CN114196774B - Marker gene for rapidly identifying fluorescence induction system of corn haploid and construction method of fluorescence induction system - Google Patents

Abstract

The invention discloses a marker gene constructed by a fluorescence induction system for rapidly identifying corn haploids, which has the following nucleic acid molecules: (a) the coding sequence of which is SEQ ID NO:1 and/or SEQ ID NO:2 or a genomic DNA molecule; (b) Has 75% or more identity to any one of the nucleotide sequences defined in (a); (c) Hybridizes with the nucleotide defined in (a) or (b) under stringent conditions, and either gene is expressed in high amounts in maize embryos while expressed in low or even no amounts in endosperm. In the haploid induction line constructed by the method, the excitation wavelength of fluorescence is matched with a handheld fluorescence identification system, and the fluorescence signals can be detected in each period of development of the immature embryo to identify the haploid, so that the identification efficiency of the haploid is greatly improved.

Description

Marker gene for rapidly identifying fluorescence induction system of corn haploid and construction method of fluorescence induction system

Technical Field

The invention relates to the technical field of biology, in particular to a marker gene for constructing a haploid high-inductivity induction system and a construction method.

Background

Corn is one of three large grain crops in the world, and is also the first large grain crop in china. The core technology of maize breeding lies in the exploitation of heterosis. In China, more than 97% of corn sowing area is used as corn hybrid seeds. The key point of corn cross breeding is to quickly obtain pure line parents with excellent and stable characters. In the traditional breeding process, multiple generations of recurrent selection and the processes of hybridization and selfing are needed, so that a certain excellent character can be stabilized, and a pure line is obtained. The breeding cycle of the inbred line is long, the efficiency is low, and the inbred line cannot meet the strong competition requirements of the current breeding industrialization. In the process of breeding modern maize varieties, a transgenic technology, a molecular marker assisted selection breeding technology and a haploid breeding technology are three common methods for assisting in accelerating the breeding of pure lines. The haploid breeding technology based on the haploid induction line has the advantages of being simple to operate, short in time consumption, capable of fast homozygous target genes, saving manpower and material resources and the like, and capable of fast obtaining DH lines, and the breeding period is greatly shortened.

The maize ig gene has been located on the long arm of chromosome three, which encodes a LOB protein, likely to play a role in cell proliferation and differentiation. The abnormal period of the mutant of the gene is in the polynuclear cell period of embryo sac meiosis, and because not all nuclei in embryo sacs are subjected to third division, extra egg cells, polar nuclei and auxiliary cells are formed, and further special phenomena such as multiple embryos, no egg cells nuclei, haploids, heterogenic nuclei, abortive grains and the like are generated. When the "egg cell" is fused with one of the two sperm cells in the male parent, the sperm directly develop into an embryo due to the absence of the nucleus from the egg cell in the embryo sac, thereby forming a haploid with only the male parent chromosome. When the maize is used as a female parent, common maize materials are used as male parent for hybridization, and the offspring ears contain a certain proportion of male parent haploids or female parent haploids; through continuous artificial breeding selection of offspring, the induction rate of the haploid can reach 1% -2%. However, the method can generate the male parent haploid and the female parent haploid at the same time, so that the method is difficult to popularize in a large scale in breeding work.

However, the most widely used application on corn today is the generation of maternal haploids by inducing hybrids through paternal inducer lines. As early as 1959, scientists have found an inducible Stock6 with an induction rate of 1% -2%. This ratio increases the ratio of 0.1% of spontaneous mutant haploids by nearly ten times. In recent years, stock6 is used as a parent material, and after processes such as offspring backcrossing and hybridization, an induction line with obviously improved induction rate is bred. Such as WS14, RWS, CAU5, etc. The corn haploid induction line has the advantages that a homozygous diploid can be obtained rapidly, so that the process of doubling the young embryo cannot be separated, in the current research, the tissue culture is most commonly carried out on the corn young embryo 11 days after pollination, the corn young embryo is transplanted into a field after callus formation, whether the corn haploid is haploid or not is judged through a field phenotype, and meanwhile, the DH line is obtained for production. In the early stage immature embryo, haploids cannot be identified, so that the whole immature embryo on each cluster needs to be stripped and cultured, and if a relatively large DH line group is desired, the workload of early stage tissue culture is huge.

However, for the existing researches, many existing fluorescence induction systems are needed to be completed by means of a fluorescence microscope, but the use environment of the fluorescence microscope has limitations, cannot be brought to the field for use, and has high cost. Meanwhile, some fluorescence induction systems have strong fluorescence intensity, so that weak colors can be identified by naked eyes. However, when such a material hybridizes with a parent material, some fluorescence intensity is affected by the parent material, which affects the accuracy of the identification.

Disclosure of Invention

Therefore, the invention provides a marker gene for constructing a haploid high-inductivity induction system and a construction method of a fluorescence induction system.

In order to achieve the above object, the present invention provides the following technical solutions:

the embodiment of the invention provides a marker gene constructed by a fluorescence induction system for rapidly identifying corn haploids, wherein the nucleic acid molecule of the marker gene is the gene of (a), the gene of (b) or the gene of (c):

(a) The coding sequence is SEQ ID NO:1 and/or SEQ ID NO:2 or a genomic DNA molecule;

(b) Has 75% or more identity to any one of the nucleotide sequences defined in (a);

(c) Hybridizes with the nucleotide defined in (a) or (b) under stringent conditions, and the gene is expressed in high quantity in maize embryo, while the expression quantity is low or even not in endosperm.

In one embodiment of the invention, the marker gene is expressed in the nucleus, cell membrane and cytoplasm.

The embodiment of the invention also provides application of the marker gene related biological material in cultivating a corn haploid high-induction rate induction system, wherein the biological material is any one of the following (a 1) to (a 4):

(a1) An expression cassette comprising the nucleic acid molecule of claim 1;

(a2) An expression cassette comprising said nucleic acid molecule of (a 1);

(a3) A recombinant vector comprising the nucleic acid molecule of (a 1) or a recombinant vector comprising the expression cassette of (a 2);

(a4) A recombinant microorganism comprising the nucleic acid molecule of (a 1), or a recombinant microorganism comprising the expression cassette of (a 2), or a recombinant vector of (a 3).

The invention also provides a construction method of a fluorescence induction system for rapidly identifying corn haploids, which comprises the following steps:

constructing any marker gene in claim 1 into an over-expression vector containing UBIQUITIN promoter and fluorescent protein, and transforming into a maize receptor plant by an agrobacterium-mediated embryo method to obtain a positive maize plant containing the marker gene;

and hybridizing the positive corn plants with a corn haploid induction line CAU5, backcross breeding, and obtaining a novel corn haploid induction line which contains corn haploid induction gene loci ZmPLA1 and ZmDMP and the marker genes, contains fluorescent tags and has high induction rate.

In one embodiment of the invention, the fluorescent protein comprises a yellow fluorescent protein, a green fluorescent protein or a red fluorescent protein, said fluorescent protein being identifiable by a fluorescent microscope or by means of a fluorescent detection means.

In one embodiment of the present invention, the amplification primer sequence of the marker gene Zm0001demb1 is shown in SEQ ID NO:3 and SEQ ID NO:4 is shown in the figure;

the amplification primer sequence of the marker gene Zm0001demb4 is shown as SEQ ID NO:5 and SEQ ID NO: shown at 6.

The invention has the following advantages:

the invention discovers that the young embryo of Zm0001demb1 and Zm0001demb4 gene over-expression lines are obviously enlarged, the two genes are respectively connected with fluorescent protein and then are subjected to transformation experiments, the obtained transgenic plants are hybridized with an induction line and then are selected to obtain a stable haploid induction line containing fluorescence, the young embryo can be stripped and simultaneously subjected to fluorescence screening, diploid embryo is directly eliminated, the induction rate is calculated according to 10% of the induction line, the manpower, material resources and financial resources can be saved by 90%, and the breeding work can be efficiently completed.

The excitation wavelength of fluorescent protein contained in the haploid induction system constructed by the invention is the same as the wavelength of the handheld fluorescent system, so that haploid screening work can be directly completed in the field by utilizing the handheld fluorescent system, the work of conveying a large number of clusters back to a seed test room for threshing and seed test again is avoided, and the identification efficiency is improved.

The fluorescent protein is connected with the genes with 2 embryos which are respectively transferred into the material, so that whether the young embryo contains fluorescence can be distinguished more easily when the haploid is distinguished, and the accuracy of the identification is improved. Even if the haploid identification process is aimed at the young embryo, the identification process can be easily finished by using a handheld fluorescence system, so that the method is simple and effective, and the pollution is not caused as easily as the prior method by using a fluorescence microscope. The accuracy of haploid identification of a part of female parent material with smaller grains or embryos is improved.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It will be apparent to those of ordinary skill in the art that the drawings in the following description are exemplary only and that other implementations can be obtained from the extensions of the drawings provided without inventive effort.

FIG. 1 is a diagram showing the construction process of a novel corn haploid inducer with high induction rate according to the embodiment of the invention;

FIG. 2 shows the data of the MaizeGDB expression profile provided by the example of the present invention, (A-F) is to screen out 6 genes specifically highly expressed in early young embryos;

FIG. 3 is a graph showing the prediction of the subcellular localization of two genes Zm0001 lamb 1 and Zm0001 lamb 4 specifically and highly expressed in maize immature embryos according to the present invention;

FIG. 4 is a graph showing subcellular localization results of two genes Zm0001d 1 and Zm0001d 4 specifically and highly expressed in maize immature embryos according to the embodiment of the present invention;

FIG. 5 is an agarose gel electrophoresis chart of a PCR identified positive plant provided by the embodiment of the invention;

FIG. 6 is a graph showing comparison results between the overexpression strain of Zm0001demb1 gene provided by the embodiment of the invention and the immature embryo phenotype data of the control group;

FIG. 7 shows a novel fluorescence-induced strain CAU5 for breeding according to an embodiment of the present invention ^emb1-DS Results are compared with the plant photograph of CAU 5.

Detailed Description

Other advantages and advantages of the present invention will become apparent to those skilled in the art from the following detailed description, which, by way of illustration, is to be read in connection with certain specific embodiments, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1 selection of embryo-specific expressed genes

As shown in FIG. 1, the RNA of embryo and endosperm of three combinations of B73 inbred line X inducible line CAU5, mo17 inbred line X inducible line CAU5, zhengdan 958 (hybrid of Zheng 58 inbred line and C7-2 inbred line) X inducible line CAU5 were extracted using a plant RNA extraction kit (Beijing China Vietnam) and the extracted RNA was sent to Beijing Nodeum source company for stock building sequencing, and there were three biological replicates for each sample, for a total of 18 samples.

And (3) extracting and analyzing the RNA sample, and comparing and analyzing returned clean data by using the Tophap2 and Cufflinks software, so as to screen 17 genes which are highly expressed in young embryo (FPKM value is more than 100 in each repetition in embryo) but not expressed in endosperm (FPKM value is less than 3 in each repetition in endosperm).

The 17 genes were analyzed and compared by using the expression profile data of the maize public database MaizeGDB, and 6 genes specifically and highly expressed in maize embryos were selected, as shown in fig. 2, and the expression profiles of the 6 genes highly expressed in the embryos (derived from MaizeGDB) were selected. The expression levels of these 6 genes in the three combined embryos and endosperm are shown in table 1.

TABLE 1

Example 2 subcellular localization analysis of maize embryo specific expressed genes

This example predicts the intracellular gene expression positions for the 6 genes screened using intracellular localization prediction software, with 2 genes (Zm 0001demb1 and Zm0001demb 4) being expressed in both cytoplasm/cell membrane/nucleus. And the expression pattern of the two genes in each tissue of the plant is specific expression only in embryo. The present example predicts the protein transmembrane region of these 2 genes using software.

As shown in FIG. 3, the gene subcellular localization prediction results of two genes Zm0001demb1 and Zm0001demb4 which are specifically and highly expressed in maize immature embryos, wherein in FIG. 3, A is the result of on-line prediction of the subcellular localization of the Zm0001demb1 protein by deep loc-1.0; b is the result of on-line prediction of the subcellular localization of the Zm0001demb4 protein by deep-1.0; c is TMHMM2.0 predicted transmembrane region results for Zm0001demb1 protein; d is TMHMM2.0 predicted transmembrane region results for the Zm0001demb4 protein.

Verification of subcellular localization experiments Zm0001demb1 and Zm0001demb4 genes were used to make subcellular localization experiments to verify the expression positions of the genes. Wherein the nucleotide sequence of the Zm0001 lamb 1 gene is shown in SEQ ID NO. 1, and the nucleotide sequence of the Zm0001 lamb 4 gene is shown in SEQ ID NO. 2. Coding region sequences (CDS) of the Zm0001demb1 and Zm0001demb4 genes with stop codons removed are cloned into a pCAMBIA1300-GFP plant expression vector to construct a fusion expression vector containing GFP protein.

Wherein, the construction process of the fusion expression vector containing the Zm0001demb1 gene and the Zm0001demb4 gene comprises the following steps:

1) Cloning of the target genes Zm0001demb1 and Zm0001demb4, respectively, was first performed using NorpraiseSuper-Fidelity DNA Polymerase was subjected to PCR amplification.

The PCR system is as follows: 2X Phanta Master Mix:25 μL; dNTP Mix:1 μl;Super-Fidelity DNA Polymerase:1 μl; F-Primer: 2. Mu.L; R-Primer: 2. Mu.L; x mu L of DNA template; ddH ₂ O Up to 50μL。

2) After purification and recovery of the PCR product, it was connected toOn the Blunt Simple cloning vector, the connection system is: />-Blunt Simple,1 μl; 4. Mu.L of the recovered PCR product; totaling 5. Mu.L. The reaction conditions are as follows: storing at 37deg.C, 5min, 25deg.C, 10-25min, and 4deg.C.

3) All the connection products are transformed into escherichia coli competent trans5 alpha, plated, picked up, cultured, and the corresponding bacterial liquid is subjected to PCR identification, sequencing identification, and plasmid and GFP empty vector with correct sequences are extracted.

4) And (3) enzyme cutting: the GFP empty vector was digested with endonucleases. The reaction procedure is: the concentration of the recovered product was then determined by gel recovery using an agarose gel DNA recovery kit (TIANGEN) at 37℃for 1h,75℃for 15 min.

5) PCR amplification is carried out by using specific primers containing homologous recombination joints, and pEASY-Blunt-T-Zm0001 lamb 1 plasmid and pEASY-Blunt-T-Zm0001 lamb 4 plasmid are respectively used as templates, and product glue is recovered for subsequent connection.

6) Homologous recombination: the connection reaction system is as follows: 2 mu L of the recovered GFP vector is digested; 3. Mu.L of the recovered PCR product; soSoSoo Mix, 5. Mu.L; totaling 10 μl. The reaction is carried out for 15min at 50 ℃, the connection product is transformed into escherichia coli competent trans5 alpha, PCR identification is carried out by using universal primers, and positive clones are selected and sent to company for sequencing.

The plasmid to be detected is transformed into onion epidermis cells or corn leaf protoplast by a gene gun method or a PEG mediated method, and the localization of the target protein in the onion epidermis cells or the corn cells is observed by a laser confocal microscope. The subcellular localization experiments of the 2 genes were obtained and were identical to the predicted results. As shown in FIG. 4, subcellular localization results of two genes Zm0001demb1 and Zm0001demb4 specifically highly expressed in maize immature embryos, wherein the first line of A in FIG. 4: 35S: GFP is control pCambia1300-GFP; zm0001demb1 in the second line: GFP is a shorthand for pCambia1300-Zm0001demb 1-GFP; and thirdly, carrying out a protein localization condition photo diagram after a plasma wall separation test. Similarly, in fig. 4, the first row of B: 35S GFP is control pCambia1300-GFP; zm0001demb4 in the second line: GFP is a shorthand for pCambia1300-Zm0001demb 1-GFP; and thirdly, carrying out a protein localization condition photo diagram after a plasma wall separation test.

Example 3 transgenic phenotypic analysis of maize embryo specific expressed genes

In this example, the coding region sequences of the Zm0001demb1 and Zm0001demb4 genes (with the stop codon removed) were selected, and the coding region sequences were constructed into an overexpression vector containing the UBIQUITIN promoter and the DS-red fluorescent tag, and transformed into a maize receptor line by the Agrobacterium-mediated embryo transfer method.

Take Zm0001demb1 as an example. Extracting RNA of corn B73, reversely transcribing the RNA into cDNA, designing a primer according to the sequence of a coding region of a Zm0001 lamb 1 gene, adding an XbaI enzyme cutting site before a left primer of the Zm0001 lamb 1, adding an enzyme cutting site BamHI after a right primer, adding protecting bases, performing PCR amplification to obtain a target fragment, simultaneously enzyme cutting the target fragment and a pCAMBIA3301 vector by using the XbaI and the BamHI, recovering the enzyme cutting fragment, connecting the enzyme cutting fragment to the pCAMBIA3301 vector obtained by enzyme cutting by using the XbaI and the BamHI, and transferring the obtained connecting product into escherichia coli to obtain a transformant. And (3) screening positive clones by PCR, extracting plasmid DNA of the positive clones, sequencing the plasmid, and selecting clones containing the whole length of the genes to obtain a target vector.

For transgenic plants, the Bar gene is firstly identified to be present or not, then the primers (Zm 0001 lamb 1-primer sequence F+R) on the gene are used for screening, and for single plants which can be selected for both, the Bar gene and the primers on the gene are used for combined amplification, so that the gene is ensured to be truly transferred into a receptor plant.

Primers for Bar gene:

F:5'GCAAAGTCTGCCGCCTTACAAC 3'(SEQ ID NO：11)

R:5'TGTTATCCGCTCACAATTCCAC AC 3'(SEQ ID NO：12)

as shown in FIG. 5, agarose gel electrophoresis patterns of positive plants identified by PCR are used for analyzing phenotypes of embryo and endosperm in the grains of the positive plants at various stages of grain development after the identified positive plants are self-pollinated. FIG. 6 is a graph showing the comparison of the immature phenotype data of Zm0001demb1 and Zm0001demb4 gene over-expressed lines with that of the control group.

Example 4 construction of maize high Induction fluorescence Induction System

Selecting a transgenic positive strain capable of causing the increase of corn embryo from the grain phenotype analysis result of the over-expression strain prepared in the example 3, hybridizing the transgenic positive strain with a corn haploid induction line CAU5, and backcrossing and breeding; in the breeding process, a means of molecular marker assisted selection is utilized, and a gene specific primer, a Zm0001 lamb 1-primer, a Zm0001 lamb 4-primer, a ZmPLA 1-primer and a ZmDMP-primer are utilized, wherein the specific primer sequences are as follows:

zm0001demb 1-primer sequence:

F:CGGGCCTCCTTACTTCCGCTTG(SEQ ID NO：3)

R:AAGGAGCCCATAACTGCCGTTC(SEQ ID NO：4)

zm0001demb 4-primer sequence:

F:ATGGGACAATGGTGCTTTAA(SEQ ID NO：5)

R:CTAGTGGCACGCGACGGAGGC(SEQ ID NO：6)

ZmPLA 1-primer sequence:

F:ACGGAAGGAGTAAGAGGATGTTT(SEQ ID NO：7)

R:CGGTAGTCCTTCCCGTTCAC(SEQ ID NO：8)

ZmDMP-primer sequence:

F:CAATGCCTATGACGATGT(SEQ ID NO：9)

R:AGATGGTGGATTGAGAC(SEQ ID NO：10)

screening and retaining corn haploid induction gene loci ZmPLA1, zmDMP and a gene Zm0001demb1 or Zm0001demb4 over-expression vector in a offspring strain; the screening process is shown in figure 1, and in the backcross generation, each generation selects the strain with the highest haploid induction rate for backcross, so that a novel corn haploid induction line containing fluorescent tags and having high induction rate is finally obtained, and as shown in figure 7, the novel fluorescent induction line CAU5 for breeding is finally obtained ^emb1-DS Comparison with the plant photograph of CAU 5.

While the invention has been described in detail in the foregoing general description and specific examples, it will be apparent to those skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.

Reference is made to:

[1] chen Shaojiang, li Liang, li Haochuan, et al maize haploid breeding technique (second edition). 2012, chinese university of agriculture press;

[2]Geiger HH.Doubled Haploids.In:Bennetzen J L,Hake S,editors.Handbook of Maize Genetics and Genomics.Springer.2009,PP.641～657；

[3] chen Shaojiang, song Tongming, use of high oil pollen direct effect to identify maize haploids crop theory, 2003,29 (4): 587-590;

[4] rich, corn haploid breeding technology research and genetic and biological mechanism discussion of haploid induction character: [ doctor's thesis ]. Beijing: university of china agriculture, 2010;

[5] li Haochuan, research on corn female parent parthenogenesis inducibility genetic and DH line evaluation method: [ doctor's academic paper ]. Beijing: university of china agriculture, 2011;

[6]Harland SC.A note on a peculiar type of‘rogue’in Sea Island cotton.Agr News Barbados,1920,19:29；

[7]Blakeslee AF,Belling J,Farnham ME,et al.A haploid mutant in the Jimson weed,Datura stramonium.Science,1922,55:646～647；

[8]Kimber G,Riley R.Haploid angiosperms.Bot Rev,1963,29:480～531

[9]Chase SS.Production of homozygous diploids of maize from monoploids.Agron J,1952,44:263～267；

[10] ao Guangming, zhao Shixu, li Anhua. Haploid plants were cultivated from unfertilized maize ovaries. Genetics journal, 1982,9:282;

[11] pan Jingli, fan Hui, wang Puxuan. Pollen development during maize pollen culture and callus formation. Northwest plant research, 1981,1:005;

[12]Evans MMS.The indeterminate gametophyte1 gene of maize encodes aLOB domain protein required for embryo sac and leaf development.Plant Cell,2007,19:46～62；

[13]Kermicle JL.Andro genesis conditioned by a mutation in maize.Science,1969,166(3911):1422-1424；

[14]Lin BY.Mega gametogenetic alterations associated with the indeterminate gametophyte mutation in maize.Revista brasileria de biologia,1981；

[15] zhao Xin molecular cytogenetic study of the induction mechanism of maize haploid inducer lines: [ doctor's academic paper ]. Beijing: university of china agriculture, 2013;

[16]Kermicle JL.Indeterminate gametophyte(ig)-biology and use.In:Freeling M,Walbot V editor.The Maize Handbook,Springer-Verlag.1994,PP.388-393；

[17]Schneerman MC,Charbonneau M,Weber DF.A survey of ig containing materials.Maize Genet News Lett,2002,74:92～93；

[18]Coe EH.A line of maize with high haploid frequency.Am Nat,1959,93:381～382；

[19]Lashermes P,Gaillard A,Beckert M.Gynogenetic haploid plants analysis for agronomic and enzymatic markers in maize(Zea mays L.).Theor Appl Genet,1988,76:570～572；

[20]FK,Gordillo GA,Geiger HH.In vivo haploid induction in maize performance of new inducers and significance of doubled haploid lines in hybrid breeding.Maydica,2005,50:275～283；

[21]Xu XW,Li L,Dong X,et al.Gametophytic and zygotic selection leads to segregation distortion through in vivo induction of a maternal haploid in maize.J Exp Bot,2013,64:1083～1096；

[22]Bennett MD,Finch RA,Barclay IR.The time rate and mechanism of chromosome elimination in Hordeum hybrids.Chromosoma,1976,54:175-200；

[23]Finch RA.Tissue-specific elimination of alternative whole parental genomes in one barley hybrid.Chromosome,1983,88,386-393；

[24] xu Xiao genetic and biological mechanism research of maize female parent haploid induction character: [ doctor's academic paper ]. Beijing: university of china agriculture, 2013;

[25] wu Peng, maize biological induction haploid tassel fertility restoration study: [ doctor's academic paper ]. Beijing: university of china agriculture, 2014;

[26]Nanda DK,Chase SS.An embryo marker for detecting monoploids of maize(Zea mays L.).Crop Sci,1966,6:213～215；

[27]Chase SS.Monoploids and diploids of maize:a comparison of genotypic equivalents.American Journal of Botany,1964,51:928～933；

[28] chen Shaojiang, song Tongming, use of high oil pollen direct effect to identify maize haploids crop theory, 2003,29 (4): 587-590;

[29]Li L,Xu XW,Jin WW,et al.Morphological and molecular evidences for DNA introgression in haploid induction via a high oil inducer CAUHOI in maize.Planta,2009.230:367–376；

[30]Barton JE,Maddock SE,Wu XE,et al.Doubling chromosome in haploid embryo.US Patent,2008.2016191 A1。

/>

/>

/>

/>

/>

/>

sequence listing

<110> Shenyang agricultural university

<120> marker genes for rapid identification of fluorescence-induced lines of maize haploids and methods of construction of fluorescence-induced lines

<130> GG21952128A

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5985

<212> DNA

<213> Artificial Sequence

<400> 1

tggcctaagc caaaaaaaaa ggcacatagt gttgtgcatg aatagatggt aaagcccatg 60

cttcttagag gtatggcaca cagggcccaa agtgttgtct ctagcctggt cattgttggt 120

tatgcctggt acaaactcgt gtcataccgt gtcgtgttgg actggatgtt ctagatgagc 180

atctatagca tattaacatg tgggatctgc caggtttgtt atagctcatc gatgtgtggg 240

gtctactaaa tacactttca tagcatgtca tgtcatgtga tgtcgctcaa catctaccct 300

ctctctgtgt gtctctttgt gtgtcaggta ggatctacga tatgccagat aaggctcagc 360

tcatcgtcgc gtgaaatctg ccatgtaagc tctcattcat caacaggtaa gatttgccag 420

ataagcttcc gctcatatca cgtggtattg ctcaacatct ttcctctctc tatgtctatg 480

cttattttgg ctgccaacgg tattggcatc agtgcttaca tgcatagcgg tttttgagtt 540

ccttctttta ccatttggta tcacttaggg gctgcttggt tccagggact agaccgtttt 600

agttcgtagt ccctcaagag atgactaaaa aggactaaac catattaatt tcatcggttg 660

ccccttattc acttccatcg tagtggtaga agaatggtaa atgacatttt ggtctttcta 720

caagtcattt aatgagttct gcacacttta tcgtcggaaa caaatagtta aggactaaac 780

tttagtcatg aactaaaata accaaacaga cacatagact aaccagcagg acataaagct 840

tttctttgaa ttaaacaaga gttccttatg cgcaggcaca atagaggacc agacagatat 900

aattgtacta gtgttgtata gatatccatg agctaccaca cgtcgagaac tcgtgtagga 960

gcatacaaag aggaaggaag aggaaaacaa aagggtgagc atagctgtca ccccatccaa 1020

accgtccccc tccagcgcaa acccacctga tcatcagatt cctcctctcc aacgatcatt 1080

aaggccacct tgatcacagc gtggttttat atagaagtgg gctggctgga ccgtttccaa 1140

aactaagagc gagcgcacgg cacggcggcg tgccgcggcg caggcacaac agcagctccc 1200

tccgcgctcc gccctccctg ctcgcaagac caacaccacc agcagcagca gcagcaccgc 1260

gccaacgagg cttccctccg gtgtgtgtgt gcgcgcgcgc tcgtgatggc agcagccccg 1320

gcggcgtcgt cgtccacgtc ggggtcgccg gccgccggcg ggccgcggtc gcggttcggc 1380

gacacgacgc tgacgaaggt gttcgtgggc gggctggcgt gggagacgcc ctcggagggg 1440

ctccggcaac acttcgagcg gtacggcgac atcctggagg ccgtcgtcat cacggaccgc 1500

ctcaccggcc gctccaaggg ctacggattc gtaagccgcc gcaccgggcc tccttacttc 1560

cgcttggcgc gcgcgcgcgc gtgcacgtct ctgagcctga ccgaggtggc cggccggccg 1620

tcgtgtgtgc gtgcgcaggt gacgttccgg gagccggagg cggcgcggcg cgcggtgcag 1680

gacccgaacc cgacgatcgc cgggcggcgc gccaactgca acattgcgtc gctggggccg 1740

ccgcgcccca cccagcctgg aggtgagtga caaactggca gtcacaagga atccatgaag 1800

tgaaaacgtt aatctatttt tttttttttt gccgcctcca catcccacat cccgtccccg 1860

gcgctcatca tgggcaacgc gacaacccgc gcaaggattc cagattggct accgccgcct 1920

ttcgctctcc cttccgctag cacgagcggt ggccggccgg gagccgggag gtagccgacg 1980

caaggcaagg gggtggcatg acgggtgggg gggaaggaag gaccgcgcgg gtaaagcaag 2040

ctacacgctg gctgaagctg agaaaagtca taggggagtg tgagcttgcc caggctggcc 2100

tgtcagttca accgggttcg tgccggagag ccccactccg ggtgggcgct cgtatcctcc 2160

cgacggatcg ccattttttt ttctatcgcc gcagaccaac tggcagttag aacggcagtt 2220

atgggctcct tggatcggcg gcaggggggg tacttgccgc gatttctttt cgaattcttt 2280

cggtagctcg tttattagta atataatcgg taggaggagc tctcgctttg actggacgcc 2340

tagtcgaggc cggtggcgcg cgcggccagt tcacccccgt ccgttgccag cgagaacaag 2400

gtgtaaaaag tagaggccgt ggccatggac ggcgggcaca cggccagggt ggcgggcggc 2460

gatctagtat agtggtgtag tggcggcgtg gggagaatcg agaacgaacg atcttttctc 2520

ctctggtcgc agtggatata atagagagag agaatactcg accgctccgc aagtttgcgc 2580

cctttttttt tgaccaccga tctggggatc agcagcttgc ctggcgaccg agagcgttga 2640

tcccacggtg tccggtgtcc ctccctgacc aactaattta ctgttgctcc gtagcaccac 2700

cgccgcgccc acgcatgctt gtctgcgttg cttggcgttg caggcttgcc aacaacctac 2760

cagtagaagc gaagccatgg cacggacaga ggtagtacac gcctgttggc actttggcag 2820

tactaagaat ggcgcggtgc tttttacagt gctgccgctg ccgctgcctg taggttttgt 2880

agccttggct tgtttgctgg cgagaactga aaaggaacga gcgcgaaaac agcgaagact 2940

agcgccaggc cggccggccg gccggcgaac cgacaccgtc ccagtcggtc ccagtactca 3000

aagcagcgtc gcgcgcgcac accacgtgcg cagcgcagac gcgaaacagc agcgcagcgg 3060

cggctgtgtc ggtcttgccc gcgctcatgc cccccaaaat cctctgcgcg ctctccgatc 3120

cgtccgcgga cgcgcagctc tggttttgtt ttggcgccgt cgttgcttgc ttcccgtttc 3180

gctagctctg cagccaatga catggcaggt aattgttgtt tgcagttgca ggcaggggtg 3240

gtccctacac cgtgggaccc caccacttgc aggtcccgca gttcgttccc agggcgccgg 3300

cctctcctct ccagatgatg gtgccccagc agcagcagca gcacggtggt gccccagcag 3360

ctgctatcta cccgtctcct cagtttgggt tagtgccctg tgccatctct gtgtgtgtgt 3420

atatacattt tcttcgcttg cattgcgcgt gccaaaaaaa ttaaaaaaaa aactgtctcc 3480

aaattgctcg gattcgtcgt acagatacgg gtacaggtga tggtggtaga ccatcggaag 3540

tacttatgtg tgtactgtgt agtagtagtg ttttatttca gctgagctct taaaagccat 3600

tcttgtttta caagtccgtg cgagttacgt tcagttcgga cgttggtcgc agtcgagctc 3660

tggtcgtcat cgtcgtcgca gtcgtccata catgatgtag cccatgcaaa tggtggcgac 3720

acggcatccg ctaggcattc aacactgaat ccctagatat ataaagagct cggtccccca 3780

ctcccaccac ccaaaacaca cacacacaga cccattgttg tgctagagta ctagtaggtc 3840

tctttcgcca tggcagcact ctctgctgct tattggcgcg ctgcagggtt caatgtctgc 3900

tgtgcataag aagcattaac gcgtgcatcg tgctagctat aatgcctgct tccttattac 3960

ttgtttcctt ccaaactgga ttgcttttcg tcgaaaatgc agtttgtagc tcatgatcgc 4020

attattttct atatcatcct tttacaacaa gttgcatggg aaggagtgct ggtaactgtt 4080

ttgtctgaac tgaaggaact ggggggttgt ggttaccctt tttattatta ttattgcgtg 4140

tgctgtctaa aaaatctctc agtcaaaact gaagaagctc cacaaacttt ttgcaggtac 4200

tgctggtacc cgccggactt tcaataccaa caggtaagca tgcatgctcc ctccccccac 4260

acaccccatc cttcaattcc cgtctccttt gctttcttct accttctcct cacatcacat 4320

gcataaccgc cggtgcacat gcctatggct accacctagc tccaccctac atgcatgcag 4380

cgatacattt cactgctacc tatttgcact gaaaacttcg actatggcaa tggcatgctc 4440

ggccgattat ctttttcatg ctgcaaaacc agatttaaca ttagcaatct gccatgttgt 4500

tgttgttgtt attgttgttg tttactcatc atgtgcgatc aactcgaggc taatttttga 4560

caacacacgc gaatgtgcga tattaatgac gaccgaacag gccctagcca gcccgcaagc 4620

gctgcagaac tactacgccc agctgtacgg tctgacgacc tcgccttcgg cggcggcggc 4680

gccctaccac caccagtacc tcggctacat ggcgccgccg cctccaacgc caaggatgat 4740

actgccacca ccaccgccgc tggcggcgca gcaggtcacc gccgtgcaac cgttggtgca 4800

gcatccgccg ccgccggcgc agcaggtcac ggtgcagcct ctgctccagc atcccccgcc 4860

acagattcat gcccctttct tcccggctcc ctcgctcccg cagcacaact tcaggctcca 4920

tccgccgccg caagctatgg cagtattgcc tcccaacaca acaggtgtgt atgttgcttg 4980

tcttctcgcc aatttgtgta ttttttggaa cgaaaggagc acaagatagt agtagcagca 5040

actgatgcct gtatttgcta ctgaactgta gcaggcggat cgctgccacc tgctgatcag 5100

gccgctgccc ctgcagctcg cgcgacaaac gcgagcagta ctcggccggg tgcgtgatcc 5160

agagaggctt caaggagaac tcaagataaa aagcatcgga ttcaccatac cttgaaatta 5220

taactgactt tttttttggg aaaaaggggg tggcgaagaa aatgaagttt cagtcgatct 5280

actatggacg aggttgaggt ttaagttact gatgatctgt aactgtaaca gtctctcatc 5340

atgttttgtc tccagaacca aacaaaagac atttcgtttt tttcttcccc ctttgtccgt 5400

cctccgattt tttaccagtt tcggcgaagc tcatcgaatc cattgtaaaa gtgaaaggta 5460

aaactgagaa aaaaaatacg actaacaata aaaatgagta caccagcaaa accgagggca 5520

tcagcttaaa aacccctcgt aaaaaactag attcttttga gacatctaag gatttttttt 5580

cccttttgaa acggacatca gaaaaaaaat ccttttgaaa tgaacatcta agctttggaa 5640

tttggatgcg tgtgcatcac atttctagaa tcggtagcta gttaaagggc cattttgctc 5700

cccccccccc cccccccccc tcaacttgtg cctaaattta gacaacatcc tcaaacttaa 5760

atatgggaca gctcaattga aaattaagaa gcaaagttta aagtttacaa agtaatctct 5820

ttttatttat ttatttattt ccttttgtaa tctggagggg cttgaaatta agaagcgaag 5880

tttaaagttt acaaacaaac agttcaaggg acgccaaaaa aacaaagaaa atggacaggc 5940

ccctactaat taaccacagc agcgtttgga tccatccatt catca 5985

<210> 2

<211> 1045

<212> DNA

<213> Artificial Sequence

<400> 2

atatataggg gctgagaagg agaggagatt ctcgtaccat gcatgtgttc aaaacggaaa 60

gtctgatctg aagccagcag acgtgaaacc gacagcacgt acgtacgtgt gagggctgag 120

ggctgctcgg cggccatggg acaatggtgc tttaagaaac gcgcagctct ggtgattatt 180

gtggccatta gctcgctgca gctgctcctg ataactgctc aagaaggtac gtacgtacat 240

tatataatgc attattgctt gcttgcttgc ttgtttattc atgcatgcac gtgtagttgg 300

cagcacgtac atacagaaag gcaagctagc taactgagca atgcaaacct tctgattgca 360

ttgcatgtcg atcagctgga ggagaccacg aggtgtggtc gtcgtcatcc tcgccggccg 420

gtggtcgtgg tggcggcgcc gtcgtcgtcc cgacggcgcg gatggggccg gacgggtcgt 480

cgacgtcgtg ttcgggggag gaggcggtgg tggtgtacca gagcagcgcc aaccctctgc 540

ccagcggcat cccggcctac accgtgcaga tcatcaacgt ctgcggcgga gggtgcaccg 600

tgtacgacgt gcacgtctcc tgcggcgact tcgcctccac ggagctcgtc gacccggcca 660

agttccagcg cgtcgccttc gacgactgcg tcgtcaaggg cggcgccgcc ttggaaccca 720

gcgagaccgt ctccttccag tactccaact ccttctccta ccagctcagt gtcgcctccg 780

tcgcgtgcca ctagagatca tcgaaccaca ggaccactac tactagatga tcatcgtcgg 840

tcgtcgttac gttgtgctgt actagtacta ctgctgttgt tatgctaact agctagttcc 900

acgtacgtta attgttcagt ctatctgcac ttctgtttaa tttctatcgt gtgtgtgtaa 960

ctatatattt ctacggtcgt cgtagttcgg catcaaactg gaagtgatca atcaagggaa 1020

aaatctctat ctctactata ttaaa 1045

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 3

cgggcctcct tacttccgct tg 22

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 4

aaggagccca taactgccgt tc 22

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

atgggacaat ggtgctttaa 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 6

ctagtggcac gcgacggagg c 21

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 7

acggaaggag taagaggatg ttt 23

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

cggtagtcct tcccgttcac 20

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 9

caatgcctat gacgatgt 18

<210> 10

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 10

agatggtgga ttgagac 17

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 11

gcaaagtctg ccgccttaca ac 22

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 12

tgttatccgc tcacaattcc acac 24

Claims (6)

1. A marker gene constructed by a fluorescence induction system for rapidly identifying corn haploids, which is characterized in that the nucleic acid molecule is the following (a) gene:

(a) The coding sequence is SEQ ID NO:1 or SEQ ID NO:2 or a genomic DNA molecule.

2. A marker gene constructed for rapid identification of maize haploids using fluorescence induction system as claimed in claim 1,

the marker gene is expressed in the nucleus, cell membrane and cytoplasm.

3. Use of a marker gene-related biomaterial according to claim 1 or 2 for breeding a maize haploid inducer line with high induction rate, said biomaterial being any one of the following (a 1) to (a 4):

(a1) An expression cassette comprising the nucleic acid molecule of claim 1;

(a2) An expression cassette comprising said nucleic acid molecule of (a 1);

(a3) A recombinant vector comprising the nucleic acid molecule of (a 1) or a recombinant vector comprising the expression cassette of (a 2);

(a4) A recombinant microorganism comprising the nucleic acid molecule of (a 1), or a recombinant microorganism comprising the expression cassette of (a 2), or a recombinant vector of (a 3).

4. A method for constructing a fluorescence-induced line for rapidly identifying a maize haploid, the method comprising:

constructing any marker gene in claim 1 into an over-expression vector containing UBIQUITIN promoter and fluorescent protein, and transforming into a maize receptor plant by an agrobacterium-mediated embryo method to obtain a positive maize plant containing the marker gene;

and hybridizing the positive corn plants with a corn haploid induction line CAU5, backcross breeding, and obtaining a novel corn haploid induction line which contains corn haploid induction gene loci ZmPLA1 and ZmDMP and the marker genes, contains fluorescent tags and has high induction rate.

5. The method for constructing a haploid inducer line with high induction rate according to claim 4, characterized in that,

the fluorescent protein includes yellow fluorescent protein, green fluorescent protein or red fluorescent protein, which can be recognized by a fluorescent microscope or by means of a fluorescent detection means.

6. The method for constructing a haploid inducer line with high induction rate according to claim 4, characterized in that,

as set forth in SEQ ID NO:1, and the amplification primer sequence of the marker gene is shown as SEQ ID NO:3 and SEQ ID NO:4 is shown in the figure;

as set forth in SEQ ID NO:2, the amplification primer sequence of the marker gene is shown as SEQ ID NO:5 and SEQ ID NO: shown at 6.