CN114208766B - Breeding method of non-dwarf Ningdu yellow chicken mating line - Google Patents
Breeding method of non-dwarf Ningdu yellow chicken mating line Download PDFInfo
- Publication number
- CN114208766B CN114208766B CN202111488512.3A CN202111488512A CN114208766B CN 114208766 B CN114208766 B CN 114208766B CN 202111488512 A CN202111488512 A CN 202111488512A CN 114208766 B CN114208766 B CN 114208766B
- Authority
- CN
- China
- Prior art keywords
- dwarf
- ningdu
- breeding
- yellow chicken
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 139
- 238000009395 breeding Methods 0.000 title claims abstract description 70
- 230000013011 mating Effects 0.000 title claims abstract description 23
- 235000013330 chicken meat Nutrition 0.000 claims abstract description 135
- 230000001488 breeding effect Effects 0.000 claims abstract description 56
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 34
- 238000004519 manufacturing process Methods 0.000 claims abstract description 24
- 230000012010 growth Effects 0.000 claims abstract description 21
- 230000036750 egg laying performance Effects 0.000 claims abstract description 12
- 239000000463 material Substances 0.000 claims abstract description 12
- 235000013372 meat Nutrition 0.000 claims abstract description 9
- 238000000034 method Methods 0.000 claims description 12
- 238000001514 detection method Methods 0.000 claims description 10
- 230000001850 reproductive effect Effects 0.000 claims description 8
- 239000008280 blood Substances 0.000 claims description 6
- 210000004369 blood Anatomy 0.000 claims description 6
- 230000037237 body shape Effects 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 4
- 238000006243 chemical reaction Methods 0.000 abstract description 11
- 230000008901 benefit Effects 0.000 abstract description 9
- 244000144977 poultry Species 0.000 abstract description 7
- 235000013594 poultry meat Nutrition 0.000 abstract description 7
- 239000000796 flavoring agent Substances 0.000 abstract description 3
- 235000019634 flavors Nutrition 0.000 abstract description 3
- 210000001699 lower leg Anatomy 0.000 description 15
- 230000037396 body weight Effects 0.000 description 9
- 230000002068 genetic effect Effects 0.000 description 8
- 235000013601 eggs Nutrition 0.000 description 4
- 102100020948 Growth hormone receptor Human genes 0.000 description 3
- 108010068542 Somatotropin Receptors Proteins 0.000 description 3
- 230000007547 defect Effects 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 230000012447 hatching Effects 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 208000004668 avian leukosis Diseases 0.000 description 2
- 230000033228 biological regulation Effects 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000007812 deficiency Effects 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 239000002184 metal Substances 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 230000017448 oviposition Effects 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 241000271566 Aves Species 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 239000003146 anticoagulant agent Substances 0.000 description 1
- 229940127219 anticoagulant drug Drugs 0.000 description 1
- 238000009412 basement excavation Methods 0.000 description 1
- 210000003323 beak Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 210000003746 feather Anatomy 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 208000032839 leukemia Diseases 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000014759 maintenance of location Effects 0.000 description 1
- 230000004060 metabolic process Effects 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000009400 out breeding Methods 0.000 description 1
- 230000008092 positive effect Effects 0.000 description 1
- 235000013613 poultry product Nutrition 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000000644 propagated effect Effects 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 239000009705 sanhuang Substances 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 210000002303 tibia Anatomy 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Fodder In General (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of poultry breeding, and discloses a breeding method of a non-dwarf Ningdu yellow chicken mating line, which establishes a breeding group of Ningdu yellow chicken mating lines: recording related production performance data by taking pure Ninghuang chickens as materials, selecting excellent individuals from the data to construct a core group according to two selection directions of growth and propagation and constructing a family; secondly, establishing a breeding population of the pure line of the short yellow chicken; and finally, introducing the dwarf gene into Ningdu yellow chicken to obtain a non-dwarf Ningdu yellow chicken complete set. The invention introduces dw gene of the dwarf yellow chicken based on Chinese local chicken variety resource, namely Ningdu yellow chicken, and utilizes the advantages of high egg laying performance and high feed conversion rate to cultivate a new matched set system with good production performance and keeping local chicken body type appearance and meat quality flavor, namely a non-dwarf Ningdu yellow chicken matched set system, thereby providing high-quality breeding and commercial production materials for enterprises, reducing commercial chicken raising cost and improving comprehensive raising benefit.
Description
Technical Field
The invention belongs to the technical field of poultry breeding, and particularly relates to a breeding method of a non-dwarf Ningdu yellow chicken complete set line.
Background
At present, ningdu yellow chicken is a famous excellent local chicken species in Jiangxi provinces, is a precious poultry variety resource, has the characteristics of 'Sanhuang' (beak, feather and shin), 'Wuhong' (crown, beard, face, eye ring and earleaf) and the like, has the characteristics of early sexual maturity, strong adaptability and stress resistance, good clustering and particularly delicious meat quality, and is deeply favored by markets. However, the growth rate of Ninghuang chickens is slow, the feed conversion rate is low, the weakness of market competitiveness is lacking, and the industrialized production process is limited to a great extent.
The chicken dw (dwarf gene) gene is a recessive, concomitant genetic gene which is considered to be the only gene known to be harmless to the health of chickens per se and beneficial to poultry production. The dw gene is a part of functional deficiency caused by the deficiency of partial exon and intron sequences of a growth hormone receptor Gene (GHR), so that the growth and development of chickens are inhibited, the weight of adult hens is reduced by 30%, the weight of adult hens is reduced by 40%, and the tibia is shortened by about 1/3. As the dwarf chicken has the advantages of low basal metabolism rate, low material consumption, high feeding density, strong adaptability, strong stress resistance and the like, the breeding and development of the Ningdu yellow chicken mating line are carried out by introducing the dwarf gene into the Ningdu yellow chicken, and the method has important production and research significance.
Through the above analysis, the problems and defects existing in the prior art are as follows: 1. dwarf homozygote (Z) dw Z dw ) Heterozygous (Z) Dw Z dw ) And normal type (Z) Dw Z Dw ) Individuals cannot be judged in early stage, and when the individuals are about 8 weeks old, individuals with dwarf homozygote and other two genotypes are distinguished by phenotypic characteristics such as weight, shank length and the like, and the individuals with heterozygote (Z Dw Z dw ) With normal homozygote chicken (Z) Dw Z Dw ) In adult chickens, the body size and appearance cannot be accurately distinguished, the existence of heterozygotes can lead to the appearance separation of offspring, and the breeding cost is increased. 2. The original Ningpo yellow chicken has excellent meat quality, but the existing Ningpo yellow chicken has slow growth speed, low laying rate and low feed utilization rate.
The difficulty of solving the problems and the defects is as follows: 1. the screening of the dw gene homozygous cock by the traditional test crossing method is time-consuming and labor-consuming. 2. The productivity of Ningyellow chickens can be improved by manual selection, but the progress is slower for low genetic traits (such as reproductive traits) by manual selection alone, and long-term selection can lead to gradual slowing of genetic progress and reduced genetic diversity of the population, namely the selection limit in terms of breeding science, with low germplasm utilization.
The meaning of solving the problems and the defects is as follows: ningdu yellow chicken is one of Chinese local chicken species and has excellent meat quality, but the industry lacks competitiveness due to low feed conversion rate, insufficient excavation of excellent characters and the like. Aiming at different production performances, the proposal establishes a specialized strain through advanced and reasonable modern breeding means, fully excavates the production potential of Ningdu yellow chickens, introduces dw genes to exert the characteristics of high feed conversion rate and high laying rate, cultivates a non-dwarf Ningdu yellow chicken mating line suitable for market needs, improves the germplasm utilization rate of the Ningdu yellow chickens, and provides technical reference for development and utilization of the Ningdu yellow chickens.
Disclosure of Invention
Aiming at the problems existing in the prior art, the invention provides a breeding method of a non-dwarf Ningdu yellow chicken complete set.
The invention is realized by the method, namely, a dwarf gene in the breeding of a non-dwarf Ningpo yellow chicken mating line, (dwarf gene references [1] Xiao, li Ning, dai Rujuan, and the like, [ J ]. Agricultural biotechnology journal, 1996,4 (2): 174-178 ] of the accurate positioning of the mutation of the growth hormone receptor (cGHR) gene of a sex-linked dwarf chicken (dwdwdwdw).
Reference [2] Sakinje, zhang Yihui, zhang Rui, et al, detection methods for chickens containing sex-linked dwarf genes Dw and/or Dw genes. Research on methods for detecting chickens [ J ]. Chinese poultry, 2015, 37 (4): 9-12).
Another object of the present invention is to provide a kit comprising the dwarf gene and dw gene.
The invention also aims to provide a breeding method of a non-dwarf Ningdu yellow chicken complete set, which comprises the following steps:
firstly, establishing a breeding population of a Ningdu yellow chicken pure line;
secondly, establishing a breeding population of the pure line of the short yellow chicken;
and finally, introducing the dwarf gene into Ningdu yellow chicken to obtain a non-dwarf Ningdu yellow chicken complete set.
Further, the establishing the breeding group of the Ningma yellow chicken pure line comprises the following steps:
recording related production performance data by taking pure Ninghuang chickens as materials, selecting excellent individuals from the data to construct a core group according to two selection directions of growth and propagation and constructing a family;
further, the selecting excellent individuals from among them to construct a core group and construct a family in two selection directions of growth and propagation includes:
the breeding Ningdu yellow chicken pure line is selected as a first female parent, and the growing Ningdu yellow chicken pure line is selected as a second male parent.
Further, selecting the propagated Ningpo yellow chicken clone as the first female parent and selecting the grown Ningpo yellow chicken clone as the second male parent comprises:
selecting a breeding Ningdu yellow chicken clone, mainly selecting families, and mainly selecting egg laying performance, uniformity and body type appearance;
the pure line of the growth type Ningdu yellow chicken is mainly selected by individuals, and mainly selects growth speed, uniformity and body shape and appearance.
Further, the establishing the breeding group of the pure line of the short yellow chicken comprises the following steps:
the method comprises the steps of taking pure breeds of dwarf yellow chickens as materials, constructing families, recording related production performance records, selecting reproductive performance, uniformity and body type and appearance, and screening individuals Z of dwarf homozygous cock by phenotype and molecular detection dw Z dw As the first parent.
Further, the introducing the dwarf gene into Ningdu yellow chicken comprises:
selecting dwarf homozygous dwarf yellow chicken cock Z dw Z dw Breeding Ningdu yellow hen Z Dw W mating, dw Gene (ref [1]]Precise localization of the mutation of the growth hormone receptor (cGHR) gene of alike-linked short chickens (dwdwdw) [ J ]]Agricultural biotechnology journal, 1996,4 (2): 174-178) into Ningdu yellow chicken to obtain F1 generation normal cock Z Dw Z dw And dwarf hen Z dw W is a metal; and mating the F1 generation hen with a grown Ningdu yellow hen to obtain a non-dwarf Ningdu yellow hen complete set line with 75% of Ningdu yellow hen blood margin.
The invention also aims to provide an application of the breeding method of the non-dwarf Ningdu yellow chicken mating line in breeding of high-egg-yield meat chickens.
The invention also aims to provide an application of the breeding method of the non-dwarf Ningpo yellow chicken complete set line in broiler breeding.
The invention also aims to provide an application of the breeding method of the non-dwarf Ningdu yellow chicken mating line in breeding of laying hens.
By combining all the technical schemes, the invention has the advantages and positive effects that:
the invention combines the conventional breeding and molecular breeding technology, introduces the dw gene of the dwarf yellow chicken on the basis of utilizing the Chinese local chicken variety resource, namely Ningdu yellow chicken, and utilizes the advantages of high egg laying performance and high feed conversion rate to cultivate a non-dwarf mating line of the Ningdu yellow chicken with grain saving, high yield and high quality. The complete system not only maintains the body type and appearance of local chickens and the meat flavor, improves the utilization rate of Ningdu yellow chicken germplasm resources, but also can improve the conversion rate of feeds, reduce the production cost of enterprises, adapt to the requirements of mass production of poultry industry and meet the requirements of markets for high-quality poultry products.
Drawings
FIG. 1 is a flowchart of a breeding method of a non-dwarf Ningdu yellow chicken complete set provided by the embodiment of the invention.
FIG. 2 is a diagram showing the simultaneous detection of individuals of 220bp and 420bp as a dwarf type heterozygote according to the present invention.
Detailed Description
The present invention will be described in further detail with reference to the following examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.
Aiming at the problems existing in the prior art, the invention provides a breeding method of a non-dwarf Ningdu yellow chicken complete set system, and the invention is described in detail below with reference to the accompanying drawings.
The invention provides a dwarf gene in breeding of a non-dwarf Ningdu yellow chicken mating line.
The invention provides a kit which comprises the dwarf gene and the dw gene.
As shown in FIG. 1, the breeding method of the non-dwarf Ningdu yellow chicken mating line provided by the embodiment of the invention comprises the following steps:
(1) Establishing a breeding group of Ningdu yellow chicken pure lines: recording related production performance data by taking pure Ninghuang chickens as materials, selecting excellent individuals from the data to construct a core group according to two selection directions of growth and propagation and constructing a family;
(2) Establishing a breeding group of the pure line of the dwarf yellow chicken: the method comprises the steps of taking pure breeds of dwarf yellow chickens as materials, constructing families, recording related production performance records, selecting reproductive performance, uniformity and body type and appearance, and screening individuals Z of dwarf homozygous cock by phenotype and molecular detection dw Z dw As a first parent;
(3) The dwarf gene is introduced into Ningdu yellow chicken to obtain a non-dwarf Ningdu yellow chicken mating line: selecting dwarf homozygous dwarf yellow chicken cock Z dw Z dw Breeding Ningdu yellow hen Z Dw W mating, introducing dw gene into Ningdu yellow chicken to obtain F1 generation normal cock Z Dw Z dw And dwarf hen Z dw W is a metal; f1 generation hen again growsAnd (3) breeding the cock with Ningpo yellow to obtain a non-dwarf Ningpo yellow complete set line with 75% of Ningpo yellow blood margin.
The method for constructing the core group and the family from the excellent individuals according to the two selection directions of growth and propagation comprises the following steps:
the breeding Ningdu yellow chicken pure line is selected as a first female parent, and the growing Ningdu yellow chicken pure line is selected as a second male parent.
The selection of the breeding Ningdu yellow chicken pure line as the first female parent and the selection of the growing Ningdu yellow chicken pure line as the second male parent provided by the embodiment of the invention comprises the following steps:
selecting a breeding Ningdu yellow chicken clone, mainly selecting families, and mainly selecting egg laying performance, uniformity and body type appearance;
the pure line of the growth type Ningdu yellow chicken is mainly selected by individuals, and mainly selects growth speed, uniformity and body shape and appearance.
The technical scheme of the invention is further described below with reference to specific embodiments.
Examples
A seed production method of a non-dwarf Ningdu yellow chicken complete set line, belonging to the technical field of poultry breeding. The invention introduces dw genes of the dwarf yellow chickens on the basis of utilizing Chinese local chicken variety resources-Ningdu yellow chickens, and utilizes the advantages of high egg laying performance and feed conversion rate to cultivate a non-dwarf Ningdu yellow chicken complete set system which has good production performance and maintains local chicken body type appearance and meat quality flavor, thereby realizing the expansion of production scale and the reduction of raising cost, and providing high-quality breeding materials for enterprises so as to cope with risks brought by market fluctuation.
1. Establishing breeding group of Ningdu yellow chicken pure line
Collecting 6000-8000 pure Ningdu yellow chickens, recording related production performance data and body size data, selecting excellent individuals from the data to construct a core group and a family according to two selection directions of growth and propagation, detecting pullorum disease and avian leukemia, and eliminating positive individuals.
The breeding Ningdu yellow chicken clone is mainly selected from families and used as a first female parent, and egg laying performance, uniformity and body type appearance are mainly selected. And (3) constructing a propagation type core group by individuals with good posture and body shape conforming to the characteristics of Ningdu yellow chickens according to the top 15% -20% of the ranking of the egg numbers of 66 weeks in the production record selection group, carrying out locking propagation, detecting pullorum disease and avian leukosis, and eliminating positive individuals. The selected and reserved cocks and hens randomly construct families, 10-15 hens are arranged in each family, the newly constructed families are subjected to family registration, then the next generation is hatched through the family, and family offspring with the average value of egg laying of the selected and reserved families being 30% of the top ranking are selected by taking the families as units. The selection and retention of breeder cocks takes family performance into consideration, and is evaluated according to egg laying performance of the whole-sibling or half-sibling hens. 55-65 families are established to avoid mating of full siblings and half siblings, then the breeding of the egg laying character is continuously carried out according to the same method, and the new breeds of the reproductive Ningdu yellow chicken are obtained after the breeding of 4-5 generations. The production performance of the breeding type Ningdu yellow chicken is basically stable through 4 generations, compared with the 1 generation, the 110-day body weight of the breeding type Ningdu yellow chicken is increased by 198.7g, the 110-day body weight of a hen is increased by 54.5g, the egg laying performance is improved by 4.9 pieces in 280 days, the open-period body weight is increased by 59.9g, the open-period age is 7.6 days in advance, meanwhile, the shank length and the shank circumference of the cock and the hen in 110 days are basically unchanged, the original appearance characteristics of the Ningdu yellow chicken are kept, and the uniformity of the breeding group is obviously improved.
TABLE 1 reproductive Ningdu yellow chicken 1-4 generation genetic progress (hen)
TABLE 2 reproduction Ningdu yellow chicken 1-4 generation genetic progress (cock)
| Project | Generation 1 | Generation 2 | 3 generation of | Generation 4 |
| Body weight/g at 110 days | 1564.9±159.4 | 1673.5±168.3 | 1724.2±137.6 | 1763.6±117.4 |
| 110 days shank length/cm | 9.0±0.5 | 9.3±0.5 | 9.5±0.5 | 9.4±0.5 |
| 110-day shank circumference/cm | 4.0±0.2 | 4.1±0.2 | 4.2±0.2 | 4.1±0.2 |
The growing Ningdu yellow chicken clone is mainly selected by individuals and is used as a second male parent, the growing speed, uniformity and body type appearance are mainly selected, the individuals with good body type and body type conforming to the characteristics of the Ningdu yellow chicken are selected to construct a growing core group for locking breeding, pullorum disease and avian leukosis detection are carried out, and positive individuals are eliminated. And randomly constructing 50-60 families of selected cocks and hens, 10-15 hens in each family, carrying out family registration on the newly constructed families, then carrying out family hatching and subculture, breeding the next generation, continuing to develop breeding of the growth characters according to the same method, avoiding mating of whole siblings and half siblings, and carrying out breeding of 4-5 generations to obtain a new strain of the growing Ningdu yellow chicken. The production performance of the growth type Ningdu yellow chicken is basically stable through 4 generations, compared with the generation 1, the 110-day body weight of the growth type Ningdu yellow chicken is increased by 135.6g, the 110-day body weight of a hen is increased by 309g, the egg laying performance is improved by 4.7 pieces in 280 days, the open-period body weight is increased by 187.3g, the open-period age is advanced by 4.4 days, the original appearance characteristics of the Ningdu yellow chicken are kept, and the uniformity of breeding groups is obviously improved.
TABLE 2 genetic progress of 1-4 generations of Ningdu yellow chicken (hen)
TABLE 2 genetic progress of Ningdu yellow chicken 1-4 generation (cock)
| Project | Generation 1 | Generation 2 | 3 generation of | Generation 4 |
| Body weight/g at 110 days | 1736.2±140.3 | 1800.4±130.0 | 1845.7±101.0 | 1871.8±133.2 |
| 110 days shank length/cm | 9.2±0.5 | 10.0±0.4 | 9.5±0.5 | 11.2±0.5 |
| 110-day shank circumference/cm | 4.0±0.1 | 4.2±0.2 | 4.4±0.2 | 4.2±0.1 |
2. Establishing breeding group of dwarf yellow chicken pure line
The dwarf yellow chicken has excellent reproductive performance, and has the advantages of high laying rate and high feed conversion rate due to containing dw genes. 1500 dwarf yellow chicken hatching eggs are purchased and introduced by Beijing livestock veterinary research institute of China academy of agricultural sciences to hatch, primary chicks wear wing numbers, families are randomly established and related production performance records are carried out, reproductive performance, uniformity and body type appearance are selected, 10-15 hens in each family are selected, and simultaneously, through phenotype and molecular detection, dwarf homozygous cock individuals (Z dw Z dw ). And breeding the next generation through genealogy hatching and subculture, and then continuing breeding the propagation characters and the body type appearance according to the same method to avoid mating of full siblings and half siblings, wherein 50-60 families are maintained in each generation. The weight of a 110-day short and small hen is 1127.9 +/-124.8 g, the length of a shank is 5.5+/-0.1 cm, the shank circumference is 3.4+/-0.1 cm, and the number of eggs laid in 280 days is 86.8+/-14.6; the weight of a 110-day cock is 1541.5 +/-142.6 g, the length of a shank is 6.8+/-0.2 cm, and the circumference of the shank4.1±0.1cm。
The detection method of the short-foot cock molecules comprises the following steps:
the detection is carried out by a conventional method without special regulation, and the related experimental reagents and materials are conventional biochemical reagents and materials if the detection is carried out without special regulation.
Blood was collected at about 200uL by using a blood collection tube containing an anticoagulant, shaken well, stored at-20℃and DNA was extracted with a blood genome extraction kit (purchased from Beijing kang, century Biotech Co., ltd.) and measured for concentration and purity with a micro-spectrophotometer.
PCR amplification reaction system: 2 XEs Taq Master mix (Dye) 10ul, 1ul each of the upstream primers PF1 and PF2, 1ul each of the downstream primers PR1 and PR2, 1ul of the DNA template, and 5ul of ultrapure water.
Reaction conditions: pre-denaturation at 94℃for 2min; denaturation at 94℃for 30s, annealing at 57℃for 30s, elongation at 72℃for 30s,33 cycles; final extension at 72℃for 2min;4, storing.
Primer sequence:
PF1 5’-tcccagactacacttctattca-3’
PR1 5’-cggggacagatcaaagacaatac-3’
PF2 5’-acctccaaagaaatctgtcgag-3’
PR2 5’-tggccaaatcctgaagtcct-3’
primers were cited from reference [2], synthesized by Beijing Hua major Gene Co., ltd, and Es Taq MasterMix was purchased from Beijing as century Biotech Co.
Experimental results:
the PCR product is detected by 1-2% agarose gel, and the result shows that only individuals with 220bp bands can be detected to be petiole homozygotes; only individuals with 420bp bands can be detected as normal homozygotes; the individuals of 220bp and 420bp can be detected as the dwarf heterozygotes. As shown in fig. 2.
Wherein, 220bp PCR product sequencing result
ccaagccttgtgctcatgcaaactcagaatgtcattttggtactttactggtcacacaagccattattcgccggtcagaagatgtgtctttcagtttctatttaactttccttatgtcagtgttttgtttgttttcctcgaagtttaataaatgtattgtctttgatctgtccccga。
Sequencing result of 420bp PCR product
gagaaattttttagggacttagagtatcgatcctgttgctttcttatggtaactaatatagaaatagacatgaaatttaaagttttgtagaaaactttaaactatacaaaatatttggacaaaaatttctgttcttcatcaaattctggttaatgataatatacttttttaaagcaaggtttcaatgaccacagtattaagtagtatggaagtacactttcattgaaaatttttgaaaacacatgaataagctctggtgatttagcagcataatcttttcgtatttgaccaacttctgaagccctccatggacaagctaccactacagttattagacagtgacacatgaaatattgattaagaaaataaggacttcaggatttggccaa。
3. Cultivation of non-dwarf Ningdu yellow chicken strain
Selecting dwarf homozygous dwarf yellow chicken cock (Z) dw Z dw ) The bred Ningdu yellow hen (Z) as the first male parent and bred in the step 1 Dw W) mating, and introducing dw gene into Ningdu yellow chicken to obtain F1 generation normal cock (Z) Dw Z dw ) And dwarf hens (Z) dw W). As dw genes are introduced, F1 generation individuals can distinguish male and female through shank length, and meanwhile, the growth performance and egg laying performance of hens bred by Ningdu yellow chickens are further improved by utilizing the hybridization advantage, and the feed utilization rate is improved. And the F1 generation hen is bred with a growing Ningdu yellow hen cock to obtain a non-dwarf Ningdu yellow hen complete set system with the appearance and meat quality similar to those of a Ningdu yellow hen breeder seed, and the egg laying performance and the feed conversion rate superior to those of the Ningdu yellow hen breeder seed. The hen body weight is 1454.8 +/-118.4 g, the shank length is 7.2+/-0.4 cm, and the shank circumference is 4.0+/-0.1 cm in 110 days; the number of eggs laid in 280 days is 81.7+/-13.5. The weight of a 110-day cock is 1711.2 +/-165.6 g, the length of a shank is 10.2+/-0.5 cm, and the circumference of the shank is 4.2+/-0.2 cm.
The foregoing is merely illustrative of specific embodiments of the present invention, and the scope of the invention is not limited thereto, but any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention will be apparent to those skilled in the art within the scope of the present invention.
Sequence listing
<110> institute of livestock and veterinary at academy of agricultural sciences in Jiangxi province
JIANGXI HUIDA REAL ESTATE Co.,Ltd.
<120> method for breeding non-dwarf Ningdu yellow chicken mating line
<140> 2021114885123
<141> 2021-12-07
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
tcccagacta cacttctatt cacggggaca gatcaaagac aatac 45
<210> 2
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
acctccaaag aaatctgtcg agtggccaaa tcctgaagtc ct 42
<210> 3
<211> 177
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ccaagccttg tgctcatgca aactcagaat gtcattttgg tactttactg gtcacacaag 60
ccattattcg ccggtcagaa gatgtgtctt tcagtttcta tttaactttc cttatgtcag 120
tgttttgttt gttttcctcg aagtttaata aatgtattgt ctttgatctg tccccga 177
<210> 4
<211> 389
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gagaaatttt ttagggactt agagtatcga tcctgttgct ttcttatggt aactaatata 60
gaaatagaca tgaaatttaa agttttgtag aaaactttaa actatacaaa atatttggac 120
aaaaatttct gttcttcatc aaattctggt taatgataat atactttttt aaagcaaggt 180
ttcaatgacc acagtattaa gtagtatgga agtacacttt cattgaaaat ttttgaaaac 240
acatgaataa gctctggtga tttagcagca taatcttttc gtatttgacc aacttctgaa 300
gccctccatg gacaagctac cactacagtt attagacagt gacacatgaa atattgatta 360
agaaaataag gacttcagga tttggccaa 389
Claims (2)
1. The breeding method of the non-dwarf Ningsu yellow chicken mating line is characterized by comprising the following steps of:
establishing a breeding population of Ningdu yellow chicken pure line;
establishing a breeding population of a pure line of the dwarf yellow chicken;
introducing the dwarf gene into Ningdu yellow chicken to obtain a non-dwarf Ningdu yellow chicken mating line;
the breeding group for establishing the Ningpo yellow chicken pure line comprises the following steps:
taking pure Ningdu yellow chicken as a material, acquiring related production performance data, selecting excellent individuals from the data to construct a core group according to two selection directions of growth and propagation, and constructing a family;
the selecting excellent individuals from the above groups to form core groups according to two selection directions of growth and propagation and forming families comprises:
selecting a breeding Ningdu yellow chicken pure line as a first female parent and selecting a growing Ningdu yellow chicken pure line as a second male parent;
the selecting the breeding Ningdu yellow chicken pure line as the first female parent and the growing Ningdu yellow chicken pure line as the second male parent comprises the following steps:
selecting a pure line family of the breeding Ningdu yellow chicken by taking egg laying performance, uniformity and body type and appearance as factors;
the growth rate, uniformity and body shape are taken as factors to carry out the individual selection of the pure line of the growth type Ningdu yellow chicken;
the establishment of the breeding group of the pure line of the short yellow chicken comprises the following steps:
the method comprises the steps of using pure breeds of dwarf yellow chickens as materials, constructing families, recording related production performance data, selecting reproductive performance, uniformity and body type and appearance, and screening individuals ZdwZdw of dwarf homozygous cock chickens as a first male parent through phenotype and molecular detection;
the introduction of the dwarf gene into Ningdu yellow chicken comprises the following steps:
selecting a dwarf homozygous dwarf yellow hen ZdwZdw to hybridize with a bred breeding Ningdu yellow hen ZdwW, and introducing dw genes into the Ningdu yellow hen to obtain F1 generation normal cock ZDwZdw and dwarf hen ZdwW; and (3) hybridizing the F1-generation hen with the grown Ningdu yellow hen to obtain a non-dwarf Ningdu yellow hen complete set line with 75% of Ningdu yellow hen blood margin.
2. Use of the breeding method of the non-dwarf Ningpo yellow chicken complete set system as claimed in claim 1 in breeding of meat chickens with high egg yield.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111488512.3A CN114208766B (en) | 2021-12-07 | 2021-12-07 | Breeding method of non-dwarf Ningdu yellow chicken mating line |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111488512.3A CN114208766B (en) | 2021-12-07 | 2021-12-07 | Breeding method of non-dwarf Ningdu yellow chicken mating line |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114208766A CN114208766A (en) | 2022-03-22 |
| CN114208766B true CN114208766B (en) | 2023-07-21 |
Family
ID=80700296
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111488512.3A Active CN114208766B (en) | 2021-12-07 | 2021-12-07 | Breeding method of non-dwarf Ningdu yellow chicken mating line |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114208766B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106614266B (en) * | 2016-09-21 | 2020-07-14 | 佛山科学技术学院 | Method for breeding new strain of high-quality white-feather black-beak yellow-shin ducks |
| CN109997788B (en) * | 2019-04-19 | 2021-04-20 | 广西壮族自治区畜牧研究所 | Breeding method of short and small yellow-feather yellow-shank chickens |
-
2021
- 2021-12-07 CN CN202111488512.3A patent/CN114208766B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114208766A (en) | 2022-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210007334A1 (en) | Identification of white leghorns red plumage mutagenic mutant genotype and cultivation method for supporting system of red plumage pink shell layer chickens | |
| CN107667976B (en) | Method for producing seeds of male-female self-discriminating high-yield Luhua feather green-shell laying hens | |
| CN110367197B (en) | Hybridization matching combination research method of meat pigeons | |
| CN111334589B (en) | Molecular marker related to Liancheng white duck white feather color and breeding method of Liancheng white duck hybrid white feather offspring | |
| WO2022227692A1 (en) | Intermuscular bone-free crucian strain and cultivation method therefor | |
| CN109105338B (en) | Seed production method of red-feather white-shell laying hen complete set line | |
| CN107779516A (en) | A kind of SNP marker for influenceing pig birth weight character and its application | |
| CN103798169A (en) | Method for quickly establishing improved breeding system of YY super-male pelteobagrus fulvidraco | |
| CN104823919A (en) | Cultivation method and application of recessive white feather new strain of Xiaoxiang chicken in southeast of Guizhou province | |
| CN116356038A (en) | Breeding method for screening Fugu rubripes individuals with rapid growth performance | |
| CN114438132A (en) | Establishment method of nile tilapia mstnb homozygous knockout line and fast-growing strain obtained by same | |
| CN108251418B (en) | SNP molecular marker related to growth speed of broiler chicken and application thereof | |
| CN111406710B (en) | Selective breeding method | |
| CN107494415B (en) | Method for breeding new Guangdong yellow chickens | |
| CN114208766B (en) | Breeding method of non-dwarf Ningdu yellow chicken mating line | |
| CN112746114A (en) | Molecular marker for early selection of local chicken feed conversion rate and identification method and application thereof | |
| CN115251004B (en) | Cultivation method of green-shank yellow-feather high-quality broilers | |
| CN107937568B (en) | Application and method of PRLR gene | |
| CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
| CN114214432A (en) | Molecular marker for identifying melanin diffusion gene locus of chicken and application of molecular marker in assisted breeding | |
| CN111280126B (en) | Breeding method and application of yellow-feather beard laying hens | |
| CN111406712B (en) | Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 | |
| CN114271237A (en) | Method for breeding long-short velvet self-sexing pigeons | |
| CN111418548A (en) | Breeding method of dwarf yellow chicken strain with homozygous mutation caused by pathogen | |
| CN106701935A (en) | Fast pyramiding breeding method of high-quality broiler multi-target traits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |