CN114208766A - Breeding method of non-dwarf type Ningdu yellow chicken complete set line - Google Patents
Breeding method of non-dwarf type Ningdu yellow chicken complete set line Download PDFInfo
- Publication number
- CN114208766A CN114208766A CN202111488512.3A CN202111488512A CN114208766A CN 114208766 A CN114208766 A CN 114208766A CN 202111488512 A CN202111488512 A CN 202111488512A CN 114208766 A CN114208766 A CN 114208766A
- Authority
- CN
- China
- Prior art keywords
- dwarf
- ningdu
- breeding
- yellow chicken
- chicken
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 161
- 238000009395 breeding Methods 0.000 title claims abstract description 78
- 235000013330 chicken meat Nutrition 0.000 claims abstract description 152
- 230000001488 breeding effect Effects 0.000 claims abstract description 61
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 35
- 238000004519 manufacturing process Methods 0.000 claims abstract description 26
- 239000000463 material Substances 0.000 claims abstract description 16
- 230000001850 reproductive effect Effects 0.000 claims description 16
- 238000000034 method Methods 0.000 claims description 13
- 230000037237 body shape Effects 0.000 claims description 11
- 230000036750 egg laying performance Effects 0.000 claims description 11
- 238000001514 detection method Methods 0.000 claims description 8
- 238000012216 screening Methods 0.000 claims description 4
- 238000009396 hybridization Methods 0.000 claims 1
- 238000006243 chemical reaction Methods 0.000 abstract description 11
- 230000013011 mating Effects 0.000 abstract description 11
- 235000013372 meat Nutrition 0.000 abstract description 8
- 244000144977 poultry Species 0.000 abstract description 7
- 235000013594 poultry meat Nutrition 0.000 abstract description 7
- 239000000796 flavoring agent Substances 0.000 abstract description 4
- 235000019634 flavors Nutrition 0.000 abstract description 4
- 230000002068 genetic effect Effects 0.000 description 7
- 230000037396 body weight Effects 0.000 description 6
- 230000017448 oviposition Effects 0.000 description 6
- 239000008280 blood Substances 0.000 description 4
- 210000004369 blood Anatomy 0.000 description 4
- 230000007547 defect Effects 0.000 description 4
- 230000012447 hatching Effects 0.000 description 4
- 102100020948 Growth hormone receptor Human genes 0.000 description 3
- 108010068542 Somatotropin Receptors Proteins 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 235000013601 eggs Nutrition 0.000 description 3
- 206010064571 Gene mutation Diseases 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 208000032839 leukemia Diseases 0.000 description 2
- 238000009400 out breeding Methods 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 238000009394 selective breeding Methods 0.000 description 2
- 238000012163 sequencing technique Methods 0.000 description 2
- 241000271566 Aves Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- CTQNGGLPUBDAKN-UHFFFAOYSA-N O-Xylene Chemical compound CC1=CC=CC=C1C CTQNGGLPUBDAKN-UHFFFAOYSA-N 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 239000003146 anticoagulant agent Substances 0.000 description 1
- 229940127219 anticoagulant drug Drugs 0.000 description 1
- 208000004668 avian leukosis Diseases 0.000 description 1
- 238000009412 basement excavation Methods 0.000 description 1
- 210000003323 beak Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 210000003746 feather Anatomy 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000011031 large-scale manufacturing process Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 230000004807 localization Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 230000037323 metabolic rate Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000008092 positive effect Effects 0.000 description 1
- 235000013613 poultry product Nutrition 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 230000001568 sexual effect Effects 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 210000003462 vein Anatomy 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Fodder In General (AREA)
Abstract
The invention belongs to the technical field of poultry breeding, and discloses a breeding method of a non-dwarf type Ningdu yellow chicken complete line, which comprises the following steps of establishing a breeding group of Ningdu yellow chicken pure lines: taking Ningdu yellow chicken pure breed as a material, recording related production performance data, selecting excellent individuals from the material, and establishing a core group and a family according to two selection directions of growth and propagation; secondly, establishing a breeding group of the dwarf yellow chicken pure line; finally, the dwarf gene is introduced into Ningdu yellow chickens to obtain a non-dwarf Ningdu yellow chicken complete set. The invention introduces dw gene of dwarf yellow chicken on the basis of utilizing local chicken variety resource-Ningdu yellow chicken in China, utilizes the advantages of high egg production performance and high feed conversion rate to breed a new mating system which has good production performance and keeps the body appearance and meat quality and flavor of local chicken, namely a non-dwarf Ningdu yellow chicken mating system, provides high-quality breeding and commercial production materials for enterprises, reduces the feeding cost of commercial chicken and improves the comprehensive feeding benefit.
Description
Technical Field
The invention belongs to the technical field of poultry breeding, and particularly relates to a breeding method of a non-dwarf Ningdu yellow chicken complete set line.
Background
At present, Ningdu yellow chicken is a famous excellent local meat chicken breed in Jiangxi province, is a valuable poultry variety resource, has the characteristics of beautiful appearance such as 'three yellow' (beak, feather and shin), 'five red' (crown, beard, face, eye ring and ear leaf), and the like, and has the advantages of early sexual maturity, strong adaptability and stress resistance, good clustering performance, and particularly delicious meat quality which is deeply favored by the market. However, the Ningdu yellow chicken has the defects of slow growth speed, low feed conversion rate and lack of market competitiveness, and the industrialized production process of the Ningdu yellow chicken is also restricted to a great extent.
The chicken dw (dwarf gene) gene is a recessive and sex-linked genetic gene which is considered to be the only gene in all known dwarf genes, is harmless to the health of chicken per se and is beneficial to poultry production. The dw gene is partially deficient in function due to deletion of partial exon and intron sequences of a growth hormone receptor Gene (GHR), so that growth and development of the chicken are inhibited, the weight of an adult hen is reduced by 30%, the weight of an adult cock is reduced by 40%, and the shin is shortened by about 1/3. Because the dwarf chicken has the advantages of low basal metabolic rate, less material consumption, high feeding density, strong adaptability and stress resistance and the like, the breeding and development of the Ningdu yellow chicken complete set system by introducing dwarf genes into Ningdu yellow chicken have important production and research significance.
Through the above analysis, the problems and defects of the prior art are as follows: 1. dwarf homozygous (Z)dwZdw) (Z) hybrid typeDwZdw) And normal type (Z)DwZDw) The individuals can not be judged in early stage, and when the individuals need to be about 8 weeks old, the individuals with the dwarf homozygous type and the other two genotypes are distinguished by phenotypic characteristics such as weight, shin length and the like, and the individuals with the heterozygous type (Z) areDwZdw) With normal homozygous chicken (Z)DwZDw) The body size appearance can not be accurately distinguished in adult chickens, and the character separation of offspring can be caused by the existence of heterozygotes, so that the breeding cost is increased. 2. The Ningdu yellow chicken breeder seeds have excellent meat quality, but the existing Ningdu yellow chicken grows slowly, the laying rate is low, and the feed utilization rate is low.
The difficulty in solving the above problems and defects is: 1. the screening of dw gene homozygous cocks by the traditional test cross method is time-consuming and labor-consuming. 2. The production performance of Ningdu yellow chickens can be improved through artificial selection, but the low heritability characters (such as reproductive characters) only progress slowly through artificial selection, and long-term selection can lead to gradual slow genetic progress and to reduction of population genetic diversity, namely the selection limit in breeding science, and meanwhile, the germplasm utilization rate is low.
The significance of solving the problems and the defects is as follows: ningdu yellow chicken as one of local chicken breeds in China has excellent meat quality, but the industry lacks competitiveness due to low feed conversion rate, insufficient excavation of excellent characters and the like. The scheme aims at different production performances, establishes a specialized strain through advanced and reasonable modern breeding means, fully excavates the production potential of Ningdu yellow chicken, introduces dw gene to exert the characteristics of high feed conversion rate and high egg yield, cultivates a non-dwarf Ningdu yellow chicken complete set system suitable for market needs, improves the germplasm utilization rate of Ningdu yellow chicken, and provides technical reference for development and utilization of Ningdu yellow chicken.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a breeding method of a non-dwarf type Ningdu yellow chicken complete set line.
The invention is realized in such a way that dwarf genes (dwarf gene reference [1] xylol, plum, jujuan, and the like) in the breeding of non-dwarf Ningdu yellow chicken mating lines precisely locate the gene mutation of sex-linked dwarf chicken (dwdwdwdw) growth hormone receptor (cGHR) [ J ] Proc. Biotech Proc. 1996, 4 (2): 174-.
Reference [2] Gaoyejie, Zhang Yihui, Zhang Rui, et al detection method of chicken containing sex-linked dwarf gene Dw and/or Dw Gene Liyang [ J ] Chinese fowl 2015, 37 (4): 9-12).
Another objective of the invention is to provide a kit, which comprises the dwarf gene and the dw gene.
The invention also aims to provide a breeding method of the non-dwarf type Ningdu yellow chicken complete set line, which comprises the following steps:
firstly, establishing a breeding group of Ningdu yellow chicken pure lines;
secondly, establishing a breeding group of the dwarf yellow chicken pure line;
finally, the dwarf gene is introduced into Ningdu yellow chickens to obtain a non-dwarf Ningdu yellow chicken complete set.
Further, the breeding group for establishing the pure line of the Ningdu yellow chickens comprises:
taking Ningdu yellow chicken pure breed as a material, recording related production performance data, selecting excellent individuals from the material, and establishing a core group and a family according to two selection directions of growth and propagation;
further, the selecting excellent individuals from the group to establish a core group and establish a family according to two selection directions of growth and propagation comprises the following steps:
selecting a reproductive Ningdu yellow chicken pure line as a first female parent, and selecting a growing Ningdu yellow chicken pure line as a second male parent.
Further, the selecting a breeding type Ningdu yellow chicken pure line as a first female parent and selecting a growing type Ningdu yellow chicken pure line as a second male parent comprises the following steps:
selecting a breeding type Ningdu yellow chicken pure line, mainly selecting the family selection, and mainly selecting the egg laying performance, the uniformity and the body shape;
the pure line of growing Ningdu yellow chicken is mainly selected by individuals, and mainly selected by growth speed, uniformity and body shape.
Further, the establishing of the breeding group of the dwarf yellow chicken pure line comprises the following steps:
using pure breed of dwarf yellow chicken as material, building a family and recording related production performance records, selecting reproductive performance, uniformity and body appearance, and screening individual Z of dwarf homozygous cock by phenotype and molecular detectiondwZdwAs the first male parent.
Further, the introduction of the dwarf gene into Ningdu yellow chickens includes:
selecting short and pure type short and small yellow cock ZdwZdwBreeding bred Ningdu yellow hen ZDwW breeding, and breeding the dw gene (reference [1]]Precise localization of sex-linked dwarf chicken (dwdwdwdwdw) growth hormone receptor (cGHR) gene mutations [ J]Agro-biotechnological newspaper, 1996, 4 (2): 174-178) into Ningdu yellow chickens to obtain F1 normal-type cocks ZDwZdwAnd dwarf hen ZdwW; the F1 hen was bred with a growing-type Ningdu yellow chicken cock to obtain a non-dwarf Ningdu yellow chicken complete set with a 75% Ningdu yellow chicken bloody border.
The invention also aims to provide application of the breeding method of the non-dwarf type Ningdu yellow chicken complete set line in breeding of high-egg-yield broiler chickens.
The invention also aims to provide application of the breeding method of the non-dwarf type Ningdu yellow chicken complete set line in broiler breeding.
The invention also aims to provide application of the breeding method of the non-dwarf Ningdu yellow chicken complete set line in laying hen breeding.
By combining all the technical schemes, the invention has the advantages and positive effects that:
the invention combines conventional breeding and molecular breeding technology, introduces dw gene of dwarf yellow chicken on the basis of utilizing local chicken variety resource of China, Ningdu yellow chicken, and utilizes the advantages of high egg laying performance and high feed conversion rate to cultivate non-dwarf complete set of Ningdu yellow chicken with grain saving, high yield and high quality. The mating system not only keeps the body appearance and the meat quality and the flavor of local chickens, improves the utilization rate of germ plasm resources of Ningdu yellow chickens, but also can improve the conversion rate of feed, reduce the production cost of enterprises, adapt to the requirement of large-scale production of poultry industry and meet the requirement of the market on high-quality poultry products.
Drawings
FIG. 1 is a flow chart of a breeding method of a non-dwarf Ningdu yellow chicken complete set line provided by the embodiment of the invention.
FIG. 2 is a short-footed heterozygous subgraph for detecting individuals of 220bp and 420bp simultaneously, which is provided by the embodiment of the invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Aiming at the problems in the prior art, the invention provides a breeding method of a non-dwarf type Ningdu yellow chicken complete set line, and the invention is described in detail below by combining the attached drawings.
The invention provides a dwarf gene in breeding of non-dwarf Ningdu yellow chicken mating lines.
The invention provides a kit, which comprises the dwarf gene and dw gene.
As shown in fig. 1, the breeding method of the non-dwarf type Ningdu yellow chicken complete set line provided by the embodiment of the invention comprises the following steps:
(1) establishing a breeding group of Ningdu yellow chicken pure lines: taking Ningdu yellow chicken pure breed as a material, recording related production performance data, selecting excellent individuals from the material, and establishing a core group and a family according to two selection directions of growth and propagation;
(2) establishing a breeding group of the dwarf yellow chicken pure line: using pure breed of dwarf yellow chicken as material, building a family and recording related production performance records, selecting reproductive performance, uniformity and body appearance, and screening individual Z of dwarf homozygous cock by phenotype and molecular detectiondwZdwAs a first male parent;
(3) the dwarf gene is introduced into Ningdu yellow chickens to obtain a non-dwarf Ningdu yellow chicken complete set: selecting short and pure type short and small yellow cock ZdwZdwBreeding bred Ningdu yellow hen ZDwW breeding, and introducing dw gene into Ningdu yellow chicken to obtain F1 normal cock ZDwZdwAnd dwarf hen ZdwW; the F1 hen was bred with a growing-type Ningdu yellow chicken cock to obtain a non-dwarf Ningdu yellow chicken complete set with a 75% Ningdu yellow chicken bloody border.
The method for selecting excellent individuals from the excellent individuals to establish a core group and establish a family according to two selection directions of growth and propagation comprises the following steps:
selecting a reproductive Ningdu yellow chicken pure line as a first female parent, and selecting a growing Ningdu yellow chicken pure line as a second male parent.
The embodiment of the invention provides a method for selecting a reproductive Ningdu yellow chicken pure line as a first female parent and selecting a growing Ningdu yellow chicken pure line as a second male parent, which comprises the following steps:
selecting a breeding type Ningdu yellow chicken pure line, mainly selecting the family selection, and mainly selecting the egg laying performance, the uniformity and the body shape;
the pure line of growing Ningdu yellow chicken is mainly selected by individuals, and mainly selected by growth speed, uniformity and body shape.
The technical solution of the present invention is further described with reference to the following specific embodiments.
Examples
A method for producing seeds of non-dwarf Ningdu yellow chicken complete sets, belonging to the technical field of poultry breeding. The invention introduces dw gene of dwarf yellow chicken on the basis of utilizing local chicken variety resource of China, namely Ningdu yellow chicken, utilizes the advantages of high egg laying performance and high feed conversion rate to breed a non-dwarf Ningdu yellow chicken complete set system which has good production performance and keeps the body appearance and meat flavor of local chicken, realizes production scale expansion and feeding cost reduction, provides high-quality breeding materials for enterprises and deals with risks brought by market fluctuation.
1. Breeding group for establishing pure line of Ningdu yellow chickens
6000-plus 8000 pure Ningdu yellow chickens are collected, relevant production performance data and body size data are recorded, excellent individuals are selected from the production performance data and the body size data, core groups and families are established according to two selection directions of growth and propagation, pullorum disease and avian leukemia detection is carried out, and positive individuals are eliminated.
The breeding type Ningdu yellow chicken pure line is mainly selected from families, is used as a first female parent and mainly selects egg laying performance, uniformity and body shape. And selecting individuals with the egg laying number of 15-20% at the top of the 66-week-old egg laying number in the population according to production records, good physique and body type conforming to the characteristics of Ningdu yellow chickens to establish a reproductive core population for locked breeding, detecting pullorum disease and avian leukosis, and eliminating positive individuals. And randomly establishing families by the selected cock and hen, wherein each family is 10-15 hens, performing pedigree registration on the newly established family, hatching the next generation by pedigree, and selecting and reserving 30% of the offspring of the family with the average egg laying rate as the top by taking the family as a unit. The breeding cock is selected and kept in consideration of the family performance, and the egg laying performance of the full-sib chicken or the half-sib chicken is evaluated. And (4) establishing 55-65 families to avoid mating of the full siblings and the half siblings, continuously carrying out egg-laying character breeding according to the same method, and carrying out breeding of 4-5 generations to obtain a new reproductive Ningdu yellow chicken strain. The breeding type Ningdu yellow chicken bred and bred through 4 generations has basically stable production performance, compared with 1 generation, the breeding type Ningdu yellow chicken bred through 4 generations has the advantages that the 110-day body weight of the breeding type Ningdu yellow chicken cock is increased by 198.7g, the 110-day body weight of the hen is increased by 54.5g, the egg laying performance in 280 days is improved by 4.9, the initial yield weight is increased by 59.9g, the initial yield day age is advanced by 7.6 days, meanwhile, the shin length and the shin circumference of 110 days of the cock and the hen are basically kept unchanged, the original appearance characteristics of the Ningdu yellow chicken are kept, and the uniformity of breeding groups is obviously improved.
TABLE 1 reproductive Ningdu yellow chickens 1-4 Generation genetic progress (hens)
TABLE 2 reproductive Ningdu yellow chickens 1-4 Generation genetic progress (rooster)
| | Generation | 1 | |
3 | Generation | 4 |
| Body weight/g for 110 days | 1564.9±159.4 | 1673.5±168.3 | 1724.2±137.6 | 1763.6±117.4 | ||
| Length of shin/cm for 110 days | 9.0±0.5 | 9.3±0.5 | 9.5±0.5 | 9.4±0.5 | ||
| Shin circumference/cm for 110 days | 4.0±0.2 | 4.1±0.2 | 4.2±0.2 | 4.1±0.2 |
The growing Ningdu yellow chicken pure line mainly adopts individual selection as a second male parent, mainly selects the growth speed, the uniformity and the body shape appearance, selects individuals with good body form and body shape conforming to the characteristics of Ningdu yellow chicken to construct a growing core group for locked breeding, detects pullorum disease and poultry leukemia, and eliminates positive individuals. Selecting and reserving cock and hen to randomly establish 50-60 families, each 10-15 hen, performing pedigree registration on the newly established family, then hatching and subculturing through the pedigree, breeding the next generation, continuing to perform breeding of growth characters according to the same method, avoiding mating of full siblings and half siblings, and obtaining the new line of the growing Ningdu yellow chicken through breeding of 4-5 generations. The production performance of the Ningdu yellow chicken bred by the 4 generations is basically stable, compared with the 4 generations, the 110-day body weight of the grown Ningdu yellow chicken cock is increased by 135.6g, the 110-day body weight of the hen is increased by 309g, the egg laying performance in 280 days is improved by 4.7, the initial product weight is increased by 187.3g, the initial product day age is advanced by 4.4 days, the original appearance characteristics of the Ningdu yellow chicken are kept, and the uniformity of the bred groups is improved obviously.
TABLE 2 growth type Ningdu yellow chickens 1-4 generations of genetic progress (hens)
TABLE 2 growth type Ningdu yellow chickens 1-4 generations of genetic progress (rooster)
| | Generation | 1 | |
3 | Generation | 4 |
| Body weight/g for 110 days | 1736.2±140.3 | 1800.4±130.0 | 1845.7±101.0 | 1871.8±133.2 | ||
| Length of shin/cm for 110 days | 9.2±0.5 | 10.0±0.4 | 9.5±0.5 | 11.2±0.5 | ||
| Shin circumference/cm for 110 days | 4.0±0.1 | 4.2±0.2 | 4.4±0.2 | 4.2±0.1 |
2. Establishing breeding group of dwarf yellow chicken pure line
The dwarf yellow chicken has excellent reproductive performance, and has the advantages of high laying rate and high feed conversion rate due to containing dw genes. 1500 dwarf yellow chicken hatching eggs are purchased and introduced by Beijing animal veterinary institute of Chinese agricultural academy of sciences to be hatched, newborn chicks are worn with wing numbers, families are randomly established and relevant production performance records are recorded, reproductive performance, uniformity and body shape appearance are selected, 10-15 hens in each family are selected, and dwarf homozygous cock individuals (Z) are screened from the eggs through phenotypic and molecular detectiondwZdw). And (3) carrying out pedigree hatching and subculture, breeding the next generation, and continuously carrying out breeding of reproductive traits and body shape appearance according to the same method, so that full sib mating and half sib mating are avoided, and 50-60 families are maintained in each generation. The bred dwarf hens with 110 days have the weight of 1127.9 +/-124.8 g, the shin length of 5.5 +/-0.1 cm, the shin circumference of 3.4 +/-0.1 cm and the egg laying number of 86.8 +/-14.6 in 280 days; the weight of the 110-day cock is 1541.5 + -142.6 g, the length of the shin is 6.8 + -0.2 cm, and the circumference of the shin is 4.1 + -0.1 cm.
The molecular detection method of the bantam cock comprises the following steps:
the detection is carried out by a conventional method without special regulation, and the involved experimental reagents and materials are conventional biochemical reagents and materials without special regulation.
A blood collection tube containing an anticoagulant is used for collecting blood in a chicken wing vein by about 200uL, the blood is shaken up and stored at the temperature of minus 20 ℃, a blood genome extraction kit (purchased from Beijing kang, century Biotech Co., Ltd.) is used for extracting DNA, and the concentration and the purity are measured by a micro spectrophotometer.
PCR amplification reaction System: 2 XEs Taq MasterMix (Dye)10ul, upstream primers PF1 and PF2 each 1ul, downstream primers PR1 and PR2 each 1ul, DNA template 1ul, and ultrapure water 5 ul.
Reaction conditions are as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 30s, for 33 cycles; final extension at 72 deg.C for 2 min; and 4, storing.
The primer sequence is as follows:
PF1 5’-tcccagactacacttctattca-3’
PR1 5’-cggggacagatcaaagacaatac-3’
PF2 5’-acctccaaagaaatctgtcgag-3’
PR2 5’-tggccaaatcctgaagtcct-3’
primers were cited from reference [2] synthesized by Beijing Huada Gen Ltd, and Es Taq MasterMix was purchased from Beijing kang, century Biotechnology Ltd.
The experimental results are as follows:
detecting the PCR product by using 1-2% agarose gel, wherein the result shows that the individual with the detected 220bp band is a dwarf homozygous; only an individual with 420bp bands can be detected as a normal homozygote; can simultaneously detect that the individuals of 220bp and 420bp are dwarf heterozygotes. As shown in fig. 2.
Wherein, the sequencing result of the 220bp PCR product
ccaagccttgtgctcatgcaaactcagaatgtcattttggtactttactggtcacacaagccattattcgccggtcagaagatgtgtctttcagtttctatttaactttccttatgtcagtgttttgtttgttttcctcgaagtttaataaatgtattgtctttgatctgtccccga。
Sequencing result of 420bp PCR product
gagaaattttttagggacttagagtatcgatcctgttgctttcttatggtaactaatatagaaatagacatgaaatttaaagttttgtagaaaactttaaactatacaaaatatttggacaaaaatttctgttcttcatcaaattctggttaatgataatatacttttttaaagcaaggtttcaatgaccacagtattaagtagtatggaagtacactttcattgaaaatttttgaaaacacatgaataagctctggtgatttagcagcataatcttttcgtatttgaccaacttctgaagccctccatggacaagctaccactacagttattagacagtgacacatgaaatattgattaagaaaataaggacttcaggatttggccaa。
3. Breeding of non-dwarf Ningdu yellow chicken strain
Selecting short and pure type short and small yellow rooster cock (Z)dwZdw) Reproductive Ningdu yellow hen (Z) as first male parent and bred in step 1DwW) mating, introducing dw gene into Ningdu yellow chicken to obtain F1 normal cock (Z)DwZdw) And dwarf hen (Z)dwW). Due to the introduction of the dw gene, individuals of the F1 generation can distinguish between males and females through the length of the shin, and meanwhile, the growth performance and the egg laying performance of the hens of the Ningdu yellow chicken breeding type are further improved by utilizing the hybrid advantages, and the feed utilization rate is improved. F1 replacement of hen andthe grown Ningdu yellow cock breeds to obtain a non-dwarf Ningdu yellow cock mating line which has the body appearance, the meat quality and the flavor similar to those of Ningdu yellow cock breeders and has better egg laying performance and feed conversion rate than those of Ningdu yellow cock breeders. The weight of the hen is 1454.8 + -118.4 g in 110 days, the length of the shin is 7.2 + -0.4 cm, and the circumference of the shin is 4.0 + -0.1 cm; egg laying number of 81.7 plus or minus 13.5 in 280 days. The weight of the 110-day cock is 1711.2 + -165.6 g, the length of the shin is 10.2 + -0.5 cm, and the circumference of the shin is 4.2 + -0.2 cm.
The above description is only for the purpose of illustrating the present invention and the appended claims are not to be construed as limiting the scope of the invention, which is intended to cover all modifications, equivalents and improvements that are within the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> institute of livestock and veterinary sciences of agricultural science institute of Jiangxi province
JIANGXI HUIDA REAL ESTATE Co.,Ltd.
<120> breeding method of non-dwarf type Ningdu yellow chicken complete set line
<140> 2021114885123
<141> 2021-12-07
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tcccagacta cacttctatt cacggggaca gatcaaagac aatac 45
<210> 2
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acctccaaag aaatctgtcg agtggccaaa tcctgaagtc ct 42
<210> 3
<211> 177
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccaagccttg tgctcatgca aactcagaat gtcattttgg tactttactg gtcacacaag 60
ccattattcg ccggtcagaa gatgtgtctt tcagtttcta tttaactttc cttatgtcag 120
tgttttgttt gttttcctcg aagtttaata aatgtattgt ctttgatctg tccccga 177
<210> 4
<211> 389
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gagaaatttt ttagggactt agagtatcga tcctgttgct ttcttatggt aactaatata 60
gaaatagaca tgaaatttaa agttttgtag aaaactttaa actatacaaa atatttggac 120
aaaaatttct gttcttcatc aaattctggt taatgataat atactttttt aaagcaaggt 180
ttcaatgacc acagtattaa gtagtatgga agtacacttt cattgaaaat ttttgaaaac 240
acatgaataa gctctggtga tttagcagca taatcttttc gtatttgacc aacttctgaa 300
gccctccatg gacaagctac cactacagtt attagacagt gacacatgaa atattgatta 360
agaaaataag gacttcagga tttggccaa 389
Claims (8)
1. A breeding method of a non-dwarf type Ningdu yellow chicken complete set line is characterized by comprising the following steps:
establishing a breeding group of pure Ningdu yellow chicken lines;
establishing a breeding group of the dwarf yellow chicken pure line;
the dwarf gene is introduced into Ningdu yellow chickens to obtain a non-dwarf Ningdu yellow chicken complete set.
2. The method for breeding a non-dwarf type Ningdu yellow chicken complete line according to claim 1, wherein the establishment of the breeding group of the Ningdu yellow chicken pure line comprises the following steps:
pure breeds of Ningdu yellow chickens are used as materials, relevant production performance data are obtained, excellent individuals are selected from the materials, core groups are established according to two selection directions of growth and propagation, and families are established.
3. A method of breeding a non-dwarf type Ningdu yellow chicken complete line as claimed in claim 2, wherein the selection of superior individuals from the non-dwarf type Ningdu yellow chicken complete line comprises the following steps:
selecting a reproductive Ningdu yellow chicken pure line as a first female parent, and selecting a growing Ningdu yellow chicken pure line as a second male parent.
4. A method of breeding a non-dwarf type Ningdu yellow chicken complex as claimed in claim 3, wherein the selecting a breeding type Ningdu yellow chicken pure line as a first female parent and a growing type Ningdu yellow chicken pure line as a second male parent comprises:
selecting a breeding Ningdu yellow chicken pure family by taking egg laying performance, uniformity and body shape as factors;
selecting pure line individuals of growing Ningdu yellow chickens according to growth speed, uniformity and body shape.
5. The method for breeding a non-dwarf Ningdu yellow chicken complete line according to claim 1, wherein the establishment of the breeding group of dwarf yellow chicken pure lines comprises the following steps:
using pure breed of dwarf yellow chicken as material, building a family and recording related production performance records, selecting reproductive performance, uniformity and body appearance, and screening individual Z of dwarf homozygous cock by phenotype and molecular detectiondwZdwAs the first male parent.
6. The method for breeding a non-dwarf Ningdu yellow chicken complete set line according to claim 1, wherein the step of introducing dwarf genes into Ningdu yellow chickens comprises the following steps:
selecting dwarf pureCombined type dwarf yellow rooster ZdwZdwBreeding bred Ningdu yellow hen ZDwW hybridization, and introducing dw gene into Ningdu yellow chicken to obtain F1 generation normal cock ZDwZdwAnd dwarf hen ZdwW; the F1 hen generation was then crossed with a growing-type Ningdu yellow chicken cock to obtain a non-dwarf Ningdu yellow chicken complete set line with a 75% bloody cut of Ningdu yellow chicken.
7. Use of a method of breeding a non-dwarf Ningdu yellow chicken complete set according to any one of claims 1 to 6 for breeding high-yield broiler chickens.
8. A kit comprising the dwarf gene and dw gene of the method for breeding a non-dwarf Ningdu yellow chicken complete set according to any one of claims 1 or 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111488512.3A CN114208766B (en) | 2021-12-07 | 2021-12-07 | Breeding method of non-dwarf Ningdu yellow chicken mating line |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111488512.3A CN114208766B (en) | 2021-12-07 | 2021-12-07 | Breeding method of non-dwarf Ningdu yellow chicken mating line |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114208766A true CN114208766A (en) | 2022-03-22 |
| CN114208766B CN114208766B (en) | 2023-07-21 |
Family
ID=80700296
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111488512.3A Active CN114208766B (en) | 2021-12-07 | 2021-12-07 | Breeding method of non-dwarf Ningdu yellow chicken mating line |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114208766B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106614266A (en) * | 2016-09-21 | 2017-05-10 | 佛山科学技术学院 | Cultivation method of new white-feather black-beak yellow-shin high-quality duck variety |
| CN109997788A (en) * | 2019-04-19 | 2019-07-12 | 广西壮族自治区畜牧研究所 | A kind of selection of dwarf-type Huang Yuhuang shin chicken |
-
2021
- 2021-12-07 CN CN202111488512.3A patent/CN114208766B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106614266A (en) * | 2016-09-21 | 2017-05-10 | 佛山科学技术学院 | Cultivation method of new white-feather black-beak yellow-shin high-quality duck variety |
| CN109997788A (en) * | 2019-04-19 | 2019-07-12 | 广西壮族自治区畜牧研究所 | A kind of selection of dwarf-type Huang Yuhuang shin chicken |
Non-Patent Citations (2)
| Title |
|---|
| 江苏特产: "矮小黄鸡", 《HTTP://WWW.WYHTC.COM/ARTICLE/5590.HTML》 * |
| 胡刚安等: "岭南黄鸡的科技优势", 《广东畜牧兽医科技》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114208766B (en) | 2023-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107494410B (en) | Method for producing dark and light shell green-shell laying hens in matched combination manner | |
| CN110367197B (en) | Hybridization matching combination research method of meat pigeons | |
| CN107667976B (en) | Method for producing seeds of male-female self-discriminating high-yield Luhua feather green-shell laying hens | |
| WO2022227692A1 (en) | Intermuscular bone-free crucian strain and cultivation method therefor | |
| CN109105338B (en) | Seed production method of red-feather white-shell laying hen complete set line | |
| CN103798169A (en) | Method for quickly establishing improved breeding system of YY super-male pelteobagrus fulvidraco | |
| CN104823919A (en) | Cultivation method and application of recessive white feather new strain of Xiaoxiang chicken in southeast of Guizhou province | |
| CN114438132A (en) | Establishment method of nile tilapia mstnb homozygous knockout line and fast-growing strain obtained by same | |
| CN108251418B (en) | SNP molecular marker related to growth speed of broiler chicken and application thereof | |
| CN111406710B (en) | Selective breeding method | |
| CN115251004B (en) | Cultivation method of green-shank yellow-feather high-quality broilers | |
| CN114208766B (en) | Breeding method of non-dwarf Ningdu yellow chicken mating line | |
| CN114271237B (en) | Method for breeding long-short velvet self-sexing pigeons | |
| CN114214432A (en) | Molecular marker for identifying melanin diffusion gene locus of chicken and application of molecular marker in assisted breeding | |
| CN111280126B (en) | Breeding method and application of yellow-feather beard laying hens | |
| CN111406712B (en) | Method for cultivating high-quality chicken with both colored feather and eggs by using babcock B380 | |
| CN111910009B (en) | Molecular marker influencing chicken bursal disease index and application thereof | |
| CN113249442B (en) | Method for screening oyster unsaturated fatty acid content-related methylation modifying gene | |
| CN111418548A (en) | Breeding method of dwarf yellow chicken strain with homozygous mutation caused by pathogen | |
| CN106701935A (en) | Fast pyramiding breeding method of high-quality broiler multi-target traits | |
| CN111705146A (en) | Molecular marker for identifying duck jute feather character and application thereof | |
| CN114645045B (en) | Primer group for breeding slow-feather homozygous yellow-foot partridge chicken and breeding method of fast yellow-foot partridge chicken suitable for slaughter | |
| CN110506706A (en) | One kind is compared with high productivity energy black meat rabbit new strain cultivation method | |
| CN111849977B (en) | Method for preparing transgenic animals by sperm vector, sgRNA for preparing short and small transgenic chickens and preparation method | |
| CN114747540B (en) | Breeding method of new strain of meat multiparous sheep suitable for grazing in alpine pasturing area |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |