
agttcatctt atatgagaga cgtcatggat cttcttgaag atgttgactt ctctattaat 420
gtgatttcta aatcaggtac gacaactgaa cctgcaatcg ctttccgtat tttccgcaag 480
cttcttgaag agaaatacgg taaagaagaa gcgaaagcgc ggatttatgc aacaactgat 540
aaagagcgcg gcgcattaaa aacgctttct aacgaagaag gctttgaatc attcgtaatt 600
cctgacgatg tcggcggccg ttattcagtt ttaacagctg taggtctctt gccgattgct 660
gtcagcggcg tcaacattga cgacatgatg aaaggcgccc tggatgcgag caaagatttt 720
gcaacatctg aactggaaga taacccagca taccaatatg cggttgttcg caatgtcctt 780
tataataagg gcaaaacaat tgaaatgctc atcaactacg aaccggcgct tcaatacttt 840
gcggaatggt ggaagcagct gttcggagaa agcgaaggga aagatgagaa gggcatttat 900
ccttcttcag cgaactattc aacagacctt cattctttag gccagtatgt acaagaaggc 960
cgcagagatt tattcgaaac ggtcctgaac gtagagaagc ctaaacatga actgacaatt 1020
gaggaagcgg ataacgatct tgacggcttg aactatttag ccggtaaaac tgttgatttc 1080
gttaacaaaa aagcattcca aggtacaatg cttgcccata cagacggaaa tgttccgaac 1140
ttaatcgtta acattcctga gctgaatgca tatacttttg gataccttgt atatttcttc 1200
gaaaaagcct gcgcgatgag cggttacctc cttggcgtca atccgtttga ccagcctggt 1260
gtagaagcgt ataaagtcaa tatgtttgcg ttactcggca aacctggctt tgaagagaaa 1320
aaagcagagc ttgaaaaacg tctggaagat 1350
<210> 17
<211> 1313
<212> DNA
<213> Artificial Sequence
<400> 17
tagggataac agggtaatat ttacgttgac accacctttc gcgtatggca tgatagcgcc 60
cggaagagag tcaattcagg gtggtgaata tgaatagttc gacaaagatc gcattggtaa 120
ttacgttact cgatgccatg gggattggcc ttatcatgcc agtcttgcca acgttattac 180
gtgaatttat tgcttcggaa gatatcgcta accactttgg cgtattgctt gcactttatg 240
cgttaatgca ggttatcttt gctccttggc ttggaaaaat gtctgaccga tttggtcggc 300
gcccagtgct gttgttgtca ttaataggcg catcgctgga ttacttattg ctggcttttt 360
caagtgcgct ttggatgctg tatttaggcc gtttgctttc agggatcaca ggagctactg 420
gggctgtcgc ggcatcggtc attgccgata ccacctcagc ttctcaacgc gtgaagtggt 480
tcggttggtt aggggcaagt tttgggcttg gtttaatagc ggggcctatt attggtggtt 540
ttgcaggaga gatttcaccg catagtccct tttttatcgc tgcgttgcta aatattgtca 600
ctttccttgt ggttatgttt tggttccgtg aaaccaaaaa tacacgtgat aatacagata 660
ccgaagtagg ggttgagacg caatcaaatt cggtgtacat cactttattt aaaacgatgc 720
ccattttgtt gattatttat ttttcagcgc aattgatagg ccaaattccc gcaacggtgt 780
gggtgctatt taccgaaaat cgttttggat ggaatagcat gatggttggc ttttcattag 840
cgggtcttgg tcttttacac tcagtattcc aagcctttgt ggcaggaaga atagccacta 900
aatggggcga aaaaacggca gtactgctcg aatttattgc agatagtagt gcatttgcct 960
ttttagcgtt tatatctgaa ggttggttag atttccctgt tttaatttta ttggctggtg 1020
gtgggatcgc tttacctgca ttacagggag tgatgtctat ccaaacaaag agtcatgagc 1080
aaggtgcttt acagggatta ttggtgagcc ttaccaatgc aaccggtgtt attggcccat 1140
tactgtttac tgttatttat aatcattcac taccaatttg ggatggctgg atttggatta 1200
ttggtttagc gttttactgt attattatcc tgctatcaat gaccttcatg ttgacccctc 1260
aagctcaggg gagtaaacag gagacaagtg cttagtaggg ataacagggt aat 1313
<210> 18
<211> 90
<212> DNA
<213> Artificial Sequence
<400> 18
caggagcact ctcaattatg tttaagaatg catttgctaa cctgcaaaag gtcggtaaat 60
cgctgtacgg ccccaaggtc caaacggtga 90
<210> 19
<211> 120
<212> DNA
<213> Artificial Sequence
<400> 19
gccatctggc tgccttagtc tccccaacgt cttacggatt agtggttacg gatgtactca 60
tccatcagcg atttaccgac cttttgcagg ttagcttggc ttcagggatg aggcgccatc 120
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 20
cgtcaaacaa attggcactg 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 21
gaacgtcaat aacctgttcg 20
<210> 22
<211> 51
<212> DNA
<213> Artificial Sequence
<400> 22
gtttaacttt aataaggaga tataccatga caaagtatgc attagtcggt g 51
<210> 23
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 23
cgattacttt ctgttcgact taagcattac agaatgtgac ctaaggtctg 50
<210> 24
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 24
gttaagtata agaaggagat atacatatga aaaacatcaa tccaacgcag 50
<210> 25
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 25
tcagcggtgg cagcagccta ggttaattaa ccgcgccacg ctttatagcg 50
<210> 26
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 26
cagaccttag gtcacattct gtaatgctta agtcgaacag aaagtaatcg 50
<210> 27
<211> 51
<212> DNA
<213> Artificial Sequence
<400> 27
caccgactaa tgcatacttt gtcatggtat atctccttat taaagttaaa c 51
<210> 28
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 28
gctataaagc gtggcgcggt taattaacct aggctgctgc caccgctgag 50
<210> 29
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 29
ctgcgttgga ttgatgtttt tcatatgtat atctccttct tatacttaac 50
<210> 30
<211> 90
<212> DNA
<213> Artificial Sequence
<400> 30
cattccaaag ttcagaggta gtcatgatta agaaaatcgg tgtgttgaca agcggcggtg 60
atgcgtacgg ccccaaggtc caaacggtga 90
<210> 31
<211> 120
<212> DNA
<213> Artificial Sequence
<400> 31
gcctttttcc gaaatcatta atacagtttt ttcgcgcagt ccagccagtc acctttgaac 60
ggacgcgcat caccgccgct tgtcaacaca ccgatttggc ttcagggatg aggcgccatc 120
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 32
catttggcct gacctgaatc 20
<210> 33
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 33
cgaacgcctt atccggccta c 21
<210> 34
<211> 90
<212> DNA
<213> Artificial Sequence
<400> 34
agactgtcat gaaaaagacc aaaattgttt gcaccatcgg accgaaaacc gaatctgaag 60
agatgtacgg ccccaaggtc caaacggtga 90
<210> 35
<211> 120
<212> DNA
<213> Artificial Sequence
<400> 35
caaaagcaat attacaggac gtgaacagat gcggtgttag tagtgccgct cggtaccagt 60
gcacccatct cttcagattc ggttttcggt ccgatttggc ttcagggatg aggcgccatc 120
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 36
aacttcggca ccagacgttg 20
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 37
tctgaacgtc agaagacagc 20
<210> 38
<211> 90
<212> DNA
<213> Artificial Sequence
<400> 38
aaacgttgca gacaaaggac aaagcaatgg caatccacaa tcgtgcaggc caacctgcac 60
aacagtacgg ccccaaggtc caaacggtga 90
<210> 39
<211> 119
<212> DNA
<213> Artificial Sequence
<400> 39
gtgtttacgc gtttttcaga acttcgctaa caatctcaac cgcttctttc tcaatctgct 60
tgcgctgttg tgcaggttgg cctgcacgat tgtgttggct tcagggatga ggcgccatc 119
<210> 40
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 40
cggtcaaaac gattaaagac aag 23
<210> 41
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 41
ccagtcgcca gctaatgatg 20
<210> 42
<211> 90
<212> DNA
<213> Artificial Sequence
<400> 42
gttaacttaa ggagaatgac atggcggtaa cgcaaacagc ccaggcctgt gacctggtca 60
ttttctacgg ccccaaggtc caaacggtga 90
<210> 43
<211> 120
<212> DNA
<213> Artificial Sequence
<400> 43
aagcgcagat attactcaaa ctcattccag gaacgaccat cacgggtaat catcgccacc 60
gaggcgaaaa tgaccaggtc acaggcctgg gctgtttggc ttcagggatg aggcgccatc 120
<210> 44
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 44
gatttgctca aatgttccag c 21
<210> 45
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 45
gcaacatgct tttcaaagag 20
<210> 46
<211> 54
<212> DNA
<213> Artificial Sequence
<400> 46
gttaagtata agaaggagat atacatatga acaccgaaca tccgctgaaa aatg 54
<210> 47
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 47
cggtggcagc agcctaggtt aattactcga gaatcagttt gaattcaccg 50
<210> 48
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 48
gtttaacttt aagaaggaga tataccatgt tcaagccgaa agcgatcgcg 50
<210> 49
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 49
gattactttc tgttcgactt aagcattaac gcagcaggcc cagaaactgc ag 52
<210> 50
<211> 54
<212> DNA
<213> Artificial Sequence
<400> 50
catttttcag cggatgttcg gtgttcatat gtatatctcc ttcttatact taac 54
<210> 51
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 51
cggtgaattc aaactgattc tcgagtaatt aacctaggct gctgccaccg 50
<210> 52
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 52
ctgcagtttc tgggcctgct gcgttaatgc ttaagtcgaa cagaaagtaa tc 52
<210> 53
<211> 50
<212> DNA
<213> Artificial Sequence
<400> 53
cgcgatcgct ttcggcttga acatggtata tctccttctt aaagttaaac 50
<210> 54
<211> 219
<212> PRT
<213> Archaeoglobus profundus
<400> 54
Met Phe Lys Ala Leu Val Val Asp Ile Asp Gly Thr Leu Thr Asp Lys
1 5 10 15
Lys Arg Ala Ile Asn Cys Arg Ala Val Glu Ala Leu Arg Lys Leu Lys
20 25 30
Ile Pro Val Val Leu Ala Thr Gly Asn Ile Ser Cys Phe Ala Arg Ala
35 40 45
Val Ala Lys Ile Ile Gly Val Ser Asp Ile Val Ile Ala Glu Asn Gly
50 55 60
Gly Val Val Arg Phe Ser Tyr Asp Gly Glu Asp Ile Val Leu Gly Asp
65 70 75 80
Arg Ser Lys Cys Leu Arg Ala Leu Glu Thr Leu Arg Lys Arg Phe Lys
85 90 95
Val Glu Leu Leu Asp Asn Glu Tyr Arg Lys Ser Glu Val Cys Met Arg
100 105 110
Arg Asn Phe Pro Ile Glu Glu Ala Arg Lys Ile Leu Pro Lys Asp Val
115 120 125
Arg Ile Val Asp Thr Gly Phe Ala Tyr His Ile Ile Asp Ala Asn Val
130 135 140
Ser Lys Gly Lys Ala Leu Met Phe Ile Ala Asp Lys Leu Gly Leu Asp
145 150 155 160
Val Lys Asp Phe Ile Ala Ile Gly Asp Ser Glu Asn Asp Ile Glu Met
165 170 175
Leu Glu Val Ala Gly Phe Gly Val Ala Val Ala Asn Ala Asp Glu Lys
180 185 190
Leu Lys Glu Val Ala Asp Leu Val Thr Ser Lys Pro Asn Gly Asp Gly
195 200 205
Val Val Glu Ala Leu Glu Phe Leu Gly Leu Ile
210 215
<210> 55
<211> 657
<212> DNA
<213> Archaeoglobus profundus
<400> 55
gtgttcaagg ctttggtagt tgatatagac ggaactttga cggataagaa gagggcaata 60
aactgcagag cggtcgaagc acttagaaaa ctaaagattc ctgttgtctt ggcaaccgga 120
aacatttcat gctttgcaag ggctgtagct aagattatag gtgtttccga tattgtaata 180
gctgagaacg gaggtgttgt cagattcagc tacgacggag aggacatagt tctgggggat 240
agaagtaaat gcttaagagc tttggagaca cttagaaaac gcttcaaagt agagcttctc 300
gacaacgaat ataggaagtc tgaggtctgc atgaggagga acttccctat agaggaagct 360
agaaagatac tgccaaaaga tgttagaata gtcgatacag gcttcgcata ccacataatc 420
gatgcaaatg tcagcaaggg gaaggctttg atgttcatag ccgataagct tggcttggac 480
gttaaggatt tcattgcgat aggtgattcc gaaaacgaca ttgaaatgtt ggaagttgca 540
ggttttggcg ttgcagttgc gaatgcggat gaaaagctta aggaggtagc ggatttggtc 600
acatcgaagc ctaatggaga cggagttgtc gaagctcttg agttcttggg actcatt 657

Claims (13)

1. A recombinant microorganism for tagatose production, wherein the recombinant microorganism has the following properties (a) to (c) as compared with a wild-type microorganism:
(a) a reduced or abolished protein activity of a glucose-specific transfer protein of the phosphotransferase system and/or the expression level of a gene encoding the same;
(b) enhanced enzymatic activity of tagatose-6-phosphate epimerase and/or expression level of a gene encoding the same;
(c) enhanced enzymatic activity of tagatose-6-phosphate phosphatase and/or expression level of a gene encoding the same;
the recombinant microorganism is derived from escherichia coli, corynebacterium glutamicum, bacillus subtilis, lactic acid bacteria or saccharomyces cerevisiae.
2. The recombinant microorganism of claim 1, wherein said glucose-specific transfer protein is selected from the group consisting of SEQ ID NOs: 1 or SEQ ID NO: 3.
3. The recombinant microorganism of claim 1, wherein said tagatose-6-phosphate epimerase is a polypeptide as set forth in SEQ ID NO: 5.
4. The recombinant microorganism of claim 1, wherein said tagatose-6-phosphate phosphatase is selected from the group consisting of SEQ ID NO: 7 or SEQ ID NO: 54, or a polypeptide having the amino acid sequence shown in seq id no.
5. The recombinant microorganism of claim 1, wherein said recombinant microorganism further has properties comprising at least one of the following (d) - (j) as compared to a wild-type microorganism:
(d) enhanced glucokinase enzymatic activity and/or expression level of a gene encoding the same;
(e) enhanced enzymatic activity of glucose-6-phosphate isomerase and/or expression level of a gene encoding the same;
(f) reduced or abolished enzymatic activity of fructose-6-phosphate kinase and/or expression level of a gene encoding it;
(g) a reduced or abolished pyruvate kinase enzymatic activity and/or expression level of a gene encoding the same;
(h) a reduced or abolished enzymatic activity of phosphoglucomutase and/or the expression level of a gene encoding it;
(i) a reduced or abolished enzymatic activity of glucose-6-phosphate dehydrogenase and/or expression level of a gene encoding the same;
(j) reduced or abolished enzymatic activity of HPr kinase and/or expression level of its encoding gene.
6. The recombinant microorganism of claim 5, wherein said glucokinase is selected from the group consisting of the polypeptides shown below: comprises the amino acid sequence shown as SEQ ID NO: 9 or SEQ ID NO: 11 and having glucokinase activity.
7. The recombinant microorganism of claim 5, wherein said glucose-6-phosphate isomerase is selected from the group consisting of the polypeptides shown below: comprises the amino acid sequence shown as SEQ ID NO: 13 or SEQ ID NO: 15 and having glucose-6-phosphate isomerase activity.
8. The recombinant microorganism of any one of claims 1-7, wherein said recombinant microorganism uses glucose or glucose and glycerol as substrates.
9. A method for producing a recombinant microorganism according to any one of claims 1 to 7, comprising the steps of:
a step of gene knockout or knockdown of a gene encoding a glucose-specific transfer protein of a phosphotransferase system in a wild-type microorganism;
a step of introducing a recombinant expression vector expressing tagatose-6-phosphate epimerase and tagatose-6-phosphate phosphatase into the recombinant microorganism, or a step of introducing a recombinant expression vector expressing the tagatose-6-phosphate epimerase and the tagatose-6-phosphate phosphatase, respectively, into the recombinant microorganism.
10. The method of claim 9, further comprising at least one of the following steps:
a step of enhancing the expression level of a gene encoding glucokinase in the recombinant microorganism;
a step of enhancing the expression level of a gene encoding glucose-6-phosphate isomerase in the recombinant microorganism;
knocking out or knocking down a gene encoding fructose-6-phosphate kinase in the recombinant microorganism;
knocking out or knocking down a gene encoding pyruvate kinase in the recombinant microorganism;
knocking out or knocking down a gene encoding phosphoglucomutase in the recombinant microorganism;
a step of knocking out or knocking down a gene encoding glucose-6-phosphate dehydrogenase in the recombinant microorganism;
knocking out or knocking down a gene encoding HPr kinase in the recombinant microorganism.
11. Use of the recombinant microorganism of any one of claims 1-7 for the production of tagatose.
12. A method of producing tagatose, comprising: a step of carrying out a fermentation reaction using the recombinant microorganism according to any one of claims 1 to 7, using glucose or glucose and glycerol as substrates.
13. The method for producing tagatose according to claim 12, further comprising: and separating tagatose from the fermentation reaction liquid after the fermentation reaction is finished.
CN202011224203.0A 2020-11-05 2020-11-05 Recombinant microorganism, preparation method thereof and application thereof in producing tagatose Active CN112342178B (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN202011224203.0A CN112342178B (en) 2020-11-05 2020-11-05 Recombinant microorganism, preparation method thereof and application thereof in producing tagatose
US18/252,001 US20240026402A1 (en) 2020-11-05 2021-10-18 Recombinant microorganism, preparation method therefor, and application of recombinant microorganism in production of tagatose
JP2023528015A JP2023551790A (en) 2020-11-05 2021-10-18 Recombinant microorganisms, methods of their preparation and their use in the production of tagatose
PCT/CN2021/124427 WO2022095684A1 (en) 2020-11-05 2021-10-18 Recombinant microorganism, preparation method therefor, and application of recombinant microorganism in production of tagatose
EP21888381.7A EP4273224A1 (en) 2020-11-05 2021-10-18 Recombinant microorganism, preparation method therefor, and application of recombinant microorganism in production of tagatose
KR1020237018501A KR20230095120A (en) 2020-11-05 2021-10-18 Recombinant microorganisms, their production methods and applications in tagatose production

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011224203.0A CN112342178B (en) 2020-11-05 2020-11-05 Recombinant microorganism, preparation method thereof and application thereof in producing tagatose

Publications (2)

Publication Number Publication Date
CN112342178A CN112342178A (en) 2021-02-09
CN112342178B true CN112342178B (en) 2022-02-25

Family

ID=74428334

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011224203.0A Active CN112342178B (en) 2020-11-05 2020-11-05 Recombinant microorganism, preparation method thereof and application thereof in producing tagatose

Country Status (6)

Country Link
US (1) US20240026402A1 (en)
EP (1) EP4273224A1 (en)
JP (1) JP2023551790A (en)
KR (1) KR20230095120A (en)
CN (1) CN112342178B (en)
WO (1) WO2022095684A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112342178B (en) * 2020-11-05 2022-02-25 中国科学院天津工业生物技术研究所 Recombinant microorganism, preparation method thereof and application thereof in producing tagatose
CN113774076B (en) * 2021-08-25 2023-04-18 南通大学 Method for assisting microbial gene operation by using glucose

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005047510A1 (en) * 2003-11-15 2005-05-26 Chebigen Inc. A noble geobacillus thermodenitrificans cbg-a1 strain expressing thermostable l-arabinose isomerase activity, the said enzyme and tagatose-production method
KR100744479B1 (en) * 2005-06-01 2007-08-01 씨제이 주식회사 D-Psicose production method by D-psicose epimerase
US9914919B2 (en) 2013-07-29 2018-03-13 Samyang Corporation Aldolase, aldolase mutant, and method and composition for producing tagatose by using same
KR101868194B1 (en) * 2013-11-19 2018-06-18 씨제이제일제당 (주) Composition for non-phosphate sugar epimerization comprising sugar epimerase derived from thermophilic bacteria
BR112018077358B1 (en) * 2016-06-30 2023-03-28 Cj Cheiljedang Corporation COMPOSITION AND METHODS TO PRODUCE TAGATOSE
KR101955103B1 (en) 2016-07-29 2019-03-06 씨제이제일제당 (주) Hexuronate c4-epimerase variants with improved conversion activity to d-tagatose and method for production of d-tagatose using them
CN106399427B (en) 2016-11-01 2018-11-13 中国科学院天津工业生物技术研究所 The preparation method of Tagatose
WO2018182355A1 (en) * 2017-03-31 2018-10-04 씨제이제일제당(주) Composition for producing tagatose and production method of tagatose using same
CN109666620B (en) * 2018-05-29 2022-05-10 中国科学院天津工业生物技术研究所 Engineering strain for producing tagatose, construction method and application thereof
KR102328650B1 (en) * 2018-09-27 2021-11-19 씨제이제일제당 주식회사 A Novel Fructose C4 epimerases and Preparation Method for producing Tagatose using the same
CN112342178B (en) * 2020-11-05 2022-02-25 中国科学院天津工业生物技术研究所 Recombinant microorganism, preparation method thereof and application thereof in producing tagatose

Also Published As

Publication number Publication date
JP2023551790A (en) 2023-12-13
WO2022095684A1 (en) 2022-05-12
CN112342178A (en) 2021-02-09
US20240026402A1 (en) 2024-01-25
EP4273224A1 (en) 2023-11-08
KR20230095120A (en) 2023-06-28

Similar Documents

Publication Publication Date Title
CN109750011B (en) Mannose-6-phosphate phosphatase and biological preparation method of mannose
CN112795551B (en) High Wen Ni-resistant transcriptase mutant and application thereof
CN111484987B (en) Heat-resistant DNA polymerase mutant with high amplification activity
KR20080047844A (en) Arabinose isomerase expressed from corynebacterium genus and tagatose manufacturing method by using it
RU2757229C2 (en) New psicose-6-phosphate phosphatase, composition for production of psicose containing the specified enzyme, method for production of psicose using the specified enzyme
CN112342178B (en) Recombinant microorganism, preparation method thereof and application thereof in producing tagatose
CN112795546B (en) High-temperature-resistant reverse transcriptase mutant with high reverse transcription efficiency and application thereof
TW201842188A (en) A composition for producing tagatose and methods for producing tagatose using the same
CN113122490B (en) Double-gene defective engineering bacterium and application thereof in improving yield of N-acetylglucosamine
CN108103039B (en) Fucosyltransferase mutants and screening method and application thereof
CN114507658B (en) Enzyme coexpression system and application thereof in synthesizing sialic acid
CN105713883B (en) L-proline-4-hydroxylase and application thereof
KR102007890B1 (en) Screening methods for sugar isomerizing enzymes using engineered recombinant strains with modified sugar metabolic pathways
KR102328650B1 (en) A Novel Fructose C4 epimerases and Preparation Method for producing Tagatose using the same
RU2730602C2 (en) Novel polyphosphate-dependent glucokinase and a method of producing glucose-6-phosphate using it
CN104745563A (en) Glucose isomerase and gene, mutant, engineering bacteria and application thereof
CN114736884A (en) Cytidine monophosphate kinase mutant and gene and application thereof
CN114480334B (en) Reverse transcriptase mutants for detection of novel coronaviruses
CN114480329B (en) High efficiency MMLV enzyme mutants
CN112795549B (en) Reverse transcriptase mutant
CN114196696A (en) Recombinase fused with specific short peptide tag and capable of efficiently catalyzing Reb M generation
US8691535B2 (en) Sucrose mutase with improved product specificity
KR102232837B1 (en) Novel polypeptides having glucosylglycerol productivity and a method for producing glucosylglycerol using the same
CN111057697A (en) High-temperature-resistant TIM barrel protein mutant and application thereof
CN110452899B (en) Glucose isomerase, mutant and application of mutant in preparation of D-fructose

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Ma Yanhe

Inventor after: Shi Ting

Inventor after: Song Yunhong

Inventor after: Zhang Ting

Inventor after: Li Yunjie

Inventor before: Ma Yanhe

Inventor before: Shi Ting

Inventor before: Song Yunhong

Inventor before: Li Yunjie

GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20230811

Address after: Building 1-201-A218, Building 8, Huiying Industrial Park, No. 86 Zhonghuan West Road, Tianjin Binhai New Area Pilot Free Trade Zone (Airport Economic Zone), 300000

Patentee after: Tiangong Biotechnology (Tianjin) Co.,Ltd.

Address before: No.32, Xiqi Road, Airport Economic Zone, Binhai New Area, Tianjin 300308

Patentee before: TIANJIN INSTITUTE OF INDUSTRIAL BIOTECHNOLOGY, CHINESE ACADEMY OF SCIENCES

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20230908

Address after: Building 1-201-4, Building 8, Huiying Industrial Park, No. 86 Zhonghuan West Road, Tianjin Binhai New Area Pilot Free Trade Zone (Airport Economic Zone), 300000

Patentee after: Tianjin Yihe Biotechnology Co.,Ltd.

Address before: Building 1-201-A218, Building 8, Huiying Industrial Park, No. 86 Zhonghuan West Road, Tianjin Binhai New Area Pilot Free Trade Zone (Airport Economic Zone), 300000

Patentee before: Tiangong Biotechnology (Tianjin) Co.,Ltd.