CN114214429A - Development method of microsatellite markers of icerya purchasi - Google Patents
Development method of microsatellite markers of icerya purchasi Download PDFInfo
- Publication number
- CN114214429A CN114214429A CN202111555993.5A CN202111555993A CN114214429A CN 114214429 A CN114214429 A CN 114214429A CN 202111555993 A CN202111555993 A CN 202111555993A CN 114214429 A CN114214429 A CN 114214429A
- Authority
- CN
- China
- Prior art keywords
- microsatellite
- icerya purchasi
- mul
- centrifuging
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108091092878 Microsatellite Proteins 0.000 title claims abstract description 38
- 238000000034 method Methods 0.000 title claims abstract description 36
- 241001058150 Icerya purchasi Species 0.000 title claims abstract description 23
- 238000011161 development Methods 0.000 title claims abstract description 14
- 241001465977 Coccoidea Species 0.000 claims abstract description 16
- 239000003550 marker Substances 0.000 claims abstract description 15
- 238000012163 sequencing technique Methods 0.000 claims abstract description 12
- 108091028043 Nucleic acid sequence Proteins 0.000 claims abstract description 11
- 108020004414 DNA Proteins 0.000 claims abstract description 10
- 238000012216 screening Methods 0.000 claims abstract description 9
- 235000008708 Morus alba Nutrition 0.000 claims abstract description 8
- 240000000249 Morus alba Species 0.000 claims abstract description 8
- 238000000137 annealing Methods 0.000 claims abstract description 8
- 238000012408 PCR amplification Methods 0.000 claims abstract description 7
- 238000004458 analytical method Methods 0.000 claims abstract description 7
- 238000010804 cDNA synthesis Methods 0.000 claims abstract description 7
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 claims abstract description 7
- 238000013461 design Methods 0.000 claims abstract description 4
- 239000012634 fragment Substances 0.000 claims abstract description 4
- 230000002194 synthesizing effect Effects 0.000 claims abstract description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 48
- 238000002156 mixing Methods 0.000 claims description 27
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 claims description 18
- 235000019441 ethanol Nutrition 0.000 claims description 15
- 239000007788 liquid Substances 0.000 claims description 15
- 239000000203 mixture Substances 0.000 claims description 13
- 239000000243 solution Substances 0.000 claims description 13
- 239000000843 powder Substances 0.000 claims description 12
- 239000002244 precipitate Substances 0.000 claims description 12
- 241000238631 Hexapoda Species 0.000 claims description 9
- 239000000499 gel Substances 0.000 claims description 9
- 238000003384 imaging method Methods 0.000 claims description 9
- 239000004570 mortar (masonry) Substances 0.000 claims description 9
- 229910052757 nitrogen Inorganic materials 0.000 claims description 9
- 239000006228 supernatant Substances 0.000 claims description 9
- 238000003260 vortexing Methods 0.000 claims description 9
- 230000002068 genetic effect Effects 0.000 claims description 8
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 claims description 6
- 238000000227 grinding Methods 0.000 claims description 6
- 238000010438 heat treatment Methods 0.000 claims description 6
- 239000012528 membrane Substances 0.000 claims description 6
- 239000013589 supplement Substances 0.000 claims description 6
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 6
- 238000007400 DNA extraction Methods 0.000 claims description 4
- 241000196324 Embryophyta Species 0.000 claims description 4
- 108010067770 Endopeptidase K Proteins 0.000 claims description 3
- 102100034343 Integrase Human genes 0.000 claims description 3
- 238000002123 RNA extraction Methods 0.000 claims description 3
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 claims description 3
- 239000011543 agarose gel Substances 0.000 claims description 3
- 238000001816 cooling Methods 0.000 claims description 3
- 238000005336 cracking Methods 0.000 claims description 3
- 238000012864 cross contamination Methods 0.000 claims description 3
- 238000001514 detection method Methods 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 3
- 238000001962 electrophoresis Methods 0.000 claims description 3
- 238000010828 elution Methods 0.000 claims description 3
- 238000000605 extraction Methods 0.000 claims description 3
- 238000011534 incubation Methods 0.000 claims description 3
- 239000011259 mixed solution Substances 0.000 claims description 3
- 108020004707 nucleic acids Proteins 0.000 claims description 3
- 150000007523 nucleic acids Chemical class 0.000 claims description 3
- 102000039446 nucleic acids Human genes 0.000 claims description 3
- 238000010839 reverse transcription Methods 0.000 claims description 3
- 239000003161 ribonuclease inhibitor Substances 0.000 claims description 3
- 238000005406 washing Methods 0.000 claims description 3
- 241001266001 Cordyceps confragosa Species 0.000 claims 1
- 239000003147 molecular marker Substances 0.000 abstract description 4
- 230000000694 effects Effects 0.000 abstract description 2
- 238000001426 native polyacrylamide gel electrophoresis Methods 0.000 abstract 1
- 238000011160 research Methods 0.000 description 5
- 241000607479 Yersinia pestis Species 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 241000255777 Lepidoptera Species 0.000 description 2
- 235000013399 edible fruits Nutrition 0.000 description 2
- 238000007430 reference method Methods 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 241001414830 Diaspididae Species 0.000 description 1
- 241000258937 Hemiptera Species 0.000 description 1
- 108091081062 Repeated sequence (DNA) Proteins 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 239000002420 orchard Substances 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 238000011269 treatment regimen Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a development method of a microsatellite marker of a white mulberry scale, which comprises the steps of collecting 50 heads of female adult worms; extracting total RNA; performing cDNA synthesis; performing transcriptome sequencing, combining and splicing sequences to obtain a DNA sequence result, and assembling and splicing to obtain unigenes; finding out a microsatellite sequence, designing primers on two sides of a core sequence and synthesizing; optimizing the annealing temperature of the primers, screening the annealing temperature, and amplifying the size of a target fragment during primer design; performing PCR amplification on DNA extracted from single-head white mealybugs, performing non-denaturing polyacrylamide gel electrophoresis, and performing strip analysis; 80 head worm DNA was amplified by PCR and subjected to native polyacrylamide gel electrophoresis. The technical effect of the invention is that the icerya purchasi transcriptome sequencing technology is used to develop the microsatellite of icerya purchasi lacking in genomic data biological information, and the microsatellite locus of icerya purchasi is deeply excavated to verify the polymorphism of the microsatellite molecular marker.
Description
Technical Field
The invention relates to the technical field of biological microsatellite markers, in particular to a development method of a microsatellite marker of a white coccicoides kuwana.
Background
SSR (simple sequence repeat, SSR) molecular markers, also known as simple repeat sequences or microsatellite sequences, usually contain 1-6bp bases, are DNA sequences consisting of repeated motifs, and have been widely used in the research of biological genetics because of the characteristics of good polymorphism and co-dominance, and the number of the SSR molecular markers in genes is also rich. The traditional SSR marker development method mainly comprises a microsatellite enrichment method, a PCR separation method, a homologous sequence reference method, a genome library sequencing method, an omitted library screening method and a database search method. The microsatellite enrichment method needs to construct and screen a genome library, the operation process is complicated, the time consumption is long, the success rate is low, and the cost is high; the PCR separation method has complex operation process, a great deal of energy and time are required to be invested in the experimental process, and pollution is easy to generate in the experiment; the homologous sequence reference method is time-consuming and labor-consuming, has low universality and has certain limitation on application; the genome library sequencing method has the advantages of low coverage rate of sites in the genome, high requirement on equipment and high cost; the operation process of a screening library method is omitted, and the developed primer has low specificity; the database search method is only limited to be applied to species with published sequences, and has limitations.
The white mealybugs, pseudobalanopsis pendagona (Targioni-Tozzetti), also known as pseudoverticillium multocida, Lepidoptera, belonging to Hemiptera, Coccoides of the Lepidoptera, Diaspididae of the Bepidaceae, Pseudobulbus pellucida, are common pseudohost pests in orchards and are widely distributed in tropical, subtropical and temperate regions. The pest is typical omnivorous pest, can eat more than 85 families of 221 plants, and the white mulberry scale is one of the most omnivorous pelecyporus pelecypus and has great harmfulness. Because the white mulberry scale has wide hosts, along with the continuous development of economy, the regulation and transportation of fruit tree seedlings are more and more frequent, the white mulberry scale rapidly spreads through seedlings and fruits mutually introduced between provinces in China and countries in the world, and the damage range is more and more enlarged.
In the current research, the microsatellite marker of the mealybug is not reported at present, the research of the mealybug microsatellite is still in a blank state, the formulation of the prevention and treatment strategy of the mealybug is seriously hindered due to the loss of the molecular marker, and the data support can not be provided for the population genetic structure and the population genetic diversity of the mealybug.
Disclosure of Invention
The invention aims to provide a development method of a microsatellite marker of a mealybug, so as to solve the problems in the background technology.
In order to realize the purpose, the invention provides the following technical scheme: a development method of a microsatellite marker of a mealybugs concretely comprises the following steps:
the method comprises the following steps: collecting 50 heads of the female imagoes fixed on the surfaces of the branches and the stems of the plants, preserving the heads of the female imagoes by using liquid nitrogen, and storing the heads of the female imagoes in a refrigerator at the temperature of minus 80 ℃ for later use;
step two: extracting total RNA;
step three: cDNA synthesis is carried out by utilizing a TakaraM-MLV reverse transcription kit;
step four: sending the qualified sample to a sequencing company for transcriptome sequencing, combining and splicing sequences to obtain a DNA sequence result, and then assembling and splicing the DNA sequence into unigenes by using Trinity software;
step five: finding out a MicroSAtellite sequence by using SSR software MicroSAtellite, designing primers on two sides of a core sequence by using Primer3 software, and synthesizing;
step six: optimizing the annealing temperature of the primers by utilizing temperature gradient PCR, and screening the annealing temperature according to the temperature +/-5 ℃ of the synthesized primers of the primers to amplify the size of a target fragment during primer design;
step seven: performing PCR amplification on DNA extracted from a single-head icerya purchasi in each of 8 different sites, performing non-denaturing polyacrylamide gel electrophoresis, and performing band analysis by using a gel imaging analyzer, wherein multiple bands are polymorphic microsatellite primers;
step eight: and carrying out PCR amplification on the DNA of the 80 head insects by using the polymorphism primer obtained by screening, carrying out non-denaturing polyacrylamide gel electrophoresis, counting the stripe result of a gel imaging system, carrying out stripe analysis, evaluating polymorphism, analyzing the genetic structure of the mealybugs, and evaluating the genetic diversity of different populations of the mealybugs.
Preferably, the total RNA extraction step in step two is:
adding 1ml of Buffer Rlysine-A into a centrifugal tube of 1.5ml of RNase-free for later use;
secondly, grinding 50mg of the tissue of the white mulberry scale into powder by using liquid nitrogen, adding the powder into the 1.5ml of centrifuge tube, immediately shaking and uniformly mixing the powder, and standing the mixture at room temperature for 3 min;
③ adding 200 mul of chloroform into the cracking sample, fully and uniformly mixing, centrifuging at 12000rpm and 4 ℃ for 5min, and taking the supernatant;
adding 1/3 volume of absolute ethyl alcohol, mixing uniformly, standing at room temperature for 3min, centrifuging at 12000rpm at 4 ℃ for 5min, and pouring off the supernatant;
washing the precipitate with 700 μ l of 75% ethanol, centrifuging at 12000rpm and 4 deg.C for 3min, and removing the supernatant;
sixthly, repeating the above steps once, inverting for 10min at room temperature to completely volatilize the residual ethanol in the centrifuge tube, adding 50 μ l of DEPC-treated ddH2O to dissolve the precipitate, and immediately using or storing at-70 ℃ for a long time;
seventhly, after electrophoresis detection is carried out on the extracted total RNA by using 1% agarose gel, photographing and storing are carried out by using a Bio-RAD gel imaging system, and the purity and the concentration of the total RNA are detected by using a trace nucleic acid detector.
Preferably, the cDNA synthesis step in step three is:
taking an RNA solution with a measured concentration, taking a solution containing 1 mu g of RNA, adding 1 mu l of random primer with a concentration of 25 mu M, and adding RNase-Free water to supplement the volume to 6 mu;
② after mixing evenly, heating the mixed solution at 70 ℃ for 10 min;
taking out the sample, placing the sample on ice for 2min, and cooling;
fourthly, sequentially adding 2 mul of 5 XM-MLV buffer, 0.5 mul of dNTP with the concentration of 10mM, 0.25 mul of RNase inhibitor with the concentration of 40U/mul and 200U of M-MLV reverse transcriptase, adding water to supplement the mixture to 10 mul, and uniformly mixing the mixture;
fifthly, heating the uniformly mixed liquid at 30 ℃ for 10min, at 42 ℃ for 1h and at 70 ℃ for 15 min.
Preferably, the DNA sequence results in step four are shown below:
>Cluster-2294.20855
ATTCCGTCTGTTCTTCATGTGAATTCCTAATCTCGTTTAATTCGTTGCAACCATCTTATAATTAATTGAGCAAAAAGTTG
CACCAGTAGGAAGTATTTTGCTCGCGAAGCTCTCAGATTTTCGTGTATACTCGATGTCATTGTGAACGAGTTTGAGTGCA
TCGAAAATTACATCGTCTTCGGCGTTCCAAACGATAGGCTTGTGTTCCAAGTTTCTAGATTACGATGCAAGCCATAAAAT
GTGTGGTGGTCGGTGATGGTGCCGTTGGTAAAACTTGCCTGCTGATCAGTTACACGACAAATGCATTTCCTGGAGAGTAC
ATACCGACTGTATTCGACAACTACTCGGCCAACGTGATGGTCGATGGCAAACCAATCAACCTAGGATTATGGGATACAGC
TGGACAAGAAGATTACGATAGGTTACGTCCCCTTTCCTATCCCCAAACGGATGTGTTCTTAATTTGTTTCTCACTGGTCA
ACCCGGCCTCTTTTGAAAATGTGCGAGCTAAGTGGTATCCAGAAGTACGACATCACTGCCCGAACACTCCCATCCTGTTG
GTGGGCACGAAATTGGACTTGAGAGAGGATAAAGAGACCAACGACAAACTGAAGGAGAAGAAATTAGCCCCGATCACGTA
TCCGCAGGGCTTATCGATGGCCAAGGAAATTAACGCCGTCAAATATTTAGAATGCAGCGCTCTAACGCAAAAAGGATTAA
AAACGGTGTTCGACGAGGCGATCCGCGCAGTTTTGTGCCCAATACTGCCCGCTAAAGGAAGAAAACGTCGGTGTCATATA
CTTTGAAAGTAAACTTTTCATTTTCGCTAACTATAATCGGTACCTACACGATATCTATCTAATGTCCAATGTATTAATTC
GATTGATTTACTCCACCAATGTTCTCGCGACCAAATACCTATCATTATTTTTTATGGCGATAACGTACGAAGTAATATAT
TATTTAAAATAATGTACTCGCGATTGCCTTTTCACGAAAGATTCGTCTTACGTTCTGCTCTTTAAAATATCCCAAGATTT
CAACCGTTATTACATAATTTCTAATGACGTATTATACGTTTTATTAATATTATTATTATTGAAAATTTCAAGCTCTTTAA
ACTAGAAAAAAGGGTGATCAGTTTTCGATGCGTGCGTACGTTCATTCACTCATTCCGTTTTAATGTAATTATGATGTATT
CGTCGTCAGTGAGATACTAGATAGTCTTTTAGAGGCTCGAATCAACTAATTAATTAATATTTATTACTTGTACAGTATAC
AGAGGTCTTTCATACGGCTGTAAGGCTTCAAATTATTTCTTTTGTTTTTATTTAGGCGCCCGCGAAGATTGACAATAATT
GGACGCGCTATAGCGAAAGAGCGATAGAGAGAGAGTGCTCAGTTTTGCTTGCGAAAATGAGAAACGTTTGATCGTGGTGA
AGAAAGCTCGAATGTGTACTTGTGTAGATACTGTGTAGAACATTTTAAACGCTACTAAGCTCTCGTGTGGATGTTGCGTA
GAACTAAATTTTGGCATTCTTATCGCAATCGTAGCTTTTGCTTTTGTTAGTCAAGATTACGATTGTATAGACCTAGAATA
TTACATAATATTATACGCGAACTTGAGAATTTTTTCTACCGTGTAGAAATGAATACCTAATAATAATATTGGCTTTACAC
ATACCTACATATTATACATAATTATGTAGCTCATTTAAATATTATGGTATAAGTATAATATGATTAGGTATACTGTCTTA
CATCAGTCTGTATTATTTGTTTTATATTTTTTTATTTTATATTTTCTATACTTACTGTGATGTATTTTAAATATTTAATA
TTCGAGATGTCGTAGAGAAGTACGCGAAAGACTGATGGTCAGCGAAAAGGTATATGTAGTGTACACAAAATTCACGAACC
ACACGCGTCGCTTTTCGTGTAATTTTTAAAAAGCATTTTCGTTCATTACAATTTTATAGAACTATGTAGGTATAAAATGG
TTTTTTCCCCAATATTTTTTAAACTGAATGCGTGCGTTCAACTCTCATCTTTTTTGAGAAGTGAATATGATTTTGATTTT
CGTGATTGAATTGCTCTGGGATTGAGTGTATCTGCGTTGAATTCTGTGGACGACATCTCCACTTGGAATTTATTGCGGGC
AATGAAGAGGGGTACGAGAATATGGTACGAGAGAAAATTTCCACACTTTTCCGGAATTATATAGGTCTATATGATGGAAA
CGATTACAAGTATATTATGCTCATGCCATTAACCCCAACGTGAATACTGAGAAAACTTTTTTTTCTTTTTTCATCAGTAT
ACCTATAATGTAAGTTTTACTACTTGCACACACTCTGCTGAATGTTAGGTGTGTTGAGCGAGATATCTACTTCATTAGAT
TAAGTACAGATTGCGCTCATTTACGTTAAAATATACGTATTAC。
preferably, the DNA extraction of the single-head white mealybugs in the seventh step comprises the following steps:
grinding single-headed insects in liquid nitrogen by using a mortar and a pestle, and putting the powder into a 1.5ml microcentrifuge tube;
② adding 180 μ l Buffer ATL;
③ adding 20 mul proteinase K solution, mixing by vortex, mixing thoroughly, incubating at 56 ℃ until the insect is completely dissolved, occasionally dispersing the sample by vortex during the incubation;
vortexing for 15s, adding 200 μ l buffer AL to the sample, thoroughly mixing by vortexing, then adding 200 μ l ethanol (96-100%), thoroughly mixing again by vortexing, adding buffer AL and ethanol to form a white precipitate that does not interfere with the DNeasy extraction procedure, and vigorously shaking to digest the precipitate;
fifthly, transferring the mixture from the fourth step into a DNeasy Mini spin column in a collecting pipe of 2ml, centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm), and discarding the circulation and the collecting pipe;
sixthly, putting the DNeasy Mini spin column into a new collecting pipe of 2ml, adding 500 mu l of buffer AW1, centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm), discarding the circulation and the collecting pipe, and not allowing ethanol to remain in the liquid after elution;
seventhly, putting the DNeasy Mini spin column into a clean 1.5ml or 2ml microcentrifuge tube, directly sucking 200 mu l of buffer AE onto the DNeasy membrane, incubating for 1 minute at room temperature, and centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm) to elute;
placing the DNeasy Mini spin column in a clean 1.5ml or 2ml microcentrifuge tube, then directly sucking 200. mu.l of buffer AE onto the DNeasy membrane, incubating at room temperature for 1 minute, and then centrifuging at more than or equal to 6000xg (8000rpm) for 1 minute to elute, thereby obtaining the final DNA extraction solution.
Preferably, when a mortar and pestle are used in step (i), care should be taken that: to prevent cross-contamination, the mortar and pestle between samples were thoroughly cleaned.
Compared with the prior art, the invention has the beneficial effects that: according to the development method of the microsatellite marker of the icerya purchasi, the icerya purchasi transcriptome sequencing technology is adopted in an innovative method, the microsatellite development is carried out on the icerya purchasi lacking in genomic data biological information, the microsatellite loci of the icerya purchasi are deeply excavated, the polymorphism of the microsatellite molecular marker is verified, and then theoretical basis and data support are provided for the research of the icerya purchasi population genetics.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention provides a technical scheme that: a development method of a microsatellite marker of a mealybugs concretely comprises the following steps:
the method comprises the following steps: collecting 50 heads of the female imagoes fixed on the surfaces of the branches and the stems of the plants, preserving the heads of the female imagoes by using liquid nitrogen, and storing the heads of the female imagoes in a refrigerator at the temperature of minus 80 ℃ for later use;
step two: extracting total RNA;
step three: cDNA synthesis is carried out by utilizing a TakaraM-MLV reverse transcription kit;
step four: sending the qualified sample to a sequencing company for transcriptome sequencing, combining and splicing sequences to obtain a DNA sequence result, and then assembling and splicing the DNA sequence into unigenes by using Trinity software;
step five: finding out a MicroSAtellite sequence by using SSR software MicroSAtellite, designing primers on two sides of a core sequence by using Primer3 software, and synthesizing;
step six: optimizing the annealing temperature of the primers by utilizing temperature gradient PCR, and screening the annealing temperature according to the temperature +/-5 ℃ of the synthesized primers of the primers to amplify the size of a target fragment during primer design;
step seven: performing PCR amplification on DNA extracted from a single-head icerya purchasi in each of 8 different sites, performing non-denaturing polyacrylamide gel electrophoresis, and performing band analysis by using a gel imaging analyzer, wherein multiple bands are polymorphic microsatellite primers;
step eight: and carrying out PCR amplification on the DNA of the 80 head insects by using the polymorphism primer obtained by screening, carrying out non-denaturing polyacrylamide gel electrophoresis, counting the stripe result of a gel imaging system, carrying out stripe analysis, evaluating polymorphism, analyzing the genetic structure of the mealybugs, and evaluating the genetic diversity of different populations of the mealybugs.
In this embodiment, the total RNA extraction step in step two is:
adding 1ml of Buffer Rlysine-A into a centrifugal tube of 1.5ml of RNase-free for later use;
secondly, grinding 50mg of the tissue of the white mulberry scale into powder by using liquid nitrogen, adding the powder into the 1.5ml of centrifuge tube, immediately shaking and uniformly mixing the powder, and standing the mixture at room temperature for 3 min;
③ adding 200 mul of chloroform into the cracking sample, fully and uniformly mixing, centrifuging at 12000rpm and 4 ℃ for 5min, and taking the supernatant;
adding 1/3 volume of absolute ethyl alcohol, mixing uniformly, standing at room temperature for 3min, centrifuging at 12000rpm at 4 ℃ for 5min, and pouring off the supernatant;
washing the precipitate with 700 μ l of 75% ethanol, centrifuging at 12000rpm and 4 deg.C for 3min, and removing the supernatant;
sixthly, repeating the above steps once, inverting for 10min at room temperature to completely volatilize the residual ethanol in the centrifuge tube, adding 50 μ l of DEPC-treated ddH2O to dissolve the precipitate, and immediately using or storing at-70 ℃ for a long time;
seventhly, after electrophoresis detection is carried out on the extracted total RNA by using 1% agarose gel, photographing and storing are carried out by using a Bio-RAD gel imaging system, and the purity and the concentration of the total RNA are detected by using a trace nucleic acid detector.
In this example, the cDNA synthesis in step three was as follows:
taking an RNA solution with a measured concentration, taking a solution containing 1 mu g of RNA, adding 1 mu l of random primer with a concentration of 25 mu M, and adding RNase-Free water to supplement the volume to 6 mu;
② after mixing evenly, heating the mixed solution at 70 ℃ for 10 min;
taking out the sample, placing the sample on ice for 2min, and cooling;
fourthly, sequentially adding 2 mul of 5 XM-MLVbuffer, 0.5 mul of dNTP with the concentration of 10mM, 0.25 mul of RNase inhibitor with the concentration of 40U/mul and 200U of M-MLV reverse transcriptase, adding water to supplement the mixture to 10 mul, and uniformly mixing the mixture;
fifthly, heating the uniformly mixed liquid at 30 ℃ for 10min, at 42 ℃ for 1h and at 70 ℃ for 15 min.
In this example, the DNA sequence results in step four are shown below:
>Cluster-2294.20855
ATTCCGTCTGTTCTTCATGTGAATTCCTAATCTCGTTTAATTCGTTGCAACCATCTTATAATTAATTGAGCAAAAAGTTG
CACCAGTAGGAAGTATTTTGCTCGCGAAGCTCTCAGATTTTCGTGTATACTCGATGTCATTGTGAACGAGTTTGAGTGCA
TCGAAAATTACATCGTCTTCGGCGTTCCAAACGATAGGCTTGTGTTCCAAGTTTCTAGATTACGATGCAAGCCATAAAAT
GTGTGGTGGTCGGTGATGGTGCCGTTGGTAAAACTTGCCTGCTGATCAGTTACACGACAAATGCATTTCCTGGAGAGTAC
ATACCGACTGTATTCGACAACTACTCGGCCAACGTGATGGTCGATGGCAAACCAATCAACCTAGGATTATGGGATACAGC
TGGACAAGAAGATTACGATAGGTTACGTCCCCTTTCCTATCCCCAAACGGATGTGTTCTTAATTTGTTTCTCACTGGTCA
ACCCGGCCTCTTTTGAAAATGTGCGAGCTAAGTGGTATCCAGAAGTACGACATCACTGCCCGAACACTCCCATCCTGTTG
GTGGGCACGAAATTGGACTTGAGAGAGGATAAAGAGACCAACGACAAACTGAAGGAGAAGAAATTAGCCCCGATCACGTA
TCCGCAGGGCTTATCGATGGCCAAGGAAATTAACGCCGTCAAATATTTAGAATGCAGCGCTCTAACGCAAAAAGGATTAA
AAACGGTGTTCGACGAGGCGATCCGCGCAGTTTTGTGCCCAATACTGCCCGCTAAAGGAAGAAAACGTCGGTGTCATATA
CTTTGAAAGTAAACTTTTCATTTTCGCTAACTATAATCGGTACCTACACGATATCTATCTAATGTCCAATGTATTAATTC
GATTGATTTACTCCACCAATGTTCTCGCGACCAAATACCTATCATTATTTTTTATGGCGATAACGTACGAAGTAATATAT
TATTTAAAATAATGTACTCGCGATTGCCTTTTCACGAAAGATTCGTCTTACGTTCTGCTCTTTAAAATATCCCAAGATTT
CAACCGTTATTACATAATTTCTAATGACGTATTATACGTTTTATTAATATTATTATTATTGAAAATTTCAAGCTCTTTAA
ACTAGAAAAAAGGGTGATCAGTTTTCGATGCGTGCGTACGTTCATTCACTCATTCCGTTTTAATGTAATTATGATGTATT
CGTCGTCAGTGAGATACTAGATAGTCTTTTAGAGGCTCGAATCAACTAATTAATTAATATTTATTACTTGTACAGTATAC
AGAGGTCTTTCATACGGCTGTAAGGCTTCAAATTATTTCTTTTGTTTTTATTTAGGCGCCCGCGAAGATTGACAATAATT
GGACGCGCTATAGCGAAAGAGCGATAGAGAGAGAGTGCTCAGTTTTGCTTGCGAAAATGAGAAACGTTTGATCGTGGTGA
AGAAAGCTCGAATGTGTACTTGTGTAGATACTGTGTAGAACATTTTAAACGCTACTAAGCTCTCGTGTGGATGTTGCGTA
GAACTAAATTTTGGCATTCTTATCGCAATCGTAGCTTTTGCTTTTGTTAGTCAAGATTACGATTGTATAGACCTAGAATA
TTACATAATATTATACGCGAACTTGAGAATTTTTTCTACCGTGTAGAAATGAATACCTAATAATAATATTGGCTTTACAC
ATACCTACATATTATACATAATTATGTAGCTCATTTAAATATTATGGTATAAGTATAATATGATTAGGTATACTGTCTTA
CATCAGTCTGTATTATTTGTTTTATATTTTTTTATTTTATATTTTCTATACTTACTGTGATGTATTTTAAATATTTAATA
TTCGAGATGTCGTAGAGAAGTACGCGAAAGACTGATGGTCAGCGAAAAGGTATATGTAGTGTACACAAAATTCACGAACC
ACACGCGTCGCTTTTCGTGTAATTTTTAAAAAGCATTTTCGTTCATTACAATTTTATAGAACTATGTAGGTATAAAATGG
TTTTTTCCCCAATATTTTTTAAACTGAATGCGTGCGTTCAACTCTCATCTTTTTTGAGAAGTGAATATGATTTTGATTTT
CGTGATTGAATTGCTCTGGGATTGAGTGTATCTGCGTTGAATTCTGTGGACGACATCTCCACTTGGAATTTATTGCGGGC
AATGAAGAGGGGTACGAGAATATGGTACGAGAGAAAATTTCCACACTTTTCCGGAATTATATAGGTCTATATGATGGAAA
CGATTACAAGTATATTATGCTCATGCCATTAACCCCAACGTGAATACTGAGAAAACTTTTTTTTCTTTTTTCATCAGTAT
ACCTATAATGTAAGTTTTACTACTTGCACACACTCTGCTGAATGTTAGGTGTGTTGAGCGAGATATCTACTTCATTAGAT
TAAGTACAGATTGCGCTCATTTACGTTAAAATATACGTATTAC。
in this embodiment, the step seven of extracting DNA from a single-head white gecko includes the steps of:
grinding single-headed insects in liquid nitrogen by using a mortar and a pestle, and putting the powder into a 1.5ml microcentrifuge tube;
② adding 180 μ l Buffer ATL;
③ adding 20 mul proteinase K solution, mixing by vortex, mixing thoroughly, incubating at 56 ℃ until the insect is completely dissolved, occasionally dispersing the sample by vortex during the incubation;
vortexing for 15s, adding 200 μ l buffer AL to the sample, thoroughly mixing by vortexing, then adding 200 μ l ethanol (96-100%), thoroughly mixing again by vortexing, adding buffer AL and ethanol to form a white precipitate that does not interfere with the DNeasy extraction procedure, and vigorously shaking to digest the precipitate;
fifthly, transferring the mixture from the fourth step into a DNeasy Mini spin column in a collecting pipe of 2ml, centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm), and discarding the circulation and the collecting pipe;
sixthly, putting the DNeasy Mini spin column into a new collecting pipe of 2ml, adding 500 mu l of buffer AW1, centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm), discarding the circulation and the collecting pipe, and not allowing ethanol to remain in the liquid after elution;
seventhly, putting the DNeasy Mini spin column into a clean 1.5ml or 2ml microcentrifuge tube, directly sucking 200 mu l of buffer AE onto the DNeasy membrane, incubating for 1 minute at room temperature, and centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm) to elute;
placing the DNeasy Mini spin column in a clean 1.5ml or 2ml microcentrifuge tube, then directly sucking 200. mu.l of buffer AE onto the DNeasy membrane, incubating at room temperature for 1 minute, and then centrifuging at more than or equal to 6000xg (8000rpm) for 1 minute to elute, thereby obtaining the final DNA extraction solution.
In this example, when a mortar and pestle are used in step (i), attention should be paid to: to prevent cross-contamination, the mortar and pestle between samples were thoroughly cleaned.
The technical effects are as follows: according to the development method of the microsatellite marker of the icerya purchasi, the icerya purchasi transcriptome sequencing technology is adopted in an innovative method, the microsatellite development is carried out on the icerya purchasi lacking in genomic data biological information, the microsatellite loci of the icerya purchasi are deeply excavated, the polymorphism of the microsatellite molecular marker is verified, and then theoretical basis and data support are provided for the research of the icerya purchasi population genetics.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Claims (6)
1. A development method of a microsatellite marker of a Lecanicillium lecanii is characterized by comprising the following steps: the method specifically comprises the following steps:
the method comprises the following steps: collecting 50 heads of the female imagoes fixed on the surfaces of the branches and the stems of the plants, preserving the heads of the female imagoes by using liquid nitrogen, and storing the heads of the female imagoes in a refrigerator at the temperature of minus 80 ℃ for later use;
step two: extracting total RNA;
step three: cDNA synthesis is carried out by utilizing a TakaraM-MLV reverse transcription kit;
step four: sending the qualified sample to a sequencing company for transcriptome sequencing, combining and splicing sequences to obtain a DNA sequence result, and then assembling and splicing the DNA sequence into unigenes by using Trinity software;
step five: finding out a MicroSAtellite sequence by using SSR software MicroSAtellite, designing primers on two sides of a core sequence by using Primer3 software, and synthesizing;
step six: optimizing the annealing temperature of the primers by utilizing temperature gradient PCR, and screening the annealing temperature according to the temperature +/-5 ℃ of the synthesized primers of the primers to amplify the size of a target fragment during primer design;
step seven: performing PCR amplification on DNA extracted from a single-head icerya purchasi in each of 8 different sites, performing non-denaturing polyacrylamide gel electrophoresis, and performing band analysis by using a gel imaging analyzer, wherein multiple bands are polymorphic microsatellite primers;
step eight: and carrying out PCR amplification on the DNA of the 80 head insects by using the polymorphism primer obtained by screening, carrying out non-denaturing polyacrylamide gel electrophoresis, counting the stripe result of a gel imaging system, carrying out stripe analysis, evaluating polymorphism, analyzing the genetic structure of the mealybugs, and evaluating the genetic diversity of different populations of the mealybugs.
2. The method for developing the microsatellite marker of the icerya purchasi of claim 1, which is characterized in that: the total RNA extraction step in the second step is as follows:
adding 1ml of Bufferlysine-A into a centrifugal tube of 1.5ml of RNase-free for later use;
secondly, grinding 50mg of the tissue of the white mulberry scale into powder by using liquid nitrogen, adding the powder into the 1.5ml of centrifuge tube, immediately shaking and uniformly mixing the powder, and standing the mixture at room temperature for 3 min;
③ adding 200 mul of chloroform into the cracking sample, fully and uniformly mixing, centrifuging at 12000rpm and 4 ℃ for 5min, and taking the supernatant;
adding 1/3 volume of absolute ethyl alcohol, mixing uniformly, standing at room temperature for 3min, centrifuging at 12000rpm at 4 ℃ for 5min, and pouring off the supernatant;
washing the precipitate with 700 μ l of 75% ethanol, centrifuging at 12000rpm and 4 deg.C for 3min, and removing the supernatant;
sixthly, repeating the above steps once, inverting for 10min at room temperature to completely volatilize the residual ethanol in the centrifuge tube, adding 50 μ l of DEPC-treated ddH2O to dissolve the precipitate, and immediately using or storing at-70 ℃ for a long time;
seventhly, after electrophoresis detection is carried out on the extracted total RNA by using 1% agarose gel, photographing and storing are carried out by using a Bio-RAD gel imaging system, and the purity and the concentration of the total RNA are detected by using a trace nucleic acid detector.
3. The method for developing the microsatellite marker of the icerya purchasi of claim 1, which is characterized in that: the cDNA synthesis in the third step comprises the following steps:
taking an RNA solution with a measured concentration, taking a solution containing 1 mu g of RNA, adding 1 mu l of random primer with a concentration of 25 mu M, and adding RNase-Free water to supplement the volume to 6 mu;
② after mixing evenly, heating the mixed solution at 70 ℃ for 10 min;
taking out the sample, placing the sample on ice for 2min, and cooling;
fourthly, sequentially adding 2 mul of 5 XM-MLVbuffer, 0.5 mul of dNTP with the concentration of 10mM, 0.25 mul of RNase inhibitor with the concentration of 40U/mul and 200U of M-MLV reverse transcriptase, adding water to supplement the mixture to 10 mul, and uniformly mixing the mixture;
fifthly, heating the uniformly mixed liquid at 30 ℃ for 10min, at 42 ℃ for 1h and at 70 ℃ for 15 min.
4. The method for developing the microsatellite marker of the icerya purchasi of claim 1, which is characterized in that: the DNA sequence results in step four are shown below:
>Cluster-2294.20855
ATTCCGTCTGTTCTTCATGTGAATTCCTAATCTCGTTTAATTCGTTGCAACCATCTTATAATTAATTGAGCAAAAAGTTG
CACCAGTAGGAAGTATTTTGCTCGCGAAGCTCTCAGATTTTCGTGTATACTCGATGTCATTGTGAACGAGTTTGAGTGCA
TCGAAAATTACATCGTCTTCGGCGTTCCAAACGATAGGCTTGTGTTCCAAGTTTCTAGATTACGATGCAAGCCATAAAAT
GTGTGGTGGTCGGTGATGGTGCCGTTGGTAAAACTTGCCTGCTGATCAGTTACACGACAAATGCATTTCCTGGAGAGTAC
ATACCGACTGTATTCGACAACTACTCGGCCAACGTGATGGTCGATGGCAAACCAATCAACCTAGGATTATGGGATACAGC
TGGACAAGAAGATTACGATAGGTTACGTCCCCTTTCCTATCCCCAAACGGATGTGTTCTTAATTTGTTTCTCACTGGTCA
ACCCGGCCTCTTTTGAAAATGTGCGAGCTAAGTGGTATCCAGAAGTACGACATCACTGCCCGAACACTCCCATCCTGTTG
GTGGGCACGAAATTGGACTTGAGAGAGGATAAAGAGACCAACGACAAACTGAAGGAGAAGAAATTAGCCCCGATCACGTA
TCCGCAGGGCTTATCGATGGCCAAGGAAATTAACGCCGTCAAATATTTAGAATGCAGCGCTCTAACGCAAAAAGGATTAA
AAACGGTGTTCGACGAGGCGATCCGCGCAGTTTTGTGCCCAATACTGCCCGCTAAAGGAAGAAAACGTCGGTGTCATATA
CTTTGAAAGTAAACTTTTCATTTTCGCTAACTATAATCGGTACCTACACGATATCTATCTAATGTCCAATGTATTAATTC
GATTGATTTACTCCACCAATGTTCTCGCGACCAAATACCTATCATTATTTTTTATGGCGATAACGTACGAAGTAATATAT
TATTTAAAATAATGTACTCGCGATTGCCTTTTCACGAAAGATTCGTCTTACGTTCTGCTCTTTAAAATATCCCAAGATTT
CAACCGTTATTACATAATTTCTAATGACGTATTATACGTTTTATTAATATTATTATTATTGAAAATTTCAAGCTCTTTAA
ACTAGAAAAAAGGGTGATCAGTTTTCGATGCGTGCGTACGTTCATTCACTCATTCCGTTTTAATGTAATTATGATGTATT
CGTCGTCAGTGAGATACTAGATAGTCTTTTAGAGGCTCGAATCAACTAATTAATTAATATTTATTACTTGTACAGTATAC
AGAGGTCTTTCATACGGCTGTAAGGCTTCAAATTATTTCTTTTGTTTTTATTTAGGCGCCCGCGAAGATTGACAATAATT
GGACGCGCTATAGCGAAAGAGCGATAGAGAGAGAGTGCTCAGTTTTGCTTGCGAAAATGAGAAACGTTTGATCGTGGTGA
AGAAAGCTCGAATGTGTACTTGTGTAGATACTGTGTAGAACATTTTAAACGCTACTAAGCTCTCGTGTGGATGTTGCGTA
GAACTAAATTTTGGCATTCTTATCGCAATCGTAGCTTTTGCTTTTGTTAGTCAAGATTACGATTGTATAGACCTAGAATA
TTACATAATATTATACGCGAACTTGAGAATTTTTTCTACCGTGTAGAAATGAATACCTAATAATAATATTGGCTTTACAC
ATACCTACATATTATACATAATTATGTAGCTCATTTAAATATTATGGTATAAGTATAATATGATTAGGTATACTGTCTTA
CATCAGTCTGTATTATTTGTTTTATATTTTTTTATTTTATATTTTCTATACTTACTGTGATGTATTTTAAATATTTAATA
TTCGAGATGTCGTAGAGAAGTACGCGAAAGACTGATGGTCAGCGAAAAGGTATATGTAGTGTACACAAAATTCACGAACC
ACACGCGTCGCTTTTCGTGTAATTTTTAAAAAGCATTTTCGTTCATTACAATTTTATAGAACTATGTAGGTATAAAATGG
TTTTTTCCCCAATATTTTTTAAACTGAATGCGTGCGTTCAACTCTCATCTTTTTTGAGAAGTGAATATGATTTTGATTTT
CGTGATTGAATTGCTCTGGGATTGAGTGTATCTGCGTTGAATTCTGTGGACGACATCTCCACTTGGAATTTATTGCGGGC
AATGAAGAGGGGTACGAGAATATGGTACGAGAGAAAATTTCCACACTTTTCCGGAATTATATAGGTCTATATGATGGAAA
CGATTACAAGTATATTATGCTCATGCCATTAACCCCAACGTGAATACTGAGAAAACTTTTTTTTCTTTTTTCATCAGTAT
ACCTATAATGTAAGTTTTACTACTTGCACACACTCTGCTGAATGTTAGGTGTGTTGAGCGAGATATCTACTTCATTAGAT
TAAGTACAGATTGCGCTCATTTACGTTAAAATATACGTATTAC。
5. the method for developing the microsatellite marker of the icerya purchasi of claim 1, which is characterized in that: the process for extracting DNA from single-head white mulberry scale in the seventh step comprises the following steps:
grinding single-headed insects in liquid nitrogen by using a mortar and a pestle, and putting the powder into a 1.5ml microcentrifuge tube;
② adding 180 μ l buffer ATL;
③ adding 20 mul proteinase K solution, mixing by vortex, mixing thoroughly, incubating at 56 ℃ until the insect is completely dissolved, occasionally dispersing the sample by vortex during the incubation;
vortexing for 15s, adding 200 μ l of buffer AL to the sample, thoroughly mixing by vortexing, then adding 200 μ l of ethanol (96-100%), thoroughly mixing again by vortexing, adding buffer AL and ethanol to form a white precipitate that does not interfere with the DNeasy extraction procedure, and vigorously shaking to digest the precipitate;
fifthly, transferring the mixture from the fourth step into a DNeasy Mini spin column in a collecting pipe of 2ml, centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm), and discarding the circulation and the collecting pipe;
sixthly, putting the DNeasy Mini spin column into a new collecting pipe of 2ml, adding 500 mu l of BufferAW1, centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm), discarding the circulation and the collecting pipe, and not allowing ethanol to remain in the liquid after elution;
seventhly, putting the DNeasy Mini spin column into a clean 1.5ml or 2ml microcentrifuge tube, directly sucking 200 mu l of BufferAE onto the DNeasy membrane, incubating for 1 minute at room temperature, and centrifuging for 1 minute at more than or equal to 6000Xg (8000rpm) to elute;
placing the DNeasy Mini spin column in a clean 1.5ml or 2ml microcentrifuge tube, then directly sucking 200. mu.l of Bufferae onto a DNeasy membrane, incubating at room temperature for 1 minute, and then centrifuging at more than or equal to 6000xg (8000rpm) for 1 minute to elute, thereby obtaining the final DNA extraction solution.
6. The method for developing the microsatellite marker of the icerya purchasi of claim 5, which is characterized in that: attention should be paid to the mortar and pestle used in step (i): to prevent cross-contamination, the mortar and pestle between samples were thoroughly cleaned.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111555993.5A CN114214429A (en) | 2021-12-18 | 2021-12-18 | Development method of microsatellite markers of icerya purchasi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111555993.5A CN114214429A (en) | 2021-12-18 | 2021-12-18 | Development method of microsatellite markers of icerya purchasi |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114214429A true CN114214429A (en) | 2022-03-22 |
Family
ID=80703954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111555993.5A Pending CN114214429A (en) | 2021-12-18 | 2021-12-18 | Development method of microsatellite markers of icerya purchasi |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114214429A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988136A (en) * | 2015-06-22 | 2015-10-21 | 红河学院 | Method for developing microsatellite markers of bagarius yarrelli sykes fishes and application of the method |
| CN108754018A (en) * | 2018-07-27 | 2018-11-06 | 大连民族大学 | A kind of screening technique of wilsonii target gene SSR molecular marker and application |
-
2021
- 2021-12-18 CN CN202111555993.5A patent/CN114214429A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988136A (en) * | 2015-06-22 | 2015-10-21 | 红河学院 | Method for developing microsatellite markers of bagarius yarrelli sykes fishes and application of the method |
| CN108754018A (en) * | 2018-07-27 | 2018-11-06 | 大连民族大学 | A kind of screening technique of wilsonii target gene SSR molecular marker and application |
Non-Patent Citations (2)
| Title |
|---|
| TINGXIAN DENG等: "De Novo Transcriptome Assembly of the Chinese Swamp Buffalo by RNA Sequencing and SSR Marker Discovery" * |
| 许佳丹 等: "我国口岸瓜实蝇监测样本的SSR分子标记分析" * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107201408B (en) | Method for developing sisal hemp SSR primer based on transcriptome sequencing | |
| CN103160937A (en) | Method for conducting enrichment library construction and SNP analysis on gene of complex genome of higher plant | |
| CN108611429B (en) | Litopenaeus vannamei disease resistance related EST-SSR molecular marker and application thereof | |
| CN104962643B (en) | Stablize reference gene, its screening technique and the application of expression in white backed planthopper different tissues position | |
| CN102797044A (en) | Fast and efficient construction method of normalized full-length cDNA library | |
| CN108588091A (en) | A kind of okra reference gene and its application | |
| CN114214429A (en) | Development method of microsatellite markers of icerya purchasi | |
| CN109055573B (en) | Method for rapidly identifying common storage spider mites based on multiple PCR technology | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN112593002B (en) | InDel marker fingerprint spectrum of mushroom L135 strain and construction method thereof | |
| CN116064905A (en) | Primer combination for detecting verticillium dahliae, kit and application | |
| CN113186327B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FC89 strain, construction method and application thereof | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN110964844B (en) | Primer, kit and method for qualitative determination of ginseng, poria cocos and bighead atractylodes rhizome powder | |
| Xie et al. | Construction of cDNA library of cotton mutant (Xiangmian-18) library during gland forming stage | |
| CN108103229B (en) | Candida krusei STR molecular marker and application thereof | |
| CN113151548B (en) | Identification method of microsatellite DNA marker fingerprint of flammulina velutipes FV1923 strain and construction method and application thereof | |
| CN112795681B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM18 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112695130B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen No. 22 strain and construction method and application thereof | |
| CN112695129B (en) | SSR marker fingerprint of hypsizigus marmoreus hunshi No. 12 strain and construction method and application thereof | |
| CN112877457B (en) | SSR (simple sequence repeat) labeled fingerprint spectrum of hypsizigus marmoreus HM6 strain as well as construction method and application of SSR labeled fingerprint spectrum | |
| CN112708694B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-B-3 strain and construction method and application thereof | |
| CN112708696B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-F-4 strain and construction method and application thereof | |
| CN112795686B (en) | SSR marker fingerprint of hypsizigus marmoreus Huzhen 18 strain and construction method and application thereof | |
| CN112795680B (en) | SSR marker fingerprint of Hypsizigus marmoreus Finc-N-11 strain and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20220322 |