CN114196774A - Marker gene for rapidly identifying fluorescence induction line of corn haploid and construction method of fluorescence induction line - Google Patents

Abstract

The invention discloses a marker gene constructed by a fluorescence induction line for rapidly identifying corn haploid, wherein a nucleic acid molecule of the marker gene is the following gene (a), gene (b) or gene (c): (a) the coding sequence is SEQ ID NO:1 and/or SEQ ID NO:2 or a genomic DNA molecule; (b) 75% or more identity to any of the nucleotide sequences defined in (a); (c) hybridizing with the nucleotide defined in (a) or (b) under strict conditions, and expressing the gene with high expression in the maize embryo and low expression or even no expression in the endosperm. In the haploid induction system constructed by the method, the excitation wavelength of fluorescence is matched with a handheld fluorescence identification system, so that the fluorescence signal can be detected at each stage of the development of the immature embryo to identify the haploid, and the haploid identification efficiency is greatly improved.

Description

Marker gene for rapidly identifying fluorescence induction line of corn haploid and construction method of fluorescence induction line

Technical Field

The invention relates to the field of biotechnology, in particular to a marker gene for constructing a haplotype high-induction-rate induction line and a construction method thereof.

Background

Corn is one of the three major food crops in the world, and is also the first major food crop in China. The core technology of maize breeding lies in the utilization of heterosis. In China, more than 97% of the sowing area of corn is used as corn hybrid. The key of corn crossbreeding is to rapidly obtain pure line parents with excellent and stable properties. In the traditional breeding process, multiple generations of recurrent selection, hybridization and selfing processes are needed to stabilize a certain excellent character so as to obtain a pure line. The breeding period of the inbred line is long, the efficiency is low, and the method cannot adapt to the fierce competitive requirement of the current breeding industrialization. In the process of breeding modern corn varieties, a transgenic technology, a molecular marker assisted selective breeding technology and a haploid breeding technology are three common methods for assisting in accelerating pure line breeding. The haploid breeding technology based on the haploid induction line has the advantages of being simple to operate, short in time consumption, capable of quickly homozygous target genes, saving manpower and material resources and the like, a DH line can be quickly obtained, and the breeding period is greatly shortened.

The maize ig gene has been mapped to the long arm of chromosome three, which encodes a LOB protein and may play a role in cell proliferation and differentiation. The abnormal period of the mutant of the gene is in the multinuclear cell period of meiosis of embryo sac, and as the nucleus in all embryo sac is not divided for the third time, additional egg cells, polar nucleus and auxiliary cells are formed, thereby generating special phenomena of multiembryo, anucleate egg cells, haploid, anorthrosis, aborted grain and the like. When the 'egg cell' is fused with one of the two sperm cells in the male parent, the sperm directly develops into an embryo because the egg cell in the embryo sac has no nucleus, and a haploid with only the male parent chromosome is formed. When the corn hybrid is used as a female parent, common corn materials are used as male parents for hybridization, and the progeny ears of the corn hybrid contain male parent haploids or female parent haploids in a certain proportion; through continuous artificial breeding selection of offspring, the induction rate of the haploid can reach 1% -2%. However, the method can produce male parent haploids and female parent haploids at the same time, so that the method is difficult to popularize in a large range in breeding work.

Nowadays, the most widely used method in corn is to induce hybrid species to produce female haploid by male inductive line. As early as 1959, scientists discovered an induction line Stock6 with an induction rate of 1% -2%. This ratio increased the ratio of 0.1% of spontaneously mutated haploids by nearly ten times. In recent years, Stock6 is used as a parent material, and an induction line with remarkably improved induction rate is bred after processes of progeny backcross, hybridization and the like. Such as WS14, RWS and CAU5, etc. The corn haploid induction line has the advantages that a homozygous diploid can be quickly obtained, and then the process of doubling a young embryo cannot be left. In early stage of young embryo, haploid cannot be identified, so all young embryos on each ear need to be stripped and cultured, and if a comparatively large DH line population is to be obtained, the workload of early stage tissue culture is huge.

However, for the existing research, many existing fluorescence induction systems need to be completed by means of a fluorescence microscope, but the use environment of the fluorescence microscope has limitations, cannot be brought to the field for use, and is high in cost. Meanwhile, some fluorescence induction systems can identify some weak colors by naked eyes due to strong fluorescence intensity. However, when such a material is hybridized with a parent material, some fluorescence intensity is influenced by the parent material, and thus the accuracy of identification is affected.

Disclosure of Invention

Therefore, the invention provides a marker gene for constructing a haplotype induction system with high induction rate and a construction method of a fluorescence induction system.

In order to achieve the above purpose, the invention provides the following technical scheme:

the embodiment of the invention provides a marker gene constructed by a fluorescence induction line for rapidly identifying corn haploid, and a nucleic acid molecule of the marker gene is the following gene (a), gene (b) or gene (c):

(a) the coding sequence is SEQ ID NO:1 and/or SEQ ID NO:2 or a genomic DNA molecule;

(b) 75% or more identity to any of the nucleotide sequences defined in (a);

(c) hybridizing with the nucleotide defined in (a) or (b) under strict conditions, and expressing the gene in the corn embryo in a high amount, and expressing the gene in the endosperm in a low amount or even not expressing the gene.

In one embodiment of the invention, the marker gene is expressed in the nucleus, cell membrane and cytoplasm.

The embodiment of the invention also provides application of the marker gene related biomaterial in culturing a corn haploid high-induction-rate induction line, wherein the biomaterial is any one of the following (a1) to (a 4):

(a1) an expression cassette comprising the nucleic acid molecule of claim 1;

(a2) an expression cassette comprising the nucleic acid molecule of (a 1);

(a3) a recombinant vector comprising the nucleic acid molecule of (a1), or a recombinant vector comprising the expression cassette of (a 2);

(a4) a recombinant microorganism containing the nucleic acid molecule of (a1), or a recombinant microorganism containing the expression cassette of (a2), or a microorganism containing the recombinant vector of (a 3).

The invention also provides a construction method of a fluorescence induction line for rapidly identifying the corn haploid, which comprises the following steps:

constructing any marker gene of claim 1 into an overexpression vector containing a UBIQUITIN promoter and a fluorescent protein, and transforming the overexpression vector into a corn recipient plant by an agrobacterium embryo dipping method to obtain a positive corn plant containing the marker gene;

and hybridizing the positive corn plant with a corn haploid induction line CAU5, backcrossing and breeding to obtain a novel corn haploid induction line which contains corn haploid induction gene loci ZmPLA1, ZmDMP and the marker gene, contains a fluorescent label and has high induction rate.

In one embodiment of the invention, the fluorescent protein comprises a yellow fluorescent protein, a green fluorescent protein or a red fluorescent protein, which is identifiable by fluorescence microscopy or by means of fluorescence detection.

In one embodiment of the invention, the amplification primer sequence of the marker gene Zm0001demb1 is shown as SEQ ID NO: 3 and SEQ ID NO: 4 is shown in the specification;

the sequence of the amplification primer of the marker gene Zm0001demb4 is shown as SEQ ID NO: 5 and SEQ ID NO: and 6.

The invention has the following advantages:

the invention discovers that the immature embryos of Zm0001demb1 and Zm0001demb4 gene overexpression strains are remarkably enlarged, the two genes are respectively connected with fluorescent protein and then are subjected to transformation experiments, the obtained transgenic plants and an induction line are hybridized and then selected, and after a stable haploid induction line containing fluorescence is obtained, the immature embryos can be stripped and simultaneously subjected to fluorescence screening, diploid embryos are directly eliminated, the method is calculated according to the induction rate of 10% of the induction line, the manpower, material resources and financial resources can be saved by 90%, and the breeding work can be efficiently completed.

The excitation wavelength of the fluorescent protein contained in the constructed haploid induction system is the same as that of the handheld fluorescent system, the handheld fluorescent system can be used for directly finishing the haploid screening work in the field, the work of transporting a large amount of clusters back to a seed test room for threshing and testing the seeds again is avoided, and the identification efficiency is improved.

The 2 embryo-enlarged genes transferred into the material are respectively connected with fluorescent protein, so that whether the young embryo contains fluorescence or not can be distinguished more easily when the haploid is distinguished, and the distinguishing accuracy is improved. Even aiming at the identification process of the haploid of the immature embryo, the identification process can be easily completed by utilizing a handheld fluorescence system, the method is simple and effective, and the pollution is not easily caused as the conventional method utilizing a fluorescence microscope. Improving the accuracy of haploid identification of a female parent material with a small part of grains or embryos.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It should be apparent that the drawings in the following description are merely exemplary, and that other embodiments can be derived from the drawings provided by those of ordinary skill in the art without inventive effort.

FIG. 1 is a process diagram of the construction of a novel corn haploid inducer line with high induction rate provided by the embodiment of the invention;

FIG. 2 is the data of the expression profile of MaizeGDB provided in the present invention, (A-F) to screen 6 genes specifically highly expressed in early stage immature embryos;

FIG. 3 is a diagram for predicting the subcellular localization of two genes Zm0001demb1 and Zm0001demb4 specifically and highly expressed in maize immature embryos, provided by the embodiment of the invention;

FIG. 4 is a diagram showing the result of subcellular localization of two genes Zm0001demb1 and Zm0001demb4 specifically and highly expressed in maize immature embryos, provided by the embodiment of the invention;

FIG. 5 is an agarose gel electrophoresis image of the positive plants identified by PCR provided in the embodiments of the present invention;

FIG. 6 is a graph showing the comparison of the phenotype data of the immature embryos of the over-expressed strain of Zm0001demb1 gene provided in the example of the present invention with that of the control group;

FIG. 7 shows a selected novel fluorescence-inducible line CAU5 according to an embodiment of the present invention^emb1-DSThe result is shown by comparison with the photographs of the plants of CAU 5.

Detailed Description

The present invention is described in terms of particular embodiments, other advantages and features of the invention will become apparent to those skilled in the art from the following disclosure, and it is to be understood that the described embodiments are merely exemplary of the invention and that it is not intended to limit the invention to the particular embodiments disclosed. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 screening of embryo-specific expressed Gene

With reference to fig. 1, 11 days after pollination, RNA of embryo and endosperm after pollination, which was three combinations of B73 inbred line × induction line CAU5, Mo17 inbred line × induction line CAU5, zheng 958 (hybrid of zheng 58 inbred line and C7-2 inbred line) × induction line CAU5, was extracted using a plant RNA extraction kit (beijing huayu), and the extracted RNA was sent to beijing nuo seta provenance company for banking and sequencing, each sample had three biological replicates, for a total of 18 samples.

Extraction and data analysis of RNA samples, the returned clean data was compared and analyzed by Tophap2 and Cufflinks software, and 17 genes highly expressed in the young embryo (FPKM value >100 at each repetition in the embryo) but not expressed in the endosperm (FPKM value <3 at each repetition in the endosperm) were selected.

The expression profile data of the 17 genes are analyzed and compared by using the expression profile data of the maize public database MaizeGDB, and 6 genes with high specificity and high expression in maize embryos are screened out, as shown in figure 2, and the expression profiles of the 6 genes with high expression in the embryos (derived from MaizeGDB). The expression levels of these 6 genes in three combined embryos and endosperms are shown in table 1.

TABLE 1

Example 2 subcellular localization of maize embryo-specific expressed genes

In this example, the prediction of the intracellular gene expression position was performed for 6 selected genes using intracellular localization prediction software, wherein 2 genes (Zm0001demb1 and Zm0001demb4) were expressed in cytoplasm/cell membrane/nucleus. And the expression patterns of the two genes in each tissue of the plant are that the two genes are specifically expressed only in the embryo. In this example, the protein transmembrane regions of these 2 genes were predicted by software.

As shown in FIG. 3, the results of the prediction of the subcellular localization of the genes Zm0001demb1 and Zm0001demb4 of two genes which are specifically and highly expressed in maize immature embryos, wherein, in FIG. 3, A is the result of predicting the subcellular localization of Zm0001demb1 protein on line by Deeploc-1.0; b is the result of on-line prediction of Zm0001demb4 protein subcellular localization by DeepLoc-1.0; c is the result of predicting the transmembrane region of the Zm0001demb1 protein by TMHMM 2.0; d is the result of predicting the transmembrane region of the Zm0001demb4 protein by TMHMM 2.0.

And (3) verification of a subcellular localization experiment, namely using Zm0001demb1 and Zm0001demb4 genes for the subcellular localization experiment to verify the expression position of the genes. Wherein, the nucleotide sequence of the Zm0001demb1 gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the Zm0001demb4 gene is shown as SEQ ID NO. 2. The coding region sequences (CDS) of the Zm0001demb1 and Zm0001demb4 genes from which stop codons were removed were cloned into a pCAMBIA1300-GFP plant expression vector to construct a fusion expression vector containing GFP protein.

Wherein the construction process of the fusion expression vector containing the Zm0001demb1 gene and the Zm0001demb4 gene comprises the following steps:

1) first, cloning of target genes Zm0001demb1 and Zm0001demb4 was performed, respectively, using Novozam

The Super-Fidelity DNA Polymerase was subjected to PCR amplification.

The PCR system is as follows: 2 × Phanta Master Mix: 25 mu L of the solution; dNTP Mix: 1 mu L of the solution;

Super-Fidelity DNA Polymerase: 1 mu L of the solution; F-Primer: 2 mu L of the solution; R-Primer: 2 mu L of the solution; x μ L of DNA template; ddH₂O Up to 50μL。

2) After the PCR product is purified and recovered, it is ligated to

-on a Blunt Simple cloning vector, the linker system is:

-Blunt Simple, 1 μ Ι; recovered PCR product, 4. mu.L; a total of 5. mu.L. The reaction conditions are as follows: storing at 37 deg.C for 5min, 25 deg.C for 10-25min, and 4 deg.C.

3) And transforming all the ligation products into escherichia coli competent trans5 alpha, plating, selecting bacteria, culturing, performing PCR identification and sequencing identification on corresponding bacteria liquid, and extracting plasmids and GFP empty vectors with correct sequences.

4) Enzyme digestion: the GFP empty vector was digested with an endonuclease. The reaction procedure is as follows: at 37 ℃ for 1h, 75 ℃ for 15min, and then the concentration of the recovered product was determined by gel recovery using agarose gel DNA recovery kit (TIANGEN).

5) PCR amplification is carried out by using specific primers containing homologous recombination joints and pEASY-Blunt-T-Zm0001demb1 plasmid and pEASY-Blunt-T-Zm0001demb4 plasmid as templates respectively, and product gel is recovered for subsequent connection.

6) Homologous recombination: the connection reaction system is as follows: the GFP vector recovered by enzyme digestion is 2 mu L; recovered PCR product, 3. mu.L; SoSoo Mix, 5. mu.L; a total of 10. mu.L. Reacting for 15min at 50 ℃, transforming the ligation product into escherichia coli competent trans5 alpha, performing PCR identification by using a universal primer, selecting positive clones, and sending the positive clones to a company for sequencing.

Transforming the plasmid to be detected into the onion epidermal cells or corn leaf protoplasts by a particle gun method or a PEG (polyethylene glycol) mediated method, and observing the positioning condition of the target protein in the onion epidermal cells or corn cells by using a laser confocal microscope. The subcellular localization experiments of the 2 genes were obtained, which were identical to the predicted results. As shown in FIG. 4, the subcellular localization results of two genes Zm0001demb1 and Zm0001demb4 specifically highly expressed in maize immature embryos, wherein, in the first row of A in FIG. 4: 35S: GFP is a control pCambia 1300-GFP; zm0001demb1 in the second row: GFP is a shorthand for pCambia1300-Zm0001demb 1-GFP; the third row is a photograph of the protein localization after plasmolysis experiments. Similarly, in fig. 4, the first row of B: 35S, GFP is used as a control pCambia 1300-GFP; zm0001demb4 in the second row: GFP is a shorthand for pCambia1300-Zm0001demb 1-GFP; the third row is a photograph of the protein localization after plasmolysis experiments.

Example 3 transgenic phenotypic analysis of maize embryo-specific expressed genes

In this example, the coding region sequences of Zm0001demb1 and Zm0001demb4 genes (excluding stop codons) were selected, constructed into an overexpression vector containing a UBIQUITIN promoter and a DS-red fluorescent tag, and transformed into a maize recipient strain by the Agrobacterium maceration method.

Take the construction method of Zm0001demb1 as an example. Extracting RNA of corn B73, reverse transcribing into cDNA, designing a primer according to the coding region sequence of Zm0001demb1 gene, adding XbaI enzyme cutting site in front of the left primer of Zm0001demb1, adding BamHI enzyme cutting site behind the right primer, adding protective base, PCR amplifying to obtain a target fragment, simultaneously cutting the target fragment and pCAMBIA3301 vector by XbaI and BamHI enzyme, recovering the cut fragment, connecting to the pCAMBIA3301 vector obtained by cutting XbaI and BamHI enzyme, obtaining a connection product, and transferring the connection product into escherichia coli to obtain a transformant. Screening positive clones by PCR, extracting plasmid DNA of the positive clones, sequencing the plasmids, and selecting clones containing the full length of the gene to obtain the target vector.

For transgenic plants, whether the Bar gene exists or not is firstly identified, then screening is carried out by using primers (Zm0001demb 1-primer sequence F + R) on the gene, and for single plants which can be selected by both the Bar gene and the primers on the gene, the Bar gene and the primers on the gene are combined for amplification, so that the gene is really transferred into a receptor plant.

Bar gene primer:

F:5'GCAAAGTCTGCCGCCTTACAAC 3'(SEQ ID NO：11)

R:5'TGTTATCCGCTCACAATTCCAC AC 3'(SEQ ID NO：12)

as shown in fig. 5, agarose gel electrophoresis images of PCR-identified positive plants were analyzed for phenotype of embryo and endosperm in the grain of positive plants at each stage of grain development after self-pollination of the identified positive plants. FIG. 6 is a graph showing the comparison of phenotype data of immature embryos of over-expressed strains of Zm0001demb1 and Zm0001demb4 genes with those of a control group.

Example 4 construction of maize high-inductivity fluorescence Induction line

In the grain phenotype analysis result of the over-expression strain prepared in the embodiment 3, a transgenic positive strain capable of causing corn embryo enlargement is selected, and the transgenic positive strain is hybridized with a corn haploid inducer CAU5 and backcrossed for breeding; in the breeding process, by means of molecular marker-assisted selection, gene-specific primers, a Zm0001demb 1-primer, a Zm0001demb 4-primer, a ZmPLA 1-primer and a ZmDMP-primer are utilized, and specific primer sequences are as follows:

zm0001demb 1-primer sequence:

F:CGGGCCTCCTTACTTCCGCTTG(SEQ ID NO：3)

R:AAGGAGCCCATAACTGCCGTTC(SEQ ID NO：4)

zm0001demb 4-primer sequence:

F:ATGGGACAATGGTGCTTTAA(SEQ ID NO：5)

R:CTAGTGGCACGCGACGGAGGC(SEQ ID NO：6)

ZmPLA 1-primer sequence:

F:ACGGAAGGAGTAAGAGGATGTTT(SEQ ID NO：7)

R:CGGTAGTCCTTCCCGTTCAC(SEQ ID NO：8)

ZmDMP-primer sequence:

F:CAATGCCTATGACGATGT(SEQ ID NO：9)

R:AGATGGTGGATTGAGAC(SEQ ID NO：10)

screening and reserving maize haploid induction gene loci ZmPLA1, ZmDMP and overexpression vectors of genes Zm0001demb1 or Zm0001demb4 in progeny strains; the screening process is shown in figure 1, meanwhile, in the backcross generation, the strain with the highest haploid inductivity is selected for each generation to carry out backcross, so that the novel corn haploid induction line containing the fluorescent label and having the high inductivity is finally obtained, and as shown in figure 7, the bred novel fluorescent induction line CAU5^emb1-DSCompare with photographs of plants from CAU 5.

Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Reference documents:

[1] chenshaojiang, liliang, lihaochuan, etc. corn haploid breeding technology (second edition) 2012, university of chinese agriculture press;

[2]Geiger HH.Doubled Haploids.In:Bennetzen J L,Hake S,editors. Handbook of Maize Genetics and Genomics.Springer.2009,PP.641～657；

[3] chenshaoxing river, Songlong, utilizes the pollen-direct effect of high oil content to identify corn haploid. the journal of crops, 2003,29 (4): 587-590;

[4] li Liang, research on corn haploid breeding technology and discussion on genetic and biological mechanisms of haploid induction traits: [ doctor academic thesis ]. Beijing: university of agriculture, china, 2010;

[5] lihachuan, corn female parent parthenogenesis inducibility heredity and DH line evaluation method research: [ doctor academic thesis ]. Beijing: university of agriculture, china, 2011;

[6]Harland SC.A note on a peculiar type of‘rogue’in Sea Island cotton.Agr News Barbados,1920,19:29；

[7]Blakeslee AF,Belling J,Farnham ME,et al.A haploid mutant in the Jimson weed,Datura stramonium.Science,1922,55:646～647；

[8]Kimber G,Riley R.Haploid angiosperms.Bot Rev,1963,29:480～531

[9]Chase SS.Production of homozygous diploids of maize from monoploids. Agron J,1952,44:263～267；

[10] aoguang, Zhao world, Li Guanghua, culture haploid plants from unfertilized corn ovary, proceedings of genetics, 1982,9: 282;

[11] the development of pollen and the formation of callus thereof in the process of culturing maize pollen, the research of northwest plants, 1981,1: 005;

[12]Evans MMS.The indeterminate gametophyte1 gene of maize encodes a LOB domain protein required for embryo sac and leaf development.Plant Cell, 2007,19:46～62；

[13]Kermicle JL.Andro genesis conditioned by a mutation in maize.Science, 1969,166(3911):1422-1424；

[14]Lin BY.Mega gametogenetic alterations associated with the indeterminate gametophyte mutation in maize.Revista brasileria de biologia,1981；

[15] zhaoxin molecular cytogenetic study of induction mechanism of haploid induction line of maize: [ doctor academic thesis ]. Beijing: university of agriculture, china, 2013;

[16]Kermicle JL.Indeterminate gametophyte(ig)-biology and use.In: Freeling M,Walbot V editor.The Maize Handbook,Springer-Verlag.1994,PP. 388-393；

[17]Schneerman MC,Charbonneau M,Weber DF.A survey of ig containing materials.Maize Genet News Lett,2002,74:92～93；

[18]Coe EH.A line of maize with high haploid frequency.Am Nat,1959,93: 381～382；

[19]Lashermes P,Gaillard A,Beckert M.Gynogenetic haploid plants analysis for agronomic and enzymatic markers in maize(Zea mays L.).Theor Appl Genet, 1988,76:570～572；

[20]

FK,Gordillo GA,Geiger HH.In vivo haploid induction in maize performance of new inducers and significance of doubled haploid lines in hybrid breeding.Maydica,2005,50:275～283；

[21]Xu XW,Li L,Dong X,et al.Gametophytic and zygotic selection leads to segregation distortion through in vivo induction of a maternal haploid in maize.J Exp Bot,2013,64:1083～1096；

[22]Bennett MD,Finch RA,Barclay IR.The time rate and mechanism of chromosome elimination in Hordeum hybrids.Chromosoma,1976,54:175-200；

[23]Finch RA.Tissue-specific elimination of alternative whole parental genomes in one barley hybrid.Chromosome,1983,88,386-393；

[24] genetic and biological mechanism research of female parent haploid induction traits of Xuxiawei corn: [ doctor academic thesis ]. Beijing: university of agriculture, china, 2013;

[25] wupeng Hao, research on restoration of haploid tassel fertility by biological induction of corn: [ doctor academic thesis ]. Beijing: university of agriculture, china, 2014;

[26]Nanda DK,Chase SS.An embryo marker for detecting monoploids of maize(Zea mays L.).Crop Sci,1966,6:213～215；

[27]Chase SS.Monoploids and diploids of maize:a comparison of genotypic equivalents.American Journal of Botany,1964,51:928～933；

[28] chenshaoxing river, Songlong, utilizes the pollen-direct effect of high oil content to identify corn haploid. the journal of crops, 2003,29 (4): 587-590;

[29]Li L,Xu XW,Jin WW,et al.Morphological and molecular evidences for DNA introgression in haploid induction via a high oil inducer CAUHOI in maize. Planta,2009.230:367–376；

[30]Barton JE,Maddock SE,Wu XE,et al.Doubling chromosome in haploid embryo.US Patent,2008.2016191 A1。

sequence listing

<110> Shenyang agriculture university

<120> marker gene for rapidly identifying fluorescence induction line of corn haploid and construction method of fluorescence induction line

<130> GG21952128A

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5985

<212> DNA

<213> Artificial Sequence

<400> 1

tggcctaagc caaaaaaaaa ggcacatagt gttgtgcatg aatagatggt aaagcccatg 60

cttcttagag gtatggcaca cagggcccaa agtgttgtct ctagcctggt cattgttggt 120

tatgcctggt acaaactcgt gtcataccgt gtcgtgttgg actggatgtt ctagatgagc 180

atctatagca tattaacatg tgggatctgc caggtttgtt atagctcatc gatgtgtggg 240

gtctactaaa tacactttca tagcatgtca tgtcatgtga tgtcgctcaa catctaccct 300

ctctctgtgt gtctctttgt gtgtcaggta ggatctacga tatgccagat aaggctcagc 360

tcatcgtcgc gtgaaatctg ccatgtaagc tctcattcat caacaggtaa gatttgccag 420

ataagcttcc gctcatatca cgtggtattg ctcaacatct ttcctctctc tatgtctatg 480

cttattttgg ctgccaacgg tattggcatc agtgcttaca tgcatagcgg tttttgagtt 540

ccttctttta ccatttggta tcacttaggg gctgcttggt tccagggact agaccgtttt 600

agttcgtagt ccctcaagag atgactaaaa aggactaaac catattaatt tcatcggttg 660

ccccttattc acttccatcg tagtggtaga agaatggtaa atgacatttt ggtctttcta 720

caagtcattt aatgagttct gcacacttta tcgtcggaaa caaatagtta aggactaaac 780

tttagtcatg aactaaaata accaaacaga cacatagact aaccagcagg acataaagct 840

tttctttgaa ttaaacaaga gttccttatg cgcaggcaca atagaggacc agacagatat 900

aattgtacta gtgttgtata gatatccatg agctaccaca cgtcgagaac tcgtgtagga 960

gcatacaaag aggaaggaag aggaaaacaa aagggtgagc atagctgtca ccccatccaa 1020

accgtccccc tccagcgcaa acccacctga tcatcagatt cctcctctcc aacgatcatt 1080

aaggccacct tgatcacagc gtggttttat atagaagtgg gctggctgga ccgtttccaa 1140

aactaagagc gagcgcacgg cacggcggcg tgccgcggcg caggcacaac agcagctccc 1200

tccgcgctcc gccctccctg ctcgcaagac caacaccacc agcagcagca gcagcaccgc 1260

gccaacgagg cttccctccg gtgtgtgtgt gcgcgcgcgc tcgtgatggc agcagccccg 1320

gcggcgtcgt cgtccacgtc ggggtcgccg gccgccggcg ggccgcggtc gcggttcggc 1380

gacacgacgc tgacgaaggt gttcgtgggc gggctggcgt gggagacgcc ctcggagggg 1440

ctccggcaac acttcgagcg gtacggcgac atcctggagg ccgtcgtcat cacggaccgc 1500

ctcaccggcc gctccaaggg ctacggattc gtaagccgcc gcaccgggcc tccttacttc 1560

cgcttggcgc gcgcgcgcgc gtgcacgtct ctgagcctga ccgaggtggc cggccggccg 1620

tcgtgtgtgc gtgcgcaggt gacgttccgg gagccggagg cggcgcggcg cgcggtgcag 1680

gacccgaacc cgacgatcgc cgggcggcgc gccaactgca acattgcgtc gctggggccg 1740

ccgcgcccca cccagcctgg aggtgagtga caaactggca gtcacaagga atccatgaag 1800

tgaaaacgtt aatctatttt tttttttttt gccgcctcca catcccacat cccgtccccg 1860

gcgctcatca tgggcaacgc gacaacccgc gcaaggattc cagattggct accgccgcct 1920

ttcgctctcc cttccgctag cacgagcggt ggccggccgg gagccgggag gtagccgacg 1980

caaggcaagg gggtggcatg acgggtgggg gggaaggaag gaccgcgcgg gtaaagcaag 2040

ctacacgctg gctgaagctg agaaaagtca taggggagtg tgagcttgcc caggctggcc 2100

tgtcagttca accgggttcg tgccggagag ccccactccg ggtgggcgct cgtatcctcc 2160

cgacggatcg ccattttttt ttctatcgcc gcagaccaac tggcagttag aacggcagtt 2220

atgggctcct tggatcggcg gcaggggggg tacttgccgc gatttctttt cgaattcttt 2280

cggtagctcg tttattagta atataatcgg taggaggagc tctcgctttg actggacgcc 2340

tagtcgaggc cggtggcgcg cgcggccagt tcacccccgt ccgttgccag cgagaacaag 2400

gtgtaaaaag tagaggccgt ggccatggac ggcgggcaca cggccagggt ggcgggcggc 2460

gatctagtat agtggtgtag tggcggcgtg gggagaatcg agaacgaacg atcttttctc 2520

ctctggtcgc agtggatata atagagagag agaatactcg accgctccgc aagtttgcgc 2580

cctttttttt tgaccaccga tctggggatc agcagcttgc ctggcgaccg agagcgttga 2640

tcccacggtg tccggtgtcc ctccctgacc aactaattta ctgttgctcc gtagcaccac 2700

cgccgcgccc acgcatgctt gtctgcgttg cttggcgttg caggcttgcc aacaacctac 2760

cagtagaagc gaagccatgg cacggacaga ggtagtacac gcctgttggc actttggcag 2820

tactaagaat ggcgcggtgc tttttacagt gctgccgctg ccgctgcctg taggttttgt 2880

agccttggct tgtttgctgg cgagaactga aaaggaacga gcgcgaaaac agcgaagact 2940

agcgccaggc cggccggccg gccggcgaac cgacaccgtc ccagtcggtc ccagtactca 3000

aagcagcgtc gcgcgcgcac accacgtgcg cagcgcagac gcgaaacagc agcgcagcgg 3060

cggctgtgtc ggtcttgccc gcgctcatgc cccccaaaat cctctgcgcg ctctccgatc 3120

cgtccgcgga cgcgcagctc tggttttgtt ttggcgccgt cgttgcttgc ttcccgtttc 3180

gctagctctg cagccaatga catggcaggt aattgttgtt tgcagttgca ggcaggggtg 3240

gtccctacac cgtgggaccc caccacttgc aggtcccgca gttcgttccc agggcgccgg 3300

cctctcctct ccagatgatg gtgccccagc agcagcagca gcacggtggt gccccagcag 3360

ctgctatcta cccgtctcct cagtttgggt tagtgccctg tgccatctct gtgtgtgtgt 3420

atatacattt tcttcgcttg cattgcgcgt gccaaaaaaa ttaaaaaaaa aactgtctcc 3480

aaattgctcg gattcgtcgt acagatacgg gtacaggtga tggtggtaga ccatcggaag 3540

tacttatgtg tgtactgtgt agtagtagtg ttttatttca gctgagctct taaaagccat 3600

tcttgtttta caagtccgtg cgagttacgt tcagttcgga cgttggtcgc agtcgagctc 3660

tggtcgtcat cgtcgtcgca gtcgtccata catgatgtag cccatgcaaa tggtggcgac 3720

acggcatccg ctaggcattc aacactgaat ccctagatat ataaagagct cggtccccca 3780

ctcccaccac ccaaaacaca cacacacaga cccattgttg tgctagagta ctagtaggtc 3840

tctttcgcca tggcagcact ctctgctgct tattggcgcg ctgcagggtt caatgtctgc 3900

tgtgcataag aagcattaac gcgtgcatcg tgctagctat aatgcctgct tccttattac 3960

ttgtttcctt ccaaactgga ttgcttttcg tcgaaaatgc agtttgtagc tcatgatcgc 4020

attattttct atatcatcct tttacaacaa gttgcatggg aaggagtgct ggtaactgtt 4080

ttgtctgaac tgaaggaact ggggggttgt ggttaccctt tttattatta ttattgcgtg 4140

tgctgtctaa aaaatctctc agtcaaaact gaagaagctc cacaaacttt ttgcaggtac 4200

tgctggtacc cgccggactt tcaataccaa caggtaagca tgcatgctcc ctccccccac 4260

acaccccatc cttcaattcc cgtctccttt gctttcttct accttctcct cacatcacat 4320

gcataaccgc cggtgcacat gcctatggct accacctagc tccaccctac atgcatgcag 4380

cgatacattt cactgctacc tatttgcact gaaaacttcg actatggcaa tggcatgctc 4440

ggccgattat ctttttcatg ctgcaaaacc agatttaaca ttagcaatct gccatgttgt 4500

tgttgttgtt attgttgttg tttactcatc atgtgcgatc aactcgaggc taatttttga 4560

caacacacgc gaatgtgcga tattaatgac gaccgaacag gccctagcca gcccgcaagc 4620

gctgcagaac tactacgccc agctgtacgg tctgacgacc tcgccttcgg cggcggcggc 4680

gccctaccac caccagtacc tcggctacat ggcgccgccg cctccaacgc caaggatgat 4740

actgccacca ccaccgccgc tggcggcgca gcaggtcacc gccgtgcaac cgttggtgca 4800

gcatccgccg ccgccggcgc agcaggtcac ggtgcagcct ctgctccagc atcccccgcc 4860

acagattcat gcccctttct tcccggctcc ctcgctcccg cagcacaact tcaggctcca 4920

tccgccgccg caagctatgg cagtattgcc tcccaacaca acaggtgtgt atgttgcttg 4980

tcttctcgcc aatttgtgta ttttttggaa cgaaaggagc acaagatagt agtagcagca 5040

actgatgcct gtatttgcta ctgaactgta gcaggcggat cgctgccacc tgctgatcag 5100

gccgctgccc ctgcagctcg cgcgacaaac gcgagcagta ctcggccggg tgcgtgatcc 5160

agagaggctt caaggagaac tcaagataaa aagcatcgga ttcaccatac cttgaaatta 5220

taactgactt tttttttggg aaaaaggggg tggcgaagaa aatgaagttt cagtcgatct 5280

actatggacg aggttgaggt ttaagttact gatgatctgt aactgtaaca gtctctcatc 5340

atgttttgtc tccagaacca aacaaaagac atttcgtttt tttcttcccc ctttgtccgt 5400

cctccgattt tttaccagtt tcggcgaagc tcatcgaatc cattgtaaaa gtgaaaggta 5460

aaactgagaa aaaaaatacg actaacaata aaaatgagta caccagcaaa accgagggca 5520

tcagcttaaa aacccctcgt aaaaaactag attcttttga gacatctaag gatttttttt 5580

cccttttgaa acggacatca gaaaaaaaat ccttttgaaa tgaacatcta agctttggaa 5640

tttggatgcg tgtgcatcac atttctagaa tcggtagcta gttaaagggc cattttgctc 5700

cccccccccc cccccccccc tcaacttgtg cctaaattta gacaacatcc tcaaacttaa 5760

atatgggaca gctcaattga aaattaagaa gcaaagttta aagtttacaa agtaatctct 5820

ttttatttat ttatttattt ccttttgtaa tctggagggg cttgaaatta agaagcgaag 5880

tttaaagttt acaaacaaac agttcaaggg acgccaaaaa aacaaagaaa atggacaggc 5940

ccctactaat taaccacagc agcgtttgga tccatccatt catca 5985

<210> 2

<211> 1045

<212> DNA

<213> Artificial Sequence

<400> 2

atatataggg gctgagaagg agaggagatt ctcgtaccat gcatgtgttc aaaacggaaa 60

gtctgatctg aagccagcag acgtgaaacc gacagcacgt acgtacgtgt gagggctgag 120

ggctgctcgg cggccatggg acaatggtgc tttaagaaac gcgcagctct ggtgattatt 180

gtggccatta gctcgctgca gctgctcctg ataactgctc aagaaggtac gtacgtacat 240

tatataatgc attattgctt gcttgcttgc ttgtttattc atgcatgcac gtgtagttgg 300

cagcacgtac atacagaaag gcaagctagc taactgagca atgcaaacct tctgattgca 360

ttgcatgtcg atcagctgga ggagaccacg aggtgtggtc gtcgtcatcc tcgccggccg 420

gtggtcgtgg tggcggcgcc gtcgtcgtcc cgacggcgcg gatggggccg gacgggtcgt 480

cgacgtcgtg ttcgggggag gaggcggtgg tggtgtacca gagcagcgcc aaccctctgc 540

ccagcggcat cccggcctac accgtgcaga tcatcaacgt ctgcggcgga gggtgcaccg 600

tgtacgacgt gcacgtctcc tgcggcgact tcgcctccac ggagctcgtc gacccggcca 660

agttccagcg cgtcgccttc gacgactgcg tcgtcaaggg cggcgccgcc ttggaaccca 720

gcgagaccgt ctccttccag tactccaact ccttctccta ccagctcagt gtcgcctccg 780

tcgcgtgcca ctagagatca tcgaaccaca ggaccactac tactagatga tcatcgtcgg 840

tcgtcgttac gttgtgctgt actagtacta ctgctgttgt tatgctaact agctagttcc 900

acgtacgtta attgttcagt ctatctgcac ttctgtttaa tttctatcgt gtgtgtgtaa 960

ctatatattt ctacggtcgt cgtagttcgg catcaaactg gaagtgatca atcaagggaa 1020

aaatctctat ctctactata ttaaa 1045

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 3

cgggcctcct tacttccgct tg 22

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 4

aaggagccca taactgccgt tc 22

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

atgggacaat ggtgctttaa 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 6

ctagtggcac gcgacggagg c 21

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 7

acggaaggag taagaggatg ttt 23

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

cggtagtcct tcccgttcac 20

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 9

caatgcctat gacgatgt 18

<210> 10

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 10

agatggtgga ttgagac 17

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 11

gcaaagtctg ccgccttaca ac 22

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 12

tgttatccgc tcacaattcc acac 24

Claims (6)

1. A marker gene constructed by a fluorescence induction line for rapidly identifying a corn haploid is characterized in that a nucleic acid molecule of the marker gene is the following gene (a), gene (b) or gene (c):

(a) the coding sequence is SEQ ID NO:1 and/or SEQ ID NO:2 or a genomic DNA molecule;

(b) 75% or more identity to any of the nucleotide sequences defined in (a);

(c) hybridizing with the nucleotide defined in (a) or (b) under strict conditions, and expressing the gene in the corn embryo in a high amount, and expressing the gene in the endosperm in a low amount or even not expressing the gene.

2. The marker gene for the rapid identification of the construction of the fluorescence induction line of maize haploid as claimed in claim 1,

the marker gene is expressed in the nucleus, cell membrane and cytoplasm.

3. Use of the marker gene-related biomaterial according to claim 1 or 2 for breeding a maize haploid high induction rate inducible line, said biomaterial being any one of the following (a1) to (a 4):

(a1) an expression cassette comprising the nucleic acid molecule of claim 1;

(a2) an expression cassette comprising the nucleic acid molecule of (a 1);

(a3) a recombinant vector comprising the nucleic acid molecule of (a1), or a recombinant vector comprising the expression cassette of (a 2);

(a4) a recombinant microorganism containing the nucleic acid molecule of (a1), or a recombinant microorganism containing the expression cassette of (a2), or a microorganism containing the recombinant vector of (a 3).

4. A method for constructing a fluorescence induction line for rapidly identifying corn haploid is characterized by comprising the following steps:

constructing any marker gene of claim 1 into an overexpression vector containing a UBIQUITIN promoter and a fluorescent protein, and transforming the overexpression vector into a corn recipient plant by an agrobacterium embryo dipping method to obtain a positive corn plant containing the marker gene;

and hybridizing the positive corn plant with a corn haploid induction line CAU5, backcrossing and breeding to obtain a novel corn haploid induction line which contains corn haploid induction gene loci ZmPLA1, ZmDMP and the marker gene, contains a fluorescent label and has high induction rate.

5. The method of constructing a haploid high induction rate inducible line according to claim 4,

the fluorescent protein comprises yellow fluorescent protein, green fluorescent protein or red fluorescent protein, and the fluorescent protein can be identified by a fluorescent microscope or by means of a fluorescent detection means.

6. The method of constructing a haploid high induction rate inducible line according to claim 4,

the sequence of the amplification primer of the marker gene Zm0001demb1 is shown as SEQ ID NO: 3 and SEQ ID NO: 4 is shown in the specification;

the sequence of the amplification primer of the marker gene Zm0001demb4 is shown as SEQ ID NO: 5 and SEQ ID NO: and 6.

Images