CN114041417B - Rapid plant breeding method - Google Patents

Abstract

The invention discloses a rapid plant breeding method. The present invention provides a method for obtaining a plant DH line, comprising: hybridizing by using haploid induction line as male parent and dominant male sterile material of heterozygous genotype, photo-thermo-sensitive male sterile material or sterile material subjected to chemical emasculation as female parent; and identifying and separating a haploid from the obtained F1 generation, doubling, and selecting a fertile doubled plant to obtain the target DH line. The rapid DH creation method provided by the invention can obviously shorten the years of pure line breeding of crops, reduce the workload, greatly reduce the workload and the cost of breeding, further improve the breeding efficiency of varieties and provide technical support for variety updating of new varieties.

Description

Rapid plant breeding method

Technical Field

The invention relates to the field of breeding, in particular to a rapid plant breeding method.

Background

Wheat, rice and the like are self-pollinating plants and also are the most important grain crops, and are widely planted all over the world. In recent years, the breeding level and variety performance of crops in China are continuously improved, and the unit yield and total yield of the crops such as wheat, rice and the like in China are continuously improved. With the continuous improvement of living conditions of people, the variety of the demands of consumers on food is continuously diversified, and the quality is further improved, so that new requirements are provided for the breeding of new varieties of selfed crops such as wheat, rice and the like at present, namely, the requirements on high yield, disease resistance and stress resistance are required, the processing quality, taste quality and nutritional quality are also continuously improved, and the root cause is the requirement for the rapid updating and updating of the new varieties. The traditional breeding method of selfing crops such as wheat or rice generally needs to undergo hybridization and multi-generation selfing, the period is long, and the consumption of manpower and material resources is huge. In recent centuries, wheat as a self-pollinating crop has no revolutionary progress in breeding technology. Therefore, a new revolutionary breeding technology is needed to improve the breeding efficiency and shorten the breeding cycle.

Haploid breeding technology is an important means for shortening the breeding cycle of crops. Compared with the continuous selfing or backcrossing method in conventional breeding, the pure line can be obtained within 1 to 2 years by using the haploid breeding technology, so that the breeding period can be shortened, and the breeding efficiency can be improved. In recent years, the research on the corn haploid breeding technology has made an important progress. The haploid induction system taking the Stock6 derived induction line as the male parent is widely applied. The haploid induction efficiency is improved to more than 10% from the initial 2%. Genetic research work on haploid induction in maize has also made significant progress in recent years. Wherein the key inducer gene ZmPLA1 in the site qhir1 that affects haploid induction efficiency has been shown to be a key gene controlling haploid induction in maize (Liu et al, 2017, kelliher et al, 2017, gilles et al, 2017. It was also found that mutations in ZmDMP also enable doubling of maize haploid induction efficiency based on ZmPLA1 (Zhong et al, 2019). Due to the homology of the corn haploid induction genes on sequences of different crops, the haploid induction system is expected to be popularized and applied in other crops. For example, the corn haploid induction system can be applied to haploid induction of crops such as wheat and rice, and effectively generates haploid grains (Liu et al, 2019, yao et al, 2018. Lays an important foundation for the construction of haploid breeding technology systems of wheat, rice and the like.

Wheat is a strict selfing pollinating crop. In the process of wheat breeding, large-scale hybridization work is difficult to perform due to the difficulty of hybridization, so the process of wheat breeding is a continuous selfing process. The use of sterile lines can make hybridization more convenient. Many sterile lines are found in species such as wheat, rice, corn and the like, but over 95 percent of the sterile lines are recessive homozygous sterile and are difficult to apply in the breeding process. The Taigu genic male sterility is a dominant male sterility line with dignifiable index in wheat, is discovered in Taigu county of Shanxi in 1972 with high loyalty, changes the problem of difficult wheat hybridization through discovery and application, and plays an important role in the processes of wheat hybridization breeding and recurrent selection. Subsequently, through genetic analysis, the Taigu genic male sterile is a dominant male sterile material controlled by a single gene. At present, taigu genic male sterile materials have been widely applied to wheat crossbreeding and recurrent selection. After decades of studies, the taigu genic male sterile gene (MS 2) was shown to be located in the short arm of chromosome 4. The insertion of the promoter region of this gene by the taigu transposon initiates the expression of the gene, resulting in an abnormal development of the male gametes and ultimately in complete male sterility (Ni et al, 2017 xia et al, 2017.

Although the Taigu genic male sterile material can be used for recurrent selection of wheat breeding, the workload of cross pollination can be greatly reduced. However, the round selection process still requires a long period. On the other hand, although a wheat induction line is created by using a gene editing method, the haploid induction efficiency can reach 10-20%, the large-scale application of haploid breeding is limited because complex operations such as glume cutting and emasculation are required to be carried out on an induction female parent.

Disclosure of Invention

In order to effectively solve the technical problems, the invention aims to provide a rapid plant hybridization induction method.

In a first aspect, the invention claims a method of obtaining a plant DH line.

The method for obtaining the plant DH line claimed by the invention can comprise the following steps:

(A) Hybridizing by taking a parthenogenesis haploid induction line of a plant as a male parent and taking a dominant male sterile material or a photo-thermo-sensitive male sterile material or a sterile material subjected to chemical emasculation treatment or a material introduced with a dominant male sterile gene and an induction excision element as a female parent to obtain an F1 generation;

(B) Identifying and separating haploid of female parent origin from F1 generation obtained by (A) hybridization;

(C) And (C) carrying out chromosome doubling on the haploid from the female parent obtained in the step (B), and selecting a fertile material from a doubled plant to obtain the DH line of the plant. The DH line does not carry male sterile genes, so the DH line can be applied to breeding.

Wherein the plant is a self-pollinating plant. The plant may be any plant satisfying the following conditions: 1) Can realize dominant sterility or chemical male killing or photo-thermo-sensitive sterility; and 2) capable of achieving haploid induction. The plant may be a monocot or a dicot.

Specifically, the plants include, but are not limited to, wheat, rice, sorghum, barley, oats, soybean, peas, mung beans, peanuts, sesame, potatoes, flax, tobacco, arabidopsis, tomatoes, oilseed rape, sunflowers, cucumbers, sweet potatoes, chinese cabbage, radishes, carrots, and the like.

When the plant is a monocotyledon, the parthenogenetic haploid inducer is a plant in which the PLA gene is silenced or suppressed or knocked out.

When the plant is a dicotyledonous plant, the parthenogenesis haploid inducer is a plant in which the DMP gene is silenced or inhibited or knocked out.

Further, when the plant is wheat; the parthenogenesis haploid inducer line can be wheat with a PLA gene silenced or inhibited or knocked out. When the plant is barley; the parthenogenesis haploid inducer is barley with a PLA gene silenced or inhibited or knocked out. When the plant is rice; the parthenogenesis haploid inducer is rice with a PLA gene silenced or inhibited or knocked out.

Further, when the plant is oilseed rape; the parthenogenesis haploid induction line is rape with a DMP gene silenced or suppressed or knocked out. When the plant is arabidopsis; the parthenogenesis haploid induction line is arabidopsis with a DMP gene silenced or inhibited or knocked out.

Still further, when the plant is wheat, the PLA gene may bebase:Sub>A PLA-base:Sub>A gene in the wheatbase:Sub>A genome and/orbase:Sub>A PLA-B gene in the wheat B genome and/orbase:Sub>A PLA-D gene in the wheat D genome. In the method, the PLA gene in the wheat genome is silenced or inhibited or knocked out, wherein the PLA gene in the wheat genome is mutated, so that the expression level of the PLA gene in the wheat genome is reduced, or the PLA gene in the wheat genome is subjected to deletion mutation, insertion mutation or base substitution.

Still further, when the plant is barley, the PLA gene may be a PLA gene in the barley genome. In the method, the PLA gene in the barley genome is silenced or inhibited or knocked out, so that the expression level of the PLA gene in the barley genome is reduced or the PLA gene in the barley genome is subjected to deletion mutation or insertion mutation or base substitution.

Further, when the plant is rice, the PLA gene may be a PLA gene in the genome of rice. In the method, the silencing or inhibiting or knocking out of the PLA gene in the rice genome is carried out on the mutant PLA gene in the rice genome, so that the expression quantity of the PLA gene in the rice genome is reduced, or the deletion mutation, the insertion mutation or the base substitution of the PLA gene in the rice genome is carried out.

Further, when the plant is oilseed rape, the DMP gene may be a DMP1A gene, a DMP2A gene and/or a DMP2C gene in the genome of oilseed rape. In the method, the DMP gene in the rape genome is silenced or inhibited or knocked out, wherein the DMP gene in the rape genome is mutated, so that the expression level of the DMP gene in the rape genome is reduced, or the DMP gene in the rape genome is subjected to deletion mutation, insertion mutation or base substitution.

Further, when the plant is arabidopsis thaliana, the DMP gene may be a DMP8 gene and/or a DMP9 gene in the genome of arabidopsis thaliana. In the method, the DMP gene in the arabidopsis genome is silenced or inhibited or knocked out, wherein the DMP gene in the arabidopsis genome is mutated, so that the expression level of the DMP gene in the arabidopsis genome is reduced, or the DMP gene in the arabidopsis genome is subjected to deletion mutation, insertion mutation or base substitution.

More specifically, the deletion mutation or insertion mutation or base substitution of the PLA gene in the wheat genome can be realized by CRISPR/Cas9 technology.

More specifically, the deletion mutation or insertion mutation or base substitution of the PLA gene in the barley genome can be realized by CRISPR/Cas9 technology.

More specifically, the deletion mutation or insertion mutation or base substitution of the PLA gene in the rice genome can be realized by CRISPR/Cas9 technology.

More specifically, the deletion mutation or insertion mutation or base substitution of the DMP gene in the rape genome can be realized by CRISPR/Cas9 technology.

More specifically, the deletion mutation or insertion mutation or base substitution of the DMP gene in the Arabidopsis genome can be realized by CRISPR/Cas9 technology.

In a first embodiment of the invention, the plant is wheat and the target sequence of CRISPR/Cas9 is SEQ ID No.6.

Wherein the sequence of the PLA-A gene in the wheat A genome is shown as SEQ ID No. 1; the sequence of the PLA-B gene in the wheat B genome is shown as SEQ ID No. 2; the sequence of the PLA-D gene in the wheat D genome is shown as SEQ ID No. 3.

The sequence of the PLA gene in the barley genome is shown as SEQ ID No. 4.

The sequence of the PLA gene in the rice genome is shown as SEQ ID No. 5.

In a second embodiment of the invention, the plant is canola, and the target sequence of CRISPR/Cas9 is SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 and/or SEQ ID No.13.

Wherein, the sequence of the DMP1A gene in the rape genome is shown as SEQ ID No.7 (the corresponding target sequences are SEQ ID No.11 and SEQ ID No. 13); the sequence of the DMP2A gene in the rape genome is shown as SEQ ID No.8 (the corresponding target sequences are SEQ ID No.10 and SEQ ID No. 12); the sequence of the DMP2C gene in the rape genome is shown as SEQ ID No.9 (the corresponding target sequences are SEQ ID No.10 and SEQ ID No. 12).

In a third specific embodiment of the invention, the plant is arabidopsis thaliana and the target sequence of CRISPR/Cas9 is SEQ ID No.18, SEQ ID No.19, SEQ ID No.20 and/or SEQ ID No.21.

Wherein, the sequence of the DMP8 gene in the arabidopsis genome is shown as SEQ ID No.16 (the corresponding target sequences are SEQ ID No.18 and SEQ ID No. 19); the sequence of the DMP9 gene in the arabidopsis genome is shown as SEQ ID No.17 (the corresponding target sequences are SEQ ID No.20 and SEQ ID No. 21).

In the step (a), the dominant male sterile gene carried in the dominant male sterile material of the heterozygous genotype as the female parent may be an MS2 gene (taigu genic male sterile gene). Correspondingly, the genotype of the dominant male sterile material of the heterozygous genotype is MS2MS2.

In the step (A), the photo-thermo-sensitive male sterile material can be a photosensitive type, a thermo-sensitive type or a photo-temperature interaction type male sterile material, and the material can show male sterility under a specific light-temperature environment. For example, the rape pol TCMS partially restores fertility at the temperature lower than 15 ℃ and is completely male sterile at the temperature higher than 20 ℃.

In the step (A), the sterile material subjected to chemical emasculation treatment is a material which is in a stamen and stamen differentiation stage in a growth stage and causes male sterility by spraying a chemical emasculation agent.

In the step (A), the introduction of the material carrying the dominant male-sterile gene and the inducing excision element leads to male sterility under the condition of expression of the dominant male-sterile gene, and the dominant male-sterile gene can be excised after chemical induction to restore fertility.

Further, in the step (a), dominant male sterile material (wheat) of heterozygous genotype as the female parent can be prepared according to a method comprising the following steps (a 1) or (a 2):

(a1) Hybridizing the Taigu genic male sterile wheat (high-stem male sterile) with the genotype of 'rhtrht, MS2MS 2' with the common wheat (high-stem fertile) with the genotype of 'rhtrht, MS2MS 2' to obtain an F1 generation (high-stem male sterile) with the genotype of 'rhtrht, MS2MS 2', which is the dominant male sterile material of the heterozygous genotype used as the female parent in the step (A).

(a2) Hybridizing dwarf-male-sterile wheat (dwarf male sterile) with the genotype of Rhtrht, MS2MS2 and common wheat (high-stalk fertile) with the genotype of Rhtrht, MS2MS2 to obtain an F1 generation (dwarf male sterile) with the genotype of Rhtrht, MS2MS2, which is the dominant male sterile material of the heterozygous genotype used as the female parent in the step (A).

Note: rht is a dominant dwarf gene, and the dwarf gene Rht in the dwarf-male-sterile wheat is closely linked with the sterile gene MS2.

Furthermore, in the step (a 1), after the taigu genic sterile wheat (high-stalk male sterile) with the genotype of 'rhtrht, MS2MS 2' and the common wheat (high-stalk fertile) with the genotype of 'rhtrht, MS2MS 2' are hybridized, the fertile plant and the sterile plant in the F1 generation (fertile plant male spike anther is normally developed and can disperse pollen; the sterile plant can not form a full anther tissue, anther abortion can not normally disperse pollen and generally shows a light green spike color) are distinguished according to the spike shape before blooming, the fertile plant is removed, and the rest sterile plant is the F1 generation (high-stalk male sterile) with the genotype of 'rhtrht, MS2MS 2'.

Furthermore, in the step (a 2), after the dwarf male sterile wheat (dwarf male sterile) with the genotype of rhtrrht, MS2MS2 and the common wheat (high-stalk fertile) with the genotype of Rhtrht, MS2MS2 are hybridized, all high-stalk plants (including high-stalk fertile) in the F1 generation are removed, and the residual dwarf plants are the F1 generation (dwarf male sterile) with the genotype of rhtrrht, MS2MS2.

In the step (A), the dominant male sterile material of the heterozygous genotype as the female parent can be a heterozygous photo-thermo-sensitive nuclear male sterile material Mmsrfrf (rape) controlled by double genes.

Note: MS is a genic male sterility gene; rf is a cytoplasmic fertility restorer gene.

Further, the photo-thermo sensitive male sterile material of the heterozygous genotype as the female parent can be prepared according to the method comprising the following steps: hybridizing the homozygous sterile material with the genotype of Mmsrfrf with the fertile material with the genotype of MsMsrfrf to obtain the F1 generation with the genotype of MsMsrfrf, wherein the F1 generation is the dominant male sterile material of the heterozygous genotype of the female parent in the step (A).

Further, in the step (a), the female parent is prepared according to a method comprising the following steps: constructing a vector which can express a sterile gene (such as Ms7 gene) and comprises a Cre/loxP recombinase and an LhGR/pOp6 chemical induction system, transferring the vector into the plant, and obtaining a positive transgenic plant which is the female parent (Arabidopsis).

Wherein, the Ms7 gene sequence is shown as SEQ ID No. 14. The gene can be expressed by a p5126 promoter, and the sequence of the p5126 promoter is shown as SEQ ID No. 15.

Further, in the step (a), the photo-thermo-sensitive male sterile material as the female parent can be prepared as follows: the light-temperature sensitive sterile material controlled by recessive gene is hybridized with the material with normal fertility, F1 shows that the material is all fertile, F1 selfing progeny generates fertility separation at low temperature in a short day, and the separation ratio of fertile plants to sterile plants is 3: the sterile plant in the selfing of the 1,F1 progeny can be used as the female parent in the step (A). After the photo-thermo-sensitive male sterile genes are introduced into a breeding group according to the steps, the breeding group can be used as a female parent for haploid induction. The photo-thermo-sensitive male sterile material as the female parent can be a wheat photo-thermo-sensitive sterile line 337S, which can show sterility at low temperature in short days and can show fertility at high temperature in long days. In a specific embodiment of the invention, the photo-thermo-sensitive male sterile material as the female parent is thermo-sensitive male sterile rape pol TCMS.

Further, in the step (a), the sterile material subjected to chemical emasculation treatment as the female parent is obtained by spraying a chemical emasculation agent. Specifically, the wheat material subjected to chemical emasculation treatment as the female parent can be obtained by spraying a chemical emasculation agent such as WL84811 on the male-female differentiation stage of wheat. The rape material as female parent after chemical emasculation treatment can be obtained by spraying chemical emasculation agent such as tribenuron-methyl after bolting rape.

In step (a), the female parent and the male parent meet at flowering time.

Further, in the step (a), when the plant is wheat, the female parent is sowed in the first 10 th of the month; the male parent is sown in stages 2-3 months next year, one stage is sown every seven days, seven stages are sown in total and distributed around the female parent material, and the florescence of the male parent and the female parent meet each other. When the plant is rape or arabidopsis, the female parent and the male parent are sown in the last 10 th month, and the male parents are distributed around the female parent material.

In the step (A), the hybridization mode can adopt the open pollination of an isolation area or the hybridization mode of single plant bagging.

In the step (B), the method for identifying a maternally derived haploid may be any of the following:

(b1) And (3) carrying out fluorescence identification on the haploid from the female parent: and (b) if the parthenogenesis haploid inducer line serving as the male parent expresses fluorescent protein and the dominant male sterile material of the heterozygous genotype serving as the female parent does not express fluorescent protein, selecting a plant without fluorescent characteristics from the F1 generation obtained by the hybridization in the step (A), namely the haploid from the female parent.

(b2) Identification of haploid by molecular marker: and (3) identifying by utilizing polymorphic molecular markers between the male parent and the female parent, and selecting a plant with a female parent banding pattern from the F1 generation obtained by the hybridization in the step (A), namely the haploid which is or is selected as a female parent source.

(b3) Flow cytometry for leaf ploidy: extracting wheat leaf cell nucleuses, carrying out flow cytometry detection, and selecting plants with cell nucleus signal peak positions half of those of hexaploid wheat cell nucleus from F1 generations obtained by hybridization in the step (A), wherein the plants are haploids from female parents; or extracting rape leaf cell nucleuses, carrying out flow cytometry detection, and selecting plants with cell nucleus signal peak positions half of those of tetraploid rape cell nucleus signals from the F1 generation obtained by the hybridization in the step (A), namely the haploid from the female parent; or extracting the cell nucleus of the arabidopsis thaliana leaf, carrying out flow cytometry detection, and selecting a plant with a cell nucleus signal peak position being half of the cell nucleus signal peak position of the diploid arabidopsis thaliana from the F1 generation obtained by the hybridization in the step (A), namely the haploid from the female parent.

In practical applications, the step (b 2) may be a preliminary identification, and the step (b 3) may be a further identification.

In the step (B), when the heterozygous dominant nucleus male sterile material is used as a female parent, two types of haploid derived from the female parent are obtained: one is haploid (genotype is 'Rht, MS 2' or 'Rht, MS 2') of female parent source carrying dominant male sterile gene; the other is a maternally derived haploid (genotype "rht, ms 2") that does not carry a dominant male sterility gene. Or when the heterozygous dominant nucleus male sterile material is used as the female parent, the obtained haploid from the female parent has two types: a haploid (genotype is "Msrf") of female parent origin carrying a dominant male sterile gene; the other is a maternally derived haploid (genotype "msrf") that does not carry a dominant male sterility gene.

In step (C), the haploid from the female parent can be subjected to colchicine treatment to achieve chromosome doubling. Chromosome doubling can of course also be achieved by other means.

In step (C), the selection of fertile material from the doubled plants is carried out according to a method which may comprise the following steps (C1) or (C2):

(c1) If the dominant male sterile material of the heterozygous genotype as the female parent in the step (A) is prepared according to the step (a 1) above, distinguishing fertile plants and sterile plants according to the ear morphology before blooming in the step (C), removing the sterile plants, and obtaining the fertile DH line as the rest.

(c2) If the dominant male sterile material of the heterozygous genotype as the female parent in step (A) is prepared according to the above step (a 2), the dwarf plants are removed (sterile) in step (C), and the remainder is the fertile DH line.

The DH line obtained by the method also belongs to the protection scope of the invention.

In a second aspect, the invention claims the use of the method as described hereinbefore in plant breeding.

In a third aspect, the invention claims a breeding method suitable for plants.

The breeding method for plants claimed in the present invention may comprise the steps (A) to (C) described above.

In a fourth aspect, the present invention claims a method of haploid induction in a plant.

A method of haploid induction in a plant as claimed by the present invention may comprise steps (A) and (B) above.

The new variety cultivated by the method also belongs to the protection scope of the invention.

In the present invention, the plant may be a self-pollinating plant. The plant may be any plant satisfying the following conditions: 1) Can realize dominant sterility or chemical male killing or photo-thermo-sensitive sterility; and 2) capable of achieving haploid induction. The plant may be a monocotyledon or a dicotyledon.

Specifically, the plants include, but are not limited to, wheat, rice, sorghum, barley, oats, soybean, peas, mung beans, peanuts, sesame, potatoes, flax, tobacco, arabidopsis, tomatoes, oilseed rape, sunflowers, and the like.

The invention firstly creates a wheat haploid parthenogenesis induction line, knocks out a wheat PLA gene by a CRISPR/Cas9 system to obtain a TaPLA wheat with haploid induction capability, wherein the TaPLA gene can be positioned in any chromosome group of wheat A, B and D, so that a single-process (TaPLA-A, taPLA-B or TaPLA-D) or double-process (TaPLA-AB, taPLA-AD or TaPLA-BD) or triple-process (TaPLA-ABD) wheat induction line is obtained. Then, the basic material for producing the wheat DH is assembled, in order to avoid the problem of large workload of later-stage wheat artificial hybridization, at least one side of parent of the basic material is required to carry dominant sterile genes, such as Ms2 genes, so as to obtain the sterile line of the target basic material. Then, a wheat haploid parthenogenesis induction line containing the tapla gene is hybridized with a heterozygous genotype male sterile line, and the hybridization mode can be carried out by open pollination in an isolation area or crossing in a single plant bag. Because the single plant carrying the heterozygous dominant male sterile gene or the photo-thermo sensitive male sterile line has the characteristic of male sterility, the complex work of castration and the like on the female parent is not needed. Hybrid F1 seeds were harvested. And then, carrying out seedling development on the obtained F1 seeds, identifying the haploid by methods such as fluorescence labeling, molecular labeling, field phenotype identification and the like, detecting the ploidy of the candidate haploid by combining flow cytometry, finally doubling the haploid by using colchicine, transplanting and selfing after seedling formation, and finally obtaining the wheat DH line. The method for creating the rapid DH can avoid a large amount of cross pollination, thereby solving the key technical problem that the cross selection of plants, particularly self-pollination crops, is difficult, obviously shortening the growth period of pure lines of the crops, reducing the workload, greatly reducing the workload and the cost of breeding, further improving the breeding efficiency of varieties and providing technical support for the update and the replacement of new varieties.

Drawings

FIG. 1 is a flow chart of wheat DH line production.

FIG. 2 is a flow cytometry method for verifying wheat haploid ploidy.

FIG. 3 is a plasmid map of the dominant sterile vector in example 3.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 Rapid Generation of wheat DH line

1. Knocking out wheat PLAs gene by using CRISPR/Cas9 system to obtain mutant and create wheat haploid induction line

A wheat A genome PLA-A gene (SEQ ID No. 1),base:Sub>A wheat B genome PLA-B gene (SEQ ID No. 2) andbase:Sub>A wheat D genome PLA-D gene (SEQ ID No. 3) are knocked out by usingbase:Sub>A CRISPR/Cas9 system so as to obtain the Triplex wheat which is simultaneously knocked out of the A genome PLA-A, the B genome PLA-B and the D genome PLA-D, and the Triplex wheat is hereinafter calledbase:Sub>A wheat haploid induction line.

The specific preparation method of the wheat haploid induction line comprises the following steps:

1. selecting target points

The knockout vector is designed into a single target, and the target sequence is as follows:

5’-GACGGTGCTGACCATCGACG-3’(SEQ ID No.6)。

the sgRNA sequence and sgRNA-encoding DNA sequences designed for the target site sequence are as follows:

sgRNA sequence of target site: 5 'guuuagcuaaauagcaaguuaaauaaaggcuagcucguuuacacuugaaaguggcaccgagcagucggugc-3';

coding DNA sequence of sgRNA: 5' gttttagaggctagaaatagctagtccgttatcaaacttgaaaaagtggcaccgagcgttggtcggtc-.

2. Construction of CRISPR/Cas9 vector

The CRISPR/Cas9 vector is obtained by inserting a DNA sequence encoding sgRNA to which a target is ligated between BsaI cleavage sites of a pBUN411 backbone (pBUN 411 is described in Xing H L, dong L, wang Z P, et al. A CRISPR/Cas9 toolkit for multiplex genome editing in plants [ J ]. BMC plant biology,2014,14 (1): 1.).

3. Obtaining transgenic wheat

The CRISPR/Cas9 vector is transferred to agrobacterium competent cells EHA105 (product of Huayuyo Biotechnology Co., ltd., available by the public) through heat shock transformation to obtain recombinant bacteria EHA105/CRISPR/Cas9. And transforming the recombinant strain EHA105/CRISPR/Cas9 into wheat receptor material young embryos by adopting an agrobacterium infection method (the recombinant agrobacterium is subjected to propagation at 28 ℃, and the wheat is infected by using the bacterial solution after propagation) and obtaining T0 generation transgenic wheat plants after screening, differentiation and rooting, wherein the cloning and sequence analysis of the wheat receptor material Fielder (described in Guodan, libayun, wheat 'Fielder' omega-alcohol soluble protein gene and promoter [ J ]. Chinese university of agriculture, 2020,25 (07): 1-9.

4. Mutant identification

Extracting T0 generation transgenic wheat plant leaf DNA, carrying out PCR amplification by using the following identification primers, carrying out Sanger sequencing on an amplification product, comparing a sequencing result with wild type wheat PLAs genes (SEQ ID No.1 to SEQ ID No. 3), and carrying out PLA mutation sequence detection by using the following primers:

primer pair for detecting PLA-A gene:

4AF：5’-GTCAAGATCTCCAGCCGAGAC-3’；

4AR：5’-GGTACTTGCCGCTGTACCT-3’。

primer pair for detecting PLA-B gene:

4BF：5’-AACTCAACATGGGGCGTCCTC-3’；

4BR：5’-ACGTCGTATGTGGAGAAGATGATG-3’。

primer pair for detecting PLA-D gene:

4DF：5’-TTCGGGTCCGGATTCTATTGTG-3’；

4DR：5’-GCAGGTACTTGCCGTTGTACC-3’。

Asbase:Sub>A result, 1 transgenic event is obtained, wherein the PLA-A genome, the PLA-B genome and the PLA-D genome of the wheat are mutated, and three specific mutation sequences are shown in the table 1.

TABLE 1 three specific mutant sequences in wheat genome

Stable mutations were formed after multiple selection generations and were called wheat haploid inducer lines.

2. Production of DH line by hybridization of wheat haploid inducing line and Taigu genic male sterile wheat

The production scheme of wheat DH line is shown in FIG. 1.

In this embodiment, the female parent material used is F1 formed by hybridization of dwarf-male-sterile wheat (Rhtrht, MS2MS 2) and economic wheat 22 (Rhtrht, MS2MS 2). The adopted male parent is the wheat haploid induction line created in the step one, and the specific operation flow is as follows:

1. planting of female parent Material

Sowing the female parent material in the first ten days of 10 months, and selecting and dressing seeds before sowing to ensure the germination rate; finely preparing soil and applying sufficient base fertilizer; sowing in consistent depth and ensuring the sufficient male parent induction line planting space; and (5) checking and supplementing seedlings in time after seedling emergence.

2. Male parent induction line planting

As the material of the male parent induction line is spring wheat, in order to ensure that the flowering phases of the male parent and the female parent meet, the male parent induction line is sowed in stages 2-3 months in the next year, sowed in one stage every seven days, sowed in seven stages in total and distributed around the material of the female parent, so as to ensure that the flowering phases of the male parent and the female parent meet.

3. Removal of parent material

Because the female parent material has fertility segregation, fertile plants need to be removed to keep sterile plants, and the conventional male sterile line material cannot form mature anthers, whether the female parent material is a sterile plant or not can be identified, the sterile plants are kept, and the fertile plants are removed through examining the size of the anthers. In F1 formed by dwarf-male-sterile wheat, the dwarf gene Rht is linked with the sterile gene MS2 to show that the dwarf is sterile and the long stalk is fertile, and the long stalk plants need to be removed and the dwarf plants need to be reserved; in F1 formed by the Taigu genic sterile wheat, fertile plants and sterile plants (fertile plants have normal anthers and can shed pollen, sterile plants cannot form full anther tissues and cannot shed pollen normally after anther abortion and have light green color in appearance) are distinguished according to ear shapes before blooming, and the fertile plants are removed. In the flowering period, the bamboo poles are used for driving the pollen, so that the male parent and the female parent can be fully hybridized.

4. Haploid identification

As the wheat haploid induction line has haploid induction capability, 10-20% of haploid can be generated in filial generation, and the rest is heterozygous hexaploid, the haploid needs to be identified, and the identification method comprises the following steps:

the flow cytometry detection of the molecular marker identified pseudohaploidy is carried out by the following specific steps: extracting cell nucleuses of young and young leaves of the pseudohaploid and the hexaploid wheat, taking the hexaploid as a contrast, setting the cell nucleus signal peak position of the pseudohaploid and the hexaploid wheat as 400 (the haploid cell nucleus signal peak position appears near 200 because the haploid nucleic acid content is half of that of the hexaploid), and if the pseudohaploid signal peak appears near 400, determining that the pseudohaploid and the hexaploid wheat are hexaploids; and if the nuclear signal peak of the plant to be detected appears near 200, the plant is considered to be a true haploid.

The flow cytometry results are shown in figure 2 and table 2.

TABLE 2 leaf ploidy detection by flow cytometry

Maternal type	Number of pseudohaploids	True haploid number	Rate of accuracy
				Abortion/general	63	62	98.41％
Dwarf-male-sterile/common	70	70	100.00％

5. Chromosome doubling

The above results confirm that the haploid plant can be doubled by using doubling reagents such as colchicine, etc., the current generation seed is harvested, and fertile materials are selected from the current generation seed, so that the homozygous DH line can be obtained (the DH line refers to the number of plants which are successfully doubled and self-fruited by the haploid). The specific operation is as follows: the tillering joint in the seedling stage is doubled, the seedling in the tillering stage is put into an aqueous solution containing 0.02 to 0.1 percent (mass percent) of colchicine, the tillering joint is soaked, the seedling is treated for 5 to 10 hours under the condition of oxygen supply mediated by an air pump, then the seedling is taken out, washed for 3 to 4 hours by running water, finally transplanted in a flowerpot, and harvested by selfing.

Wheat haploid doubling performance is shown in table 3.

TABLE 3 haploid doubling of wheat

Maternal type	Haploid seedling number	Number of dead seedlings	Number of grown seedlings	Obtaining the DH number	Doubling the efficiency
						Abortion/general	30	1	29	24	82.76％
Dwarf-male-sterile/common	41	2	39	30	76.92％

Example 2 Rapid Induction of Brassica campestris haploid

1. Knocking out rape DMP gene by using CRISPR/Cas9 system to obtain mutant and create rape haploid induction line

Knocking out rape DMP homologous genes BnDMP1A (SEQ ID No. 7), bnDMP2A (SEQ ID No. 8) and BnDMP2C (SEQ ID No. 9) by using a CRISPR/Cas9 system, and constructing a three-process material, which is hereinafter called a rape haploid induction line.

The specific preparation method of the rape haploid induction line comprises the following steps:

1. selecting target point

The target site was designed using the CRISPOR website (http:// CRISPOR. Tefor. Net /). Firstly, selecting rape as a reference genome, selecting the sequence type of PAM as NGG, and selecting a target site with high editing efficiency and low off-target probability according to the 'Doench 2016' score sorting. The three genes are designed into 4 knockout targets, and the target sequences are as follows:

(1)：5’-CACGAAAATGGAGAAAACAG-3’(SEQ ID No.10)

(2)：5’-GAGAAAACAGAGGAAAGTGT-3’(SEQ ID No.11)

(3)：5’-TGGGATCAGAGTTTACACGA-3’(SEQ ID No.12)

(4)：5’-GAACTCCTTGAGCGACCATG-3’(SEQ ID No.13)

wherein, the BnDMP1A knockout targets are (2) and (4), the BnDMP2A knockout targets are (1) and (3), and the BnDMP2C knockout targets are (1) and (3).

2. Construction of CRISPR/Cas9 vector

1) Designing a primer, wherein the structure of the primer carrying a target sequence is as follows:

T1-F：tgtggtctcaATTGNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcaag

respectively replacing 19-nt N in the primer with 19-nt target point sequences to obtain forward primers BnDMPs-T1-T4 amplified by target sites:

BnDMP-T1：tgtggtctcaATTGCACGAAAATGGAGAAAACAGgttttagagctagaaatagcaag

BnDMP-T2：tgtggtctcaATTGAGAAAACAGAGGAAAGTGTgttttagagctagaaatagcaag

BnDMP-T3：tgtggtctcaATTGTGGGATCAGAGTTTACACGAgttttagagctagaaatagcaag

BnDMP-T4：tgtggtctcaATTGAACTCCTTGAGCGACCATGgttttagagctagaaatagcaag

2) PCR amplification with plasmid pBUE411 (publicly available from Addge website, https:// www. Addge. Org/62200/; a CRISPR/Cas9 toolkit for multiplex genome editing in plants.Xing HL, dong L, wang ZP, zhang HY, han CY, liu B, wang XC, chen QJ.BMC Plant biol.2014 Nov 29;14 (1) 327.10.1186/s12870-014-0327-y PubMed 25432517) is taken as a template, and target primers BnDMPs-T1-T4 are respectively paired with a directional primer sgRNA-R (tggtggtccaAGCGTAATGCCAACTTTGTAC) for PCR amplification.

3) After purification of the 4 PCR products, the respective U6-26 promoters (described in "Zhong Y, chen B, li M, et al. A DMP-triggered in vivo signal halogenated identification system in the two type of rare Arabidopsis [ J ]. Nature Plants,2020,6 (5): 466-472." supra) were ligated to the level 1 vector (pICH 47751, pICH47761, pICH 72 and pICH 47781) backbone in the MoClo Toolkit. Wherein, the amplification product of the target 1 is cloned to pICH47751 skeleton, and is expressed by the promoter U6-26, and the obtained recombinant vector is named as pL1-F3 after being verified to be correct by sequencing. The amplification product of the target 2 is cloned to pICH47761 skeleton, and is expressed by the promoter U6-26, and the obtained recombinant vector is named as pL1-F4 after being verified to be correct by sequencing. The amplification product of the target 3 is cloned to pICH47772 skeleton, and is expressed by the promoter U6-26, and the obtained recombinant vector is named as pL1-F5 after being verified to be correct by sequencing. The amplification product of the target 4 is cloned to pICH47781 skeleton, and is expressed by the promoter U6-26, and the obtained recombinant vector is named as pL1-F6 after being verified to be correct by sequencing.

4) The tagging elements pL1-F1-FastR (described in "Zhong Y, chen B, li M, et al. A DMP-triggered in vivo matrix halogenated introduction system in the di-cotyledous Arabidopsis [ J ]. Nature Plants,2020,6 (5): 466-472." in the text.) the 35s promoter-driven gene-editing elements pL1-F2-p35s hCas9 (described in "Zhong Y, chen B, li M, et al. A DMP-triggered in vivo matrix halogenated introduction system in the di-cotyledous Arabidopsis [ J ]. Nature Plants,2020, 472, 5): pIL 1-F3, pIL 1-F4, pIL 23, pIL 2, CSL 23-pIL 23, and CSP-3 were further cloned into the vectors.

Among them, the above pICH47751, pICH47761, pICH47772, and pICH47781 and pICHCL 4723 are described in "Engler C, youles M, gruetzner R, ehnert T, werner S, jones J D G, patron N J, marilonnet S.A gold Gate structural Toolbox for Plants [ J ]. ACS Synthetic Biology,2014,3 (11): 839-843".

3. Obtaining of transgenic rape

The CRISPR/Cas9 vector is transferred to agrobacterium-competent cells GV3101 competent cells (catalog number: AC1001, product of Shanghai Weidi Biotechnology Co., ltd.) through heat shock transformation to obtain recombinant bacteria GV3101/CRISPR/Cas9. The recombinant strain GV3101/CRISPR/Cas9 is then transformed into rape receptor material Westar (described in "Silva N F, stone S L, christie L N, et al. Expression of the S receptor kinase in selected-compatible Brassica napus cv. Westar leads to the adaptive expression of selected-compatible Brassica napus polen [ J ]. Molecular genetics: MGG,2001,265 (3): 559") by Agrobacterium infection (recombinant Agrobacterium is propagated at 28 ℃ and used to infect the hypocotyl of rape), and T0-generation transgenic rape plants are obtained after screening, differentiation and rooting.

4. Mutant identification

Extracting T0 generation transgenic rape plant leaf DNA, carrying out PCR amplification by using the following identification primers, carrying out Sanger sequencing on an amplification product, comparing a sequencing result with a Westar rape gene DMP sequence (SEQ ID No. 7-SEQ ID No. 8), wherein the DMP mutation sequence detection primers are as follows:

primer pair for detecting the BnDMP1A gene:

BnDMP1A-F：5’-TGGACTACGGTTTACACGGC-3’

BnDMP1A-R：5’-GGTTTCATGAACACGGCGAG-3’

primer pair for detecting the BnDMP2A gene:

BnDMP2A-F：5’-CCACCACTGGTTAAGCGATACT-3’

BnDMP2A-R：5’-CATGCGACGTTTTCGACCTC-3’

primer pair for detecting the BnDMP2C gene:

BnDMP2C-F：5’-CCCTTAGGACTAACGAACTCGC-3’

BnDMP2C-R：5’-CACTTACCGGAATCTCTGCCTC-3’

as a result, 1 transgenic event T0-7 was obtained, wherein BnDMP1A, bnDMP2A and BnDMP2C were mutated, and three specific mutation sequences are shown in Table 4 and named as a rape haploid inducer line.

TABLE 4 three specific mutant sequences in the rape genome

Note: shaded is an inserted base.

2. Haploid production by hybridization of temperature-sensitive sterile rape and rape haploid induction line

In this embodiment, the adopted female parent material is temperature-sensitive male sterile rape Pol TCMS (described in "vertical courage of poplar, liu bangwu, saint yang. Microspore culture technology purification and breeding Pol TCMS sterile dual-purpose line [ J ]. Proceedings of chinese oil crops 2006 (02): 115-118+ 124"), and the adopted male parent is the rape haploid inducer created in the first step, and the specific operation flow is as follows:

1. planting of material

Sowing the materials in a small pot in the first ten days of 10 months, and transplanting 2-3 plants in each pot when 4-5 leaves grow.

2. Hybridization between male and female parents

Because the material is planted in a greenhouse and lacks entomophilous and wind-borne pollination, the stamen of the oil menadiol inducible line is taken and dipped on the female stamen of the female parent to complete hybridization.

3. Haploid identification

3.1 fluorescent identification

As the rape haploid induction line carries a fluorescent marker and the female parent material does not have the fluorescent marker, the seeds obtained by hybridization germinate and are divided into fluorescent seeds and non-fluorescent seeds according to whether the embryo carries fluorescence or not. And (4) sowing the non-fluorescent seeds into the plug tray, and performing next identification after seedling emergence.

3.2 molecular marker identification of haploids

As the haploid does not contain the male parent chromosome segment, the initial identification of the haploid can be realized by utilizing the polymorphism molecular marker between the male parent and the female parent, and the haploid is represented as a female parent banding pattern. The specific process is as follows: firstly, DNA of rape haploid induction line (male parent) and pol TCMS rape (female parent) leaves is extracted, a PCR amplification method is utilized to screen and obtain polymorphic molecular markers, and the molecular marker information is as follows:

A07-1 F：5’-CGGGGCCATAAAAACAGTGAAG-3’

A07-1 R：5’-GCCTTCAGCGACTTGAACATC-3’

after the non-fluorescent seeds obtained by differentiation in the fluorescence identification are germinated, the DNA of the leaves is extracted, the molecular markers are utilized to carry out PCR amplification, the products are subjected to electrophoretic identification, the sample which is shown to be consistent with the female parent banding pattern is a pseudohaploid sample, and the molecular marker identification result is shown in table 5.

TABLE 5 identification of haploids by molecular markers

With fluorescence count	Non-fluorescence number	Number of pseudohaploids
			254	11	8

3.3 flow cytometry detection of leaf ploidy

The flow cytometry detection of the molecular marker identified pseudohaploidy is carried out by the following specific steps: extracting cell nucleuses of young leaves of the pseudohaploid rape and the tetraploid rape, taking the tetraploid rape as a contrast, setting the cell nucleus signal peak position of the pseudohaploid rape and the tetraploid rape as 100 (the haploid cell nucleus signal peak position appears near 50 because the haploid nucleic acid content is half of that of the hexaploid), and if the pseudohaploid signal peak appears near 100, considering the pseudohaploid rape and the tetraploid rape as tetraploids; and if the nuclear signal peak of the plant to be detected appears near 50, the plant to be detected is considered to be a true haploid.

The flow cytometry results are shown in table 6.

TABLE 6 leaf ploidy detection by flow cytometry

Number of pseudohaploids	True haploid number	Rate of accuracy
			8	8	100％

Example 3 Rapid Induction of Arabidopsis haploid

1. Constructing a vector for expressing a sterile gene Ms7 and combining a Cre/loxP recombinase and an LhGR/pOp6 chemical induction system to create an arabidopsis female parent dominant sterile line

1. Construction of sterile vectors

The specific construction method comprises the following steps:

(1) Anther high expression promoter selection

According to the screening, a promoter p5126 highly expressed in maize anther is selected to drive the Ms7 gene, the gene sequence is shown as SEQ ID No.14, and the promoter sequence of p5126 is shown as SEQ ID No. 15.

(2) Carrier construction based on Golden Gate method

Dominant sterile vectors were constructed using the MoClo Toolkit Kit (Kit # 1000000044). A promoter p5126 sequence (SEQ ID No. 15) is obtained by amplification of a primer pair p5126F/R by using a DNA of corn B73 as a template, and is cloned into a Level0 vector pICH41295 (described in A modulation system for a standardized assembly of multigene constructs. Weber E, engler C, gruetzner R, werner S, marillonnet S.PLoS. One.2011 Feb 18 (2): e16765.Doi:10.1371/j ournal. Po. 0016765.10.1371/j ournal. Po. 0016765. P.p.Med 21338) to obtain Level0-p5126. Using the DNA of maize B73 as a template, the Ms7 gene sequence was obtained by three-stage amplification using primer pairs ZmMs7-CDS1F1/R1, zmMs7-CDS1F2/R2 and ZmMs7-CDS1F3/R3, followed by seamless Cloning to form the complete Ms7 sequence (SEQ ID No. 14) and Cloning to Level0 vector pICH41308 (described in "Engler C, youles M, gruetzner R, ehnert T, werner S, jones J D G, patron N J, marilonet S.A gold Gate modulation Cloning Toolbox for Plants [ J ]. Synthetic Biology,2014,3 (11): 839-843") to obtain Level0-ZmMs CDS1.level0-p5126 and level0-ZmMs7-CDS1 were ligated into pICH47751 (described in A modular system for standardized establishment of multigene constractions. Weber E, engler C, gruetzner R, werner S, marilonnet S.PLoS one.2011 Feb 6 (2): e16765.Doi:10.1371/j ournal. Po.0016765.10.1371/j ournal. Po.00165656721365pu 64738) by BsaI digestion to obtain male sterile gene expression elements: p5126: ms7. The primer sequences are shown in Table 7.

TABLE 7 primer sequences

The Cre gene and the LhGR/pOp6 element were synthesized by the Kingsler company. P2x35S eGFP-P2A-LhGR-Ter35S (SEQ ID No. 22) and pOp 6:Tacre-int-TerE 9 (SEQ ID No. 23) expression elements were obtained, respectively. These elements, together with the dominant male sterility gene expression element p5126 Ms7 and the arabidopsis seed fluorescence expression element: pAtOletin [ SEQ ID No.24 ] eGFP-TerOletin was cloned into level2 vector pICSL4723 (described in "Engler C, youles M, gruetzner R, ehnert T, werner S, jones J D G, patron N J, marilonet S.A gold Gate modulated Cloning Toolbox for Plants [ J ]. Synthetic Biology,2014,3 (11): 839-ACS 843) by the gold Gate method, and the final vector was obtained after the correctness of the sequencing verification, and a schematic diagram thereof is shown in FIG. 3.

2. Acquisition of dominant male sterile line of transgenic arabidopsis

The sterile vector constructed in the step 1 is transformed into agrobacterium competent cell GV3101 competent cell (catalog number: AC1001, product of Shanghai Weidi Biotechnology Limited) through heat shock transformation, and a recombinant bacterium GV3101/MS2 is obtained. And transforming the recombinant strain GV3101/MS2 into an arabidopsis receptor material Col-0 by adopting an agrobacterium dipping infection method (the recombinant agrobacterium is subjected to propagation at 28 ℃, and the arabidopsis is subjected to dipping infection by using the propagated bacterial solution), and obtaining a transgenic arabidopsis plant through GFP fluorescence screening, namely the dominant male sterile line.

2. Haploid production by hybridization of female parent dominant sterile arabidopsis and arabidopsis haploid induction line

1. Planting of material

The method comprises the following steps of (1) disinfecting arabidopsis thaliana seeds, then planting the arabidopsis thaliana seeds on a 1/2MS culture medium, and culturing in a constant-temperature illumination incubator under the culture conditions: at 22 ℃,16h of illumination/8 h of darkness and 60-70 percent of relative humidity. When four true leaves grow out, the leaves are transferred into seedling pots filled with soil, 4 plants are transplanted into one pot, and the seedlings are continuously cultured in a greenhouse.

2. Hybridization between male and female parents

As the material is planted in the greenhouse, in the absence of insect-borne and wind-borne powders, an Arabidopsis haploid DMP8DMP9 inducible line (i.e., a double gene mutant of AtDMP8 and AtDMP9, described in the literature "Zhong Y, chen B, li M, wang D, jiano Y, qi X, wang M, liu Z, chen C, wang Y, chen M, li J, xiao Z, cheng D, liu W, boutilier K, liu C, chen S.A DMP-triggered in vivo tissue amplified induced system [ J ] Nature, 2020,6 (5): 472-466.", atDMP8 gene as shown in SEQ ID No.16, pistil DMP9 gene as shown in SEQ ID No. 17) was taken and crossed into a male sterile line under dominant male-female crossing, two male stigma crossing steps were obtained.

3. Haploid identification

3.1 fluorescent identification

As the arabidopsis haploid induction line carries the RFP fluorescent marker, the parent material has no RFP fluorescent marker, a fluorescent searchlight is used for observing and screening, diploid seeds obtained by hybridization show strong fluorescence, pseudohaploid seeds show weak fluorescence, the weak fluorescence seeds are sown in a 1/2MS culture medium, and the next step of identification is carried out after seedling emergence.

3.2 molecular marker identification of haploids

As the haploid does not contain the male parent chromosome segment, the initial identification of the haploid can be realized by utilizing the polymorphism molecular marker between the male parent and the female parent, and the haploid is represented as a female parent banding pattern. The specific process is as follows: firstly, extracting leaf DNA of an arabidopsis haploid induction line (male parent) and an arabidopsis female parent dominant sterile line (female parent), and screening by using a PCR amplification method to obtain a polymorphic molecular marker, wherein the molecular marker information is as follows:

DMP8F1：5’-TGCGAAATGAGATTGGTTTTGGG-3’

DMP8R1：5’-AAACACCCTGTGACTCTCCG-3’

DMP9F1：5’-ATAACCGTCAATAACCGCCG-3’

DMP9R2：5’-CCAGTCATGCAACCAACACC-3’

after the weak fluorescent seeds obtained by differentiation in the fluorescence identification are germinated, the DNA of the leaves is extracted, the molecular markers are utilized to carry out PCR amplification, the products are subjected to electrophoretic identification, the sample which is shown to be consistent with the female parent banding pattern is a pseudohaploid sample, and the molecular marker identification result is shown in table 8.

TABLE 8 identification of haploids by molecular markers

With fluorescence count	Weak fluorescence number	Number of pseudohaploids
			479	16	14

3.3 flow cytometry detection of leaf ploidy

The flow cytometry detection of the molecular marker identified pseudohaploidy is carried out by the following specific steps: extracting cell nucleuses of the pseudohaploid and diploid arabidopsis young leaves, taking the diploid as a control, setting the cell nucleus signal peak position of the pseudohaploid and diploid arabidopsis young leaves as 100 (the haploid cell nucleus signal peak position appears near 50 because the haploid nucleic acid content is half of that of the diploid), and if the pseudohaploid signal peak appears near 100, determining the pseudohaploid and diploid arabidopsis young leaves as diploid; and if the nuclear signal peak of the plant to be detected appears near 50, the plant to be detected is considered to be a true haploid.

The flow cytometry results are shown in table 9.

TABLE 9 leaf ploidy detection by flow cytometry

Number of pseudohaploids	True haploid number	Rate of accuracy
			14	11	78.5％

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific examples, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

<110> university of agriculture in China

<120> a method for rapid breeding of plants

<130> GNCLN212912

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 2733

<212> DNA

<213> Artificial sequence

<400> 1

aaagaaaaac acaaaaaaga gaagaaagac gaaatccgat gaaaaccgga ccagtccaag 60

caacaggcag aaacaagaaa aagattccct caaaaaaaca agaaaaagaa ccaacgaaac 120

tctacagcga gctagctagc gaacgaacca aaaaaaaacc cggtcaagat ctccagccga 180

gacttcactt acgcttcgtc atgagcgata catagaatag tttgcagtga actcagcttg 240

ggccgtcttc agtttggtca gagtgaacgc gctctcgcac tgtgtgcgcc acgacataag 300

accgaccggt tccttcttct tccactgcat gtctgcatgt cttcagttaa ccacacccgc 360

aaactgttta ctgtttactg tgccctctct cactccaaaa atagaccagc gcgcgctacg 420

gcatgaacca tggcagccac tcgctcgccg ctagcaaacc caccaattac cgccatcggt 480

ctgcctaccc tctcgtgcgg cgatcgatcc cgtcttcttc ctcctgattc tcgaccgagg 540

tgtcgtacgt cggtttgcaa cgtcggctga tcgatcggac gcgtggccgc cgggtcgatg 600

atggcaagct actggtgccg gcggccctgc gagtcgtgca gcacgcgggc gatggcgggc 660

agcgtggtcg gccagccggt ggcgccgggg cagcgggtga cggtgctgac catcgacggg 720

ggcggcatcc gcggcatcat cccgggcacc atcctcgact tcctcgaggc caagctgcag 780

gagctggacg gcccgggcgc gcgcctggcc gactacttcg actgcatcgc cggcaccagc 840

accggcggcc tcatcaccgc catgatcacc gcgcccggca aggacggccg cccgctcttc 900

gccgccaggg acgtcaaccg cttctacctc gacaacgggc cctacatctt ccctcaaagg 960

cgagagcacg aacgatctca tctcatggac atggatcatg cgagctgaac tggtggttga 1020

tgtgtggatt gtgttgagct gtgccaggag gtgcgcgctc gccgcggtga ccgcatcgct 1080

gaggcggccg aggtacagcg gcaagtacct gcacggcaag atcaggagca tgctcggcga 1140

gacgaggctg tgcgacgcgc tcaccgacgt cgtcatcccc accttcgacg tcaagcttct 1200

ccagcccatc atcttctcca catacgacgt atatatgcta attttatact tggatcatgg 1260

atcagacaga catggggcta aaaacgtgat ggatcatgtg tgcgtgcgtg caggccaaga 1320

gcatgcccct gaagaacgcg cggctcgccg acatctgcat cggcacctcc gccgccccga 1380

cctacctccc cgcgcaccac ttccacaccc acgacggcaa cggcaaggag cgcgagtaca 1440

acctcatcga cggcggcgtc gccgccaaca atccggtaac caatcaagcg tctgtccgtc 1500

tgtcagatgt tcagacacgc ttgcccgacc cgatcacact gatgaactga gctgtgacaa 1560

acgcagacga tggtggcgat gacgcagatc accaagaaga tgatgggcaa ggacagggag 1620

gagctgtacc cggtgaagcc gtcggactgc ggcaagttcc tggtgatgtc cgtcggcacc 1680

ggctcgacgt ccgaccaggg gctgtacacg gcgaagcagt gctcccagtg gggcatcatc 1740

agctggctcc gcaacaaggg catggcgccc atcatcgaca tcttcatggc agccagctcc 1800

gacctcgtcg acatccacgc cgccgtgctc ttccagtcgc tgcacagcga cggcgactac 1860

ctccgcatcc aggacaactc gctccacggc ccggcggcca cggtggacgc tgccacgccc 1920

gagaacatgg cggagctcct caggatcggc gagcggatgc tggcgcagag ggtgtccagg 1980

gtgaacgtcg agaccgggag gtacgaggag gtaaaggggg ccgggagcaa cgccgacgcg 2040

ctcgccgggt tcgccaggca gctctccgac gagaggagga caaggctcga gcgccggcgt 2100

ggtggcgccg gccgtctgaa atccagacgc tgaccttgta gcttagcgtg gcttagtttc 2160

atttattttc tatataaatt tttggcgggg atagatagag aaagcttttc acatggataa 2220

tgaaaggaaa tgatgagctc aagaaaaata acaacacttt tttttgcgta gtcaagaaaa 2280

aataacaaga cttgatgaaa ccaaaatgcc tctcaattgg tcaccatggc aattgtatat 2340

ccctttcgac atcatcatca tgaataaatc aacagtgaac aagagagcaa acgaccaaca 2400

aaaatttaca caaagcctcc tacctatttc ggcaagcttc aaaataaatg aatggattgc 2460

agcatagaaa gaaaagaaaa acctgaccta tacaacagaa cactgggaac atcggttaga 2520

cgatcatcgg gactctgcct gcttgccggc ttcagtccgc ggatcatcgc aaacagtaac 2580

ttgcacaggc aaggctgcaa atgtgctcac cttacagtga ctgtatcctt gcttccactg 2640

cacaggcttg aattggccag gcactcgtgg gggttagcgt agaaataatc ctcctctttc 2700

ggcttgtttt cgagttttcg ccgacaggac ggt 2733

<210> 2

<211> 2768

<212> DNA

<213> Artificial sequence

<400> 2

ttccaccatg caaaccaatg caacctctta tgtggcatca tcaccctaca aaaaacgaga 60

taccgcatct gtaattcctt ttgcaaactt ttttaagtat aacttgagca atggacttaa 120

ttagaacctc tatctccgga agacatgcat ttctccttcc aaccagtaag tttaagaatt 180

aagatctgcc tcctaccaca gtcgatatgg gatttaagca actattcggg aaccatttgc 240

agtgaactca acatggggcg tcctcagttt ggtgagagag tggaccgcgc tctcgcactg 300

tctacgccaa gaccgaccgg ttccttcttc cactgcatgt cttcagttaa ccacacccgc 360

atctgtttac tgtaccctct ctcagtccaa aaatagacga gcgcgcgcta cggcacaagc 420

cattgcagcc actcgctcgc cgctagcaaa tccaccaatt actaccatcg atctgggtac 480

cctcttgtgc ggcgaccgat ctcgtcttct tcttcctctt gattgtcaac cgaggtgccg 540

tcagtttgca acggcggctg atcgatcaga cgcgcgcgcg cgtgcgtggc cgccgggtcg 600

atgatggcaa gctactggtg ccggcgcccc tgcgagtcgt gcagcacgag ggcgatggcg 660

ggcagcgtgg tgggccagcc ggtggctccg gggcagcggg tgacggtgct gaccatcgac 720

gggggcggca tccgcggcct catcccgggc accatcctcg ccttcctcga ggccaagctg 780

caggagctgg acgggccggg cgcgcgcctg gccgactact tcgactgcat cgccggcacc 840

agcaccggcg gcctcatcac cgccatgatc accgcgcccg gcaaggacgg ccgcccgctc 900

ttcgccgcca aggacgtcaa ccgcttctac ctcgacaacg ggccctacat cttcccgcaa 960

aggtgagagc acgaacgatc tcatctcatg gacatggatc atgcgcgctg aactggtgat 1020

tgatgtatga attgcattga gttgtgccag gaggtgcgcg ctcgccgcgg tgaccgcgtc 1080

gctgaggcgg ccgaggtaca acggcaagta cctgcacggc aagatcagga gcatgctcgg 1140

cgagacgagg ctgtgcgacg cgctcaccga cgtcgtcatc cccaccttcg acgtcaagct 1200

tctccagccc atcatcttct ccacatacga cgtatgctaa ttttatacga ggactaatgt 1260

gatgatcaga tcgatccatc cttggatcat ggatcagaca gacatggggc taaaaacgtg 1320

atggatcatg cgtgcgtcgt ccgtgcaggc caggtgcatg cccctgaaga acgcgcggct 1380

cgccgacgtc tgcatcggca cctcggccgc tccgacctgc ctccccgcgc accacttcca 1440

cacccacgac ggcaacggca aggagcgtga gtacaacctc atcgacggtg gcgtcgccgc 1500

caacaatccg gtaaccaatc aagcgtctgc ccgtcggtca gatgttcaga cacgcttgcc 1560

cgacccgagc acactgacca actgagctgt gagaaatgca gacgatggtg gcgatgacgc 1620

agatcaccaa gaagatgatg ggcaaggaca gggaggagct gtacccggtg gagccgtcgg 1680

actgcggcaa gttcctggtg ctgtccgtcg ggaccggctc gacgtccgac caggggctgt 1740

acacggcgaa gcagtgctcc cagtggggca tcatcagctg gctgcgcaac aagggcatgg 1800

cgcccatcat cgacatcttc atggcggcca gctccgacct cgtcgacatc cacgccgccg 1860

tgctcttcca gtcgctgcac agcgacgcca actacctccg catccaggac aactcgctcc 1920

acggcccggc ggccacggtg gacgccgcca cgcccgagaa catggcggag ctcctcagga 1980

tcggcgagcg gatgctggcg cagagggtgt ccagggtgaa cgtggagacc gggaggtacg 2040

aggagataaa gggggccggg agcaacgccg acgcgctcgc cggcttcgcc aggcagctct 2100

ccgacgagag gaggacaagg ctcggccgcc ggcgcggtgg cgccggccgc ctgaaatcca 2160

gccgctgatc ttgtagctta gtgtggctta gtttcattca ttttctatat acagtatatc 2220

tttttggctg ggataggtag agaaagcttc acatggataa tgacaggaaa tgaggagttc 2280

tggaaaaata acaacacttg atggaaccaa aatgtctctc aattggtcac cgtggcaatt 2340

gtatatccct tccgatatca tcatgaattt aatcaccggt gaacaatagc gcaaacgacc 2400

aacaaaaatt tacacacagc atccctactt tggctagctt gaaaataaat gaatggattg 2460

cagcatagaa agaaaaaaga aaaacctggc ctatacaaca gaacactggg aacgccagtt 2520

aaacgatcgt ggcgactctg cctgcttgcc ggcttcagtc cgcggatcat cacaaacagt 2580

aacttgcaca ggcgaggctg caaatgtgct caccttacag tgactgtatc cttgcttcca 2640

ctgcacaggc ttgaattggc caggcactcg tgggggttag cgtagaaata atcctcctct 2700

tttggcttgt tttcgagttt tcgccgacaa gatggttgga ctacacggcc tctatgaact 2760

tcttggac 2768

<210> 3

<211> 2768

<212> DNA

<213> Artificial sequence

<400> 3

acttgttgag gagatccgac ggatgatggc agatgactcg agggagattt cttttactca 60

tattagtcgt ttgcagaata aagttagtca cgagctcacc gcgtacggcc gcggcacatc 120

tcggacagcg gtctggctgt tttcgggtcc ggattctatt gtgaacttgt gtaaggctga 180

gaagcctcct tgagtaatga aatctctctt ccccccgcaa aaaggaagaa ctcagcttgg 240

gccttggggc gtcttcagtt tggtcagagt gaacgcgctc tcgcactgtc tgcgccacga 300

cacaataccg accgcttcct tcttcttcca ctgcatgtct gcatgtcttc agttaaccac 360

acccgcaact gtttactgtg ccctctctca ctccaaaaat agaccagcgc gcgctacggc 420

acaagccata gcagccactc gctcgccgct agcaaaccca ccaattaccg ccatcgatct 480

gcctaccctc tcgtgcggcg accgatctcg tcgtcttcct cttgattttc ggccgaggtg 540

tcgtacgttg gtttgcgtcg gcggctgatc gatcggacgc gtggccgccg ggttcaatcg 600

atggcaagct actggggccg gcgaccctgc gagtcgtgca gcacgagggc gatggcgggc 660

agcgtggtgg gccagccggt ggcgccgggg cagcgggtga cggtgctgac catcgacggg 720

ggcggcatcc gcggcatcat cccgggcacc atcctcgcct tcctcgaggc caagctgcag 780

gagctggacg ggccgggcgc gcgcctggcc gactacttcg actgcatcgc cggcaccagc 840

accggcggcc tcatcaccgc catgatcacc gcgcccggca aggacggctg cccgctcttc 900

gccgccaggg acgtcaaccg cttctacctc gacaatggcc cctacatctt cccgcaaagg 960

tgagagcgcg aacgatctca tctcatggac atggatcgtg cgagctgaac tggtgattga 1020

tgtatgtatt gcattgagtt gtgccaggag gtgcgcgctg gccgcggtga ccgcgtcgct 1080

gaggcggccg aggtacaacg gcaagtacct gcacgggaag atcaggagca tgctcggcga 1140

gacgaggctg tccgacgcgc tcaccgacgt ggtcatcccc accttcgacg tcaagcttct 1200

ccagcccatc atcttctcca catacgacgt atgccaattt tatatgtata agagaactaa 1260

tgtgatgatc agatagatcc atccttggat catggatcag acagacatgg ggctaaaaat 1320

gtgatggatc acgcgtgcgt gcgtgcaggc caagagcatg cccctgaaga acgcgcgact 1380

cgccgacgtg tgcatcggca cctccgccgc tccgacctac ctccccgcgc accacttcca 1440

cacccacgac ggcaacggca aggagcgcga gtacaacctc atcgacggcg gcgtcgccgc 1500

caacaatccg gtaacgaatc aagcctctgt ccgtcggtca gatgttcaga cacgcttgcc 1560

cgacccgagc acactgatga actgagccgt gagaaatgca gacgatggtg gcgatgacgc 1620

agatcaccaa gaagatgatg ggcaaggaca gggaggagct gtacccggtg gagccgtcgg 1680

actgcggcaa gttcctggtg ctgtccgtcg ggaccggctc gacgtccgac caggggctgt 1740

acacggcgaa gcagtgctcc cagtggggca tcatcagctg gctgcgcaac aagggcatgg 1800

cgcccatcat cgacatcttc atggccgcca gctccgacct cgtcgacatc cacgccgccg 1860

tgctcttcca gtcgctgcac agcgacgcca actacctccg catccaggac aactcgctcc 1920

acggcccggc ggccacggtg gacgccgcca cgcccgagaa catggcggag ctcctcagga 1980

tcggcgagcg gatgctggcg cagagggtgt ccagggtgaa cgtcgagacc gggaggtacg 2040

aggaggtaaa gggggccggg aacaacgccg acgcgctcgc cggcttcgcc aggcagctct 2100

ccgacgagag gaggacaagg ctcgggagcc ggcgcggtgg cgccggccgc ctgaaatcca 2160

gccgctgatc ttgtagctta gtgtggctta gtttcattta ttttctatat acagtatatt 2220

tttttggctg ggataggtag agaaagcttc acatggataa tggatggaaa tgaggagttt 2280

aggaaaaata acaacactta atgaaaccaa aatgtctctc ggttgttcac cgtggcaatt 2340

gcatatccct tccgatataa tcatgaattt aatcaacagt gaacaatagc gcaaacgacg 2400

aacaaaaatt tacacaaagc ctcctcccta ttttggcaag cttcaaaata aatgaatgga 2460

ttgcagaata gaaagaagaa gaaaaacctg ggctatacaa cagaacactg ccaacatcgg 2520

ttaaacgatc atcggggact ctgcctgctt gccggcttca gtccgcggat catcacaaac 2580

agtaacttgc acaggcgagg ctgcaaatgt gctcacctta cagtgactgt atccttgctt 2640

ccactgcaca ggcttgaatt ggccaggcac tcgtgggggt tagcgtagaa gtaatcctcc 2700

tccttcggct tgttttcgag tttccgacga caggacggtt ggaccacacg gcctctatga 2760

acttcttg 2768

<210> 4

<211> 2731

<212> DNA

<213> Artificial sequence

<400> 4

tacatcgtag atgcctcgtc gtcgacgaaa acgtctccat aactctgccg atctgaggtc 60

cgctaagcaa cgtttttgac ccacatatat gatgggccag atacacaagc atctcagccc 120

accaatcaga cactccatcc ttgtaaatca tatatgtggg tcaaaaacgt gcttccataa 180

tagatgtggg attaaaccac actatttcgg gaacaatttg cagtgaactc aacttggggc 240

gtcctcttcc ctcaaaaaaa acttggggcg tcctctcctc agtttggtgc gggtggggtg 300

gacgcgctct cccacggtgg cactgtctgc gccacgactc aaaaccgacc ggttccttct 360

tccaccgcat gccttgtctt gagttaacca catccgcatc tgtttactct gccctctctc 420

actccaaaca tagaccagcc cgcgctatgg catgagccat ggcagccact cgctagcaaa 480

tccaccaatt accgccatcg atctgggtac cctcccgtgc ggcgatcgat gtcgtcatcg 540

tcgtcttctt cttgattgtt gaccgaggtg tcgtcggttt gcatcagcgg ctgatcgatg 600

atggcaagct actggtgccg gcgaccgtgc gagtcgtgca gcacgagggc gatggcgggc 660

agcgtggtcg gccagccggt ggcgccgggg cagagggtga cggtgctgac catcgacggc 720

ggcggcatcc gcggcctcat cccgggcacc atcctcgcct tcctcgaggc caggctgcag 780

gagctggacg ggccggacgc gcgcctggcc gactacttcg actgcatcgc cggcaccagc 840

accggcgggc tcatcaccgc catgctcacc gcgcccggcc aggacggccg cccgctcttc 900

gccgccaagg acgtcaaccg cttctacctc gacaacgggc cctacatctt ccctcaaagg 960

tgagagcacg agcgatctcg tggccatgta tcatgccagc tgaaccggtg attgatgtgt 1020

gaattgtgtt gagttgtgcc aggaggtgcg cgctcgccgc ggtgaccgcg tcgctgaggc 1080

ggccgaggta cagcggcaag tacctgcacg gcaagatcag gagcatgctg ggcgagacga 1140

ggctgtgcga cgcgctcacc gacgtcgtca tccccacctt cgacgtcaag cttctccagc 1200

ccatcatctt ctccacatac gacgtatgct aatttacgcc attgatcaga tagatccatc 1260

ctccttggat cagacagaca tggggctaaa atcgttgaag gatcatgcgt gcaggccagg 1320

aacatgcccc tgaagaacgc gcggcttgcc gacatctgca tcggcacctc cgccgccccg 1380

acctacctcc cggcgcacca cttccacacc caagacgaca acggtaagga gcgcgagtac 1440

aacctcatcg acggcggcgt cgccgccaac aatccggtaa ccaaccaatc aagcgttcac 1500

cagtcatcat atattcagat gccctggccg agcacactga tgaactgagt tgcgagagat 1560

gcagacgatg gtgaccatga cgcagatcac caagaagatg atggtgaagg acagggagga 1620

gctgtacccg gtgaagccgt cggactgcgg caagttcctg gtgctgtcca tcgggaccgg 1680

ctcgacgtcg gaccaggggc tgtacacggc caagcagtgc tcccagtggg gcatcatccg 1740

ctggctgcgc aacaagggca tggcgcccat catcgacatc ttcatggcgg ccagctccga 1800

cctcgtcgac atccacgccg ccgtgctctt ccagtcgctg cacagcgacg gtaactacct 1860

ccgcatccag gacaactcgc tccacggccc agccgcgacg gtggacgccg ccacgcccga 1920

gaacatggcg gagctcctca ggatcggcga gcggatgctg gcacagaggg tgtccagggt 1980

gaacgtcgag accgggaggt acgaggagat acggggcgcc gggagcaacg ccgacgcgct 2040

cgccggcttc gccaaacagc tctccgacga gaggaggaca aggctcggcc gccggcgcgt 2100

tggcgccggc cgtctgaaat ccagacgctg atcttgtaac ttagtgtggg ttagtttcat 2160

ctattttctt tatatacttt ttggctggga ttaggtagag aaagcttcac atggataatg 2220

aaaggaaatg agcagttcag gagaaataat acgcttgatg aagccaaaat ctctctcaat 2280

tggtcaccgt cgcaattgta tatccctttc gacatcatca tcatgaataa atcaacagtg 2340

aacaagagcc gaacaaaaat ttacacaaag cctcgctacc tatttcggca agcttgaaca 2400

taaatgaatg gattgcagaa ttgaaagaag aaaaacctga cctatacaac agaacactgg 2460

gaacactggt tagacgatcg tggggactct gcccgaatgc cggcttcagt ccgaggatca 2520

tcaccaacag taacttgcac aggcgaggcg gcaaatgtgc tcaccttaca gtgactgtat 2580

tcttggttcc actgcacagg cttgaattgg ccgagcactc atgggggtta gagtagaagt 2640

aatcctcctc tttcggcttg ttttcgagtt ttctccgaca ggatggttga accacacggc 2700

ctctatgaac ttcctggaca gaagatgtaa a 2731

<210> 5

<211> 3010

<212> DNA

<213> Artificial sequence

<400> 5

aaaacaaatc atagcacaca catatgtgaa agaatttgtt cccacgacct ctattttacc 60

gaaataacat gttacggaga gatttttgaa agttacatac aagttacact atagttacag 120

tgtaattaca tgcaagttat agtgtaatta tactataatt gtactgtaat tacatctgtc 180

aaatttttgg gggaaaattt gtcgacgaat atatagcaaa atcgaacttt ggacttgttt 240

gacagcgcta attacttttg gatcatgacg ccaagttggt catcgcagcc caatcctcat 300

tcctccacgg gtccatccta ttgggcttcc atgggcctca ccagtggccc cacagcatat 360

ccatcaaaat cgttgtctga ctcggtctct tctagctcgc gggtgagtga ctggagagcc 420

gttggttggg cacttgcggt tgatctggtc cgttgcttca gctcagagct ctcacccgtc 480

tcttccacca aagccgtgtg cccgtgtggg tgtgggtgtg cgcgcacact gcgctcgagc 540

gcccgccaaa aatagttcgc cgtagctcaa aaacgctcac gccgcgcgtt cctgcaaatc 600

acagtgacta gtgacaaacg atcgatcgat ccctccatcc acaaaccctc ctcgatctca 660

tcttccttcg tctcgtcaat ggcggcgagc tactcgtgcc ggcggacatg cgaggcgtgc 720

agcacgaggg cgatggccgg gtgcgtggtg ggcgagccgg cgtcggcgcc ggggcagcgg 780

gtgacgttgc tggcgatcga cggcggcggc atcaggggcc tcatcccggg caccatcctc 840

gccttcctcg aggccaggct gcaggagctg gatggccccg acgcgcgcct cgccgattac 900

ttcgactgca tcgccgggac cagcaccggc ggcctcatca ccgccatgct cgccgcgccc 960

ggcgaccacg gccgcccgct cttcgccgcc agcgacatca accgcttcta cctcgacaac 1020

ggcccactca tcttcccaca aaagtaactg atcacctcga attcgatctc ctctcttcga 1080

tctctgcatt atttgatttg attggggatt gtgggcggcg tggcgtggcg tccaggaggt 1140

gcggcatggc ggcggccatg gcggcgctga cgaggccgag gtacaacggc aagtacctgc 1200

aggggaagat caggaagatg ctgggcgaga cgagggtgcg cgacacgctg acgaacgtcg 1260

tcatccccac gttcgacgtc aggctgctcc agccaaccat cttctccaca tacgacgtgc 1320

gtgcgttgat tccatccgca ttggcgttgg aatcagctga ttgtttgatt gatcgaacaa 1380

ttgatcggtt aaaattttgc aggcgaagag catgccgctc aagaacgcgc tcctctccga 1440

catctgcatc agcacatccg cggcgccgac ctacctcccc gcgcactgct tccagaccac 1500

cgacgacgcc accggcaagg tccgcgagtt cgacctcatc gacggcggcg tcgccgccaa 1560

caacccggta actaatcaat caagcaatcc atcaaacgaa gatccacatg tgcattcctg 1620

tggtacaaat gctgatcgat cgatggatgg atcgattttc gcgagaacgt acagacgatg 1680

gtggccatga cgcagatcac caagaagata atggtgaagg acaaggagga gctgtacccg 1740

gtaaagccgt cggactgcgg taagttcctg gtgctgtccg tgggcaccgg gtcgacgtcg 1800

gaccagggga tgtacacggc gaggcagtgc tcgcggtggg ggatcgtccg gtggctgcgc 1860

aacaagggga tggcgcccat catcgacatc ttcatggcgg ccagctccga cctcgtcgac 1920

atccacgccg ccgtcatgtt ccagtcgctg cacagcgacg gcgactacct ccgcatccag 1980

gacaacacgc tccacggcga cgccgccacg gtggacgccg ccaccaggga caacatgcgg 2040

gcgctcgtcg ggatcggcga gcggatgctg gcgcagcggg tgtcgagggt caacgtcgag 2100

accggcaggt acgtcgaggt gcccggcgcc ggcagcaacg ccgacgcgct gaggggcttc 2160

gccaggcagc tctccgagga gaggagggcg aggctaggtc ggcgaaacgc ctgcggcggc 2220

ggcggcgaag gagagcccag cggcgtggcg tgcaagcgtt agtaactgta cacgcatcat 2280

gctgacgcga tcttttttat ttttcttttt ttttttttac ctttctagcg gacatgggga 2340

ataacaagac gtgacagtag tgcaatcggt ttgtaacgtg cgtataccaa cattgatcca 2400

tttcttcatc acagtttcag ttcatcagta tccgcgcagc acaaacacgt acacgtacgt 2460

acagtcgtac acaacgtaca aaaatggatt atctataaat atgccgccat tttttttaaa 2520

ataaaacggt aaaatcattt ggcatgtatt tatttacact ataaactctc acatgttttt 2580

atggcaactt tatatattta cgctgttaaa tcaaaagtga ttgaaatagg gctaaaagca 2640

gccatttttt taaagcagaa ccaatagcaa cacataggat aacatagtta atatttcaaa 2700

ttaaaaattc acattatata tatatatata ttacgaatta cacactgtag aatcaatatt 2760

tctaccatgt ataacttatc acttctacat ttcttttcac tccttttatc atccagtgcc 2820

catatcctga tatccgcttt tacaatttcc tacatcgggt ggcctgacaa atttcgggcc 2880

tgttcacttt gttaccattt tcaaacttac caaattttat taaagttgct aaaaaaagtg 2940

gctacattta gtttgctgcc aaattttggt aactatataa gaaatcctgc caaattttta 3000

gcaagttgcc 3010

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

gacggtgctg accatcgacg 20

<210> 7

<211> 729

<212> DNA

<213> Artificial sequence

<400> 7

atggagaaaa cagaggaaag tgtcggaatc agagtctaca cgccgcaaaa accatcacca 60

tcgccaccgt ctcgctctcc caaaccctta ttaatctcat cacttccctc acttccccca 120

ggagccgcag ccggaggagg aagaggccgc aaacgccgca tggtcgctca aggagttcaa 180

aaaacggttt caaagacatc gatgatcgtc aacttcctcc cgacaggaac tctcctgatg 240

ttcgaaatgg ttctcccgtc tatctaccga gacggagact gcaacggaat caacacgctc 300

atgatccatc tcctcctcct tctctgcgca acgtcttgct tcttcttcca tttcaccgac 360

agtttcaaag ccgccgacga gaaaatctat tacggtttcg tgacgccgcg tggactcgcc 420

gtgttcatga aaccgccgcc gcctgagtgc ggaggcggag gagacgcgtt cgcggaagcc 480

gagattccgg tgactgatga gaggtataag ttgaaggtta acgactttgt tcatgcggtg 540

atgagcgttt tggtgtttat ggcgattgcg ttttcggaca ggagagtcac gggttgtctc 600

gttccgggga aacagaaaga gatggatcaa gttatggaga gtttcccatt aatggtcgga 660

atcgtttgca gtgctctatt tcttgtcttc ccgaccactc gacgtggtgt tggatgcatg 720

tctgcttga 729

<210> 8

<211> 735

<212> DNA

<213> Artificial sequence

<400> 8

atggagaaaa cagaggaaag cgttgggatc agagtttaca cgacggcgac tccgccgcaa 60

aaaccatcac caccaccgtc tgagtcacaa aaacccgtct caatctcttc acttcctaca 120

ctcccggtag gagccgccgc aggaggagga agaggtcgaa aacgtcgcat ggtggcgcaa 180

ggagtccaaa aaacggtatc aaagacatca atgctcgtaa actttcttcc aacaggaacg 240

ctcttgatgt tcgaaatggt tcttccttca atctaccgcg acggagactg taacggaatc 300

aaaacgctca tgatccatct cctcttgctt ctttgcgcaa tgtcttgttt cttcttccat 360

ttcaccgata gtttcaaagc atccgatggg aacatctatt acggtttcgt gacgccgcgt 420

ggactcgcgg ttttcatgaa accgccgccg ccggagttcg gaggcggtga tgtgattgcg 480

gaggcagaga ttccggtgag tgatgatagg tataagttga gggttaacga ctttgttcat 540

gcggtgatga gcgttttggt gtttatggcg attgcgtttt cggatagaag agtcacgggt 600

tgcttgtttc cagggaaaga gaaagagatg gatcaagtta tggagagttt tccattgatg 660

gttggaatcg tttgtagtgc tttgtttctc gttttcccga ccactcgcta cggtgttgga 720

tgcatgtccg cttga 735

<210> 9

<211> 738

<212> DNA

<213> Artificial sequence

<400> 9

atggagaaaa cagaggaaag cgttgggatc agagtttaca cgacggcgac tccgccgcaa 60

aaaccatcac caccactgac tcactcacca aaacccgtct caatctcgtc acttcctaca 120

ctcccagtag gagccgccgc aggaggagga agaggtcgaa aacgtcgcat ggtggcgcaa 180

ggagtccaaa aacggtatca aagacatcaa tgctcgtaaa ctttcttcca acagggacgc 240

tcttgatgtt cgaaatggtt cttccttcaa tctaccgcga cggagactgt aacggaatca 300

acacgctcat gatccatctc ctcttgcttc tttgcgcaat gtcttgtttc ttcttccatt 360

tcaccgatag tttcaaagca tccgatggga acatctatta cggtttcgtg acgccgcgtg 420

gactcgcggt tttcatgaaa ccgccgcccc cggagttcgg aggcggtgat gtgattgcgc 480

gcggaggcag agattccggt aagtgatgat aggtatacgt tgagggttaa cgactttgtt 540

catgcgatga tgagcgtttt ggtgtttatg gcgattgcgt tttcggatag aagagtcacg 600

ggttgcttgt ttccagggaa agagaaagag atggatcaag ttatggagag ttttccattg 660

atggttggaa tcgtttgtag tgctttgttt ctcgttttcc cgaccacatg ctacggtgtt 720

ggatgcatgt ccgcttga 738

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<400> 10

cacgaaaatg gagaaaacag 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

gagaaaacag aggaaagtgt 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

tgggatcaga gtttacacga 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

gaactccttg agcgaccatg 20

<210> 14

<211> 2016

<212> DNA

<213> Artificial sequence

<400> 14

atggctgcca ataataagac gacgatggtg gtcagcctgg ggagctcgcg gcggcggaag 60

cgcggcgaga tgctgttccg gttcgagtcc ttctgccagc ccggctaccc cgctccgctc 120

gccggcgggg gcgccttcag ggacaacgtc agggctctgc tcggcctcgc gcacctggag 180

ggcggcgcgc atggcgagac gaagtgctgg tctttccagc tcgagctgca ccgccacccg 240

cccaccgtcg tcaggctctt cgtcgtcgag gaagtggtcg acacgtcgcc gcagcgccag 300

tgccacctct gccgtcacgt cggttggggt cggcatctga tctgcagcaa gcggttccac 360

ttcgtgctgc ccaagaggga gttgtcagtg gaagctgacg gcctgcacta cgggatcaac 420

cacagcccgg agaaaccgtc caaaggcacg gcgacctcca ggggccacct gctgcacggc 480

gtggtgcacc tcaacggctt cggccacctc gttgccctgc acggcttcga gggcggctcc 540

gaattcgtcg ccggcgagca gatcatggac ctctgggatc gcatatgctc ctctctgaac 600

gtcaggaagg tgagcctcgt cgacacggcg aggaaggggc acatggagct gcggctgctg 660

cacggcgtcg cgtacggcga cacgtggttc gggcggtggg gctacaggtt cggccggccc 720

agctacggcg tcgcgctacc gtcctaccag cagtcgctgc acgcgctcca gtcggtacct 780

ctctgcgtgc tcgtgccgca cctgtcgtgc ttcagccagg acctccccgt ggtggtgacc 840

aagtaccagg ccatcagcgg ccacaagctg ctcaacctcg gcgacctcct ccgcttcatg 900

ctcgagctgc gaacgcgcct cccggcgacc tccgtcaccg ccatggacta ccgcggcatc 960

atgtcggagg cctcgtgccg gtggtcggct aagcgcgtgg acatggcggc ccgcgccgtg 1020

gtggacgcgc tccgccgcac cgagccgccc gcgcggtggg tcacgcggca ggaggtgcgc 1080

gacgcggcgc gcgcctacat cggcgacacg ggcctcctcg acttcgtgct caagtccctg 1140

ggcaaccaca tcgtcggcaa ctacgtcgtg cggcgcgcga tgaacccggt gaccaaggtg 1200

ctcgagtact gcctggagga cgtgtccagc gtgctcccgg cggtgggcgg cgtgccgagc 1260

aacggcggcg gcaagatgag ggtccggttc cagctcacgc gggcgcagct catgagggac 1320

ctgatgcacc tgtaccgcca cgtgctgaag gagccgagcc aggcgctcac caccggcgcc 1380

ttcggcgcga tccccgtggc ggcgcggatg gtcttggaca ccaagcactt cgtcaaagat 1440

taccacgaag gtttcgctcc gatcaacagt gttggagttg ggcacgtcca catgaacctg 1500

tgttgcacgc tgcttctgaa gaacgggggt ccggagctgg tggcgccgta cgagacggtc 1560

accctgccgg cgcatgcaac ggtgggcgag ctcaaatggg aggcgcagag gctgttcagt 1620

gagatgtacc tcggcctaag gaccttcacg gccgagtccg tcgccggggt cggcgtcagc 1680

caggacgctt gcccggtgct cgggctcatc gacgtgggaa gcgtcgtggt gatcgaagga 1740

tcagtcgtcg agcagcagca gctggcggat gaaagcgtac gtacagggag cgaggccgcg 1800

tctgtgagcg agggaggcgg cgacagcgag agggtcgtgg actgcgcgtg cggagcggat 1860

gacgacgacg gggagcgcat ggcgtgctgc gacatctgcg aggcgtggca gcacacccgg 1920

tgcgcgggga tcaaggacac cgacgacgcc ccgcacgttt tcgtctgcaa ccgctgcgac 1980

aacgacgttc tgtcattccc tcccttgagc tgttag 2016

<210> 15

<211> 503

<212> DNA

<213> Artificial sequence

<400> 15

tatgatttag aataatatac aaatatatta cataaaaaat atattaattg aattagtgtt 60

gtctaattta taattattag aatgtaattc aattccaacg aaacaacggg gccttaggtt 120

taatatcttc cttacactgc gaaaatgttg ttacacttgc caaaaaaaat caatcgcata 180

tttaccttac aaggacatat tttagcaaaa tgctatagac atgaatccaa cgtaatcaat 240

agagtgagat ttactggtaa actaccaatt gctcatctgc tcggtaccaa ccagcctttc 300

ctattaccat gcacatgttg cctctcaact gcagcatctt tcaagccgtg agcagacatg 360

ttgcagatcg aagtaaggta tatatgtgca tagtctccta attcttcatc ttcaacctct 420

agctgattga tctctggtat ttaccactct ttccttcctt ccttccttca attctaaata 480

ccacaaatca aagttgcttt gcg 503

<210> 16

<211> 940

<212> DNA

<213> Artificial sequence

<400> 16

tgaagcagta gcagttctgg aaacaacaaa aatttgataa accgtcgtac taaagatagt 60

tcgaacaaaa atccaaaaca catttctcat ttcacaaaac aaacgaaaac tattgagtca 120

caaaacacag agagaatgga gaaaacagag gaaagcgtcg gaatcagagt ttacacgacg 180

acaacgacgc aaaatccgtc accaacatcg tctcggtcgc ccaaacctgt ccctctctct 240

tcactgccta tgcttccggc aggagccgcc gcgggaggag gaaaaggtag aaaacgtcgc 300

atggtggcga aaggagttca aaaaacggtt tcgaagacat caatgctcgt caatttcctt 360

ccgacaggaa ctctcttgat gttcgaaatg gttcttccga caatctaccg tgacggagac 420

tgtaacggaa tcaacacact catgattcat cttctcttgc ttctttgcgc aatgtcttgt 480

ttcttcttcc atttcaccga cagtttcaaa gcctccgatg ggaaaattta ctacggtttt 540

gtgactccac gtggactcgc ggtgttcatg aaaccaccct cgccggggtt tggaggcgga 600

gatgtgattg cagagaagga gattccggtg acggatgaga ggtataagtt gagggttaat 660

gactttgtgc attcagtgat gagtgttttg gtttttatgg cgatcgcgtt ttcggatcgg 720

agagtcacag ggtgtttgtt tccaggaaaa gagaaggaga tggatcaagt tatggagagt 780

tttccgttaa tggtcggaat tgtttgcagt gctttgtttc ttgtttttcc gaccagtcga 840

tacggtgtcg gatgcatgtc tacataataa ctaatttcac ttttctgttg ttttgtgatt 900

ttttaagtat cttttttttg tagtatttgc cttgtaattt 940

<210> 17

<211> 887

<212> DNA

<213> Artificial sequence

<400> 17

caaaagaaaa aaacagagag aaacacacga aaatggagaa aacagaggaa agcgtcggaa 60

tcagagttta cacggcgact ccgccgcaaa aaccatcacc atcaccacct tctcgttcac 120

caaaacccgt cttaatctct tcattgcctt ccctcccgtc aggagccgcc gctggaggag 180

gaagaggtcg aaaacgtcgc atggtggcgc aaggagttca aaaaacggtt tcgaagacat 240

caatgctcgt caacttcctt ccgacaggaa cactcttgat gttcgaaatg gttcttccat 300

caatataccg tgacggagac tgtaacggaa tcaacacact catgattcat ctcctcttgc 360

ttctttgcgc aatgtcttgt ttcttcttcc attttaccga cagtttcaaa gcatccgatg 420

ggaagatcta ctacggtttc gtgacgccac gtggactcgc ggtgttcatg aaaccgccgc 480

ctccagagtt tggtggcgga gatgttatag cggaggcaga gattccggtg actgatgata 540

ggtataagtt gacggttaat gactttgttc atgcagtgat gagcgttttg gtgtttatgg 600

cgattgcgtt ttcggatcga agagtcacgg gatgtttgtt tccagggaaa gagaaagaga 660

tggatcaagt tatggagagt tttccaataa tggttggaat tgtttgtagt gctttgtttc 720

ttgtttttcc gaccactcga tatggtgttg gttgcatgac tggttaattt attttcactt 780

ttctgttttt tggtttgttt tagtatctat ttcgtatttt ccttgtaatt tagattatct 840

gatttaaact ccaatgttct actattttta tctattgtat tgttaaa 887

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

gagaaaacag aggaaagcgt 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

aagaggtcga aaacgtcgca 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

tcaagagtgt tcctgtcgga 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

atgaacaccg cgagtccacg 20

<210> 22

<211> 8433

<212> DNA

<213> Artificial sequence

<400> 22

ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 60

aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 120

ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 180

ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 240

tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 300

cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct 360

gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 420

gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 480

tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 540

ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg 600

gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 660

ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 720

tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 780

ttacggttcc tggcagatcc tagatgtggc gcaacgatgc cggcgacaag caggagcgca 840

ccgacttctt ccgcatcaag tgttttggct ctcaggccga ggcccacggc aagtatttgg 900

gcaaggggtc gctggtattc gtgcagggca agattcggaa taccaagtac gagaaggacg 960

gccagacggt ctacgggacc gacttcattg ccgataaggt ggattatctg gacaccaagg 1020

caccaggcgg gtcaaatcag gaataagggc acattgcccc ggcgtgagtc ggggcaatcc 1080

cgcaaggagg gtgaatgaat cggacgtttg accggaaggc atacaggcaa gaactgatcg 1140

acgcggggtt ttccgccgag gatgccgaaa ccatcgcaag ccgcaccgtc atgcgtgcgc 1200

cccgcgaaac cttccagtcc gtcggctcga tggtccagca agctacggcc aagatcgagc 1260

gcgacagcgt gcaactggct ccccctgccc tgcccgcgcc atcggccgcc gtggagcgtt 1320

cgcgtcgtct tgaacaggag gcggcaggtt tggcgaagtc gatgaccatc gacacgcgag 1380

gaactatgac gaccaagaag cgaaaaaccg ccggcgagga cctggcaaaa caggtcagcg 1440

aggccaagca ggccgcgttg ctgaaacaca cgaagcagca gatcaaggaa atgcagcttt 1500

ccttgttcga tattgcgccg tggccggaca cgatgcgagc gatgccaaac gacacggccc 1560

gctctgccct gttcaccacg cgcaacaaga aaatcccgcg cgaggcgctg caaaacaagg 1620

tcattttcca cgtcaacaag gacgtgaaga tcacctacac cggcgtcgag ctgcgggccg 1680

acgatgacga actggtgtgg cagcaggtgt tggagtacgc gaagcgcacc cctatcggcg 1740

agccgatcac cttcacgttc tacgagcttt gccaggacct gggctggtcg atcaatggcc 1800

ggtattacac gaaggccgag gaatgcctgt cgcgcctaca ggcgacggcg atgggcttca 1860

cgtccgaccg cgttgggcac ctggaatcgg tgtcgctgct gcaccgcttc cgcgtcctgg 1920

accgtggcaa gaaaacgtcc cgttgccagg tcctgatcga cgaggaaatc gtcgtgctgt 1980

ttgctggcga ccactacacg aaattcatat gggagaagta ccgcaagctg tcgccgacgg 2040

cccgacggat gttcgactat ttcagctcgc accgggagcc gtacccgctc aagctggaaa 2100

ccttccgcct catgtgcgga tcggattcca cccgcgtgaa gaagtggcgc gagcaggtcg 2160

gcgaagcctg cgaagagttg cgaggcagcg gcctggtgga acacgcctgg gtcaatgatg 2220

acctggtgca ttgcaaacgc tagggccttg tggggtcagt tccggctggg ggttcagcag 2280

ccagcgcctg atctggggaa ccctgtggtt ggcatgcaca tacaaatgga cgaacggata 2340

aaccttttca cgccctttta aatatccgat tattctaata aacgctcttt tctcttaggt 2400

ttacccgcca atatatcctg tcaaacactg atagtttaaa ccacttcgtg cagaagacaa 2460

tagtagcgat ctggatttta gtactggatt ttggttttag gaattagaaa ttttattgat 2520

agaagtattt tacaaataca aatacatact aagggtttct tatatgctca acacatgagc 2580

gaaaccctat aggaacccta attcccttat ctgggaacta ctcacacatt attatggaga 2640

aactcgagct tgtcgatcga ctctagctag agaagctcac tccttttttg gattcggagg 2700

ggtgtcctcg tcgtcgaaga ggtagttgta gacatcatcc atagtggtag tgttgaacat 2760

gccggtcgtg attccgaaag cgttgtacgc cgtttgatct gtccagccgg ggcttagagg 2820

cttagaatta ttaccatcat cgattttaga cgcagttatc tcattgttca tgaagttgtc 2880

atgaacgtta gacgaggcta ttggctgcga cagagcctga ctattagtct gggtggttat 2940

caggtttgga ccattagacg agttggtgaa agtaaaagag agtgaagagt ctgcaatgtt 3000

tccagattga ttgaaattgg caaattcaga gccagacgtg gttttccttt tcacgagcga 3060

tacaggtagt aattggttgc ccttcactgc ctgcccctgt gatagctgga gtaatctatc 3120

aacagaagtc tgacccaaaa gccgaaaatc ctgtttaata gttgtcagtg gtgggatgta 3180

gcagctcgaa tcttcagtgt cgtcgtaccc gacaactgaa atatcagcac caactcgcag 3240

cccggactcg gtaatagctc tcatcgcccc cagagccatt tgatcatttg ccaccagcat 3300

agctgtgggg acgatgccct catttagcat ctgcattgtt tgctggaagc ctgacatggc 3360

ggaccagtca ccctcccgct ccgcaatagg ttggatctgg ttcctagtaa gatacttgtg 3420

ccaacctgcc aaccgcaatc tcgcggatac agagctcagg ggtccagcaa ggagggcgat 3480

ctgctgatga ccaagcgcca ccaagtgctc gaccccgagg cgtgtgccgt cctcatgtga 3540

aaagatgata gagttaatcg gcgtttggtc actcacatca aggaacagag cgggaacatt 3600

tgtacaggcg gcctccactg ctatggcatc ttggtcatca agcgggtagt tgattatgag 3660

tcctgatacc ctctgcgcca acaaattgtg cacggcggcc ttacaagctt cgactcctga 3720

ccgctccacc attgacacga cgacggaggc gccaagttgg tcagctctgg acttgatcgc 3780

tgcgacaatt tgtgaaggag catggagagc cagggagctc gtggccacgc caatgaggag 3840

tgattgtttt ccagccagct gttgagccac acgatttgga atataattta gttcagccat 3900

tgcggcttca accttttcgc gcgttttggc tgagacatgg ctcgcttggt tgaccacgcg 3960

gcttactgtt tggtgggaca cgccggcgta ctctgcaaca tcatagagtg taactggctt 4020

actcgtgctt ttctggtgga ataacagctt cttgatgttg ccattcgagt acttcgggat 4080

ttggttagta ataatctccg ccagcatctc cgggaactcg atgctcattg tcttgtcaag 4140

aaaggtctga aagcagtagg ttagtagatt ttcgaccact tcatgcatgg aatccagcaa 4200

cttagtgagc tggtagaacc tctgccagtt ttgggaacta ttcccctcac gcttgactat 4260

cgccttgccc agttctttga tatatgtcat ccggatttca tcaaaaagct cctgggactt 4320

taatccttcc ttaggaactg acgacaataa aagtagggtt ttcatacaca gatactcctc 4380

gtagcttacc tgcaggcgtt ggagctcact tgagacaaag agcatgtgct tgcactggtc 4440

atacatgcac ggcagggaca tgcgctgttc attaattatc aggtcgggcg cgaagcacaa 4500

aagatttccg gacgactgcc tataactgcg ccaccccagc gcgaacgcca tcagaaacat 4560

ccagctgtac tgcaagagtg tcatctggtc gtcgaggtgc aagttgcgga atccaggaat 4620

ggctttagcc cacttaaccg cggcgataac ttgtcggccg ccaagcatgt tgagcgtggt 4680

cataatcctc cacgcgctat ccggtacaga agagtcatag ccagcataca gcacttccgg 4740

ctcaatgacc tccaggaggc ttacgagcgt gggcgtcagc tgcgggaggg ctgctggcac 4800

tatggtcttg ttggggttct cgcttgtatc ctgcgaaaca cctgcagtgg cctgctggat 4860

cccctttatc ttttttttgg tttttctggc ttcacttgcc ataggtccag ggttctcctc 4920

cacgtctcca gcctgcttca gcaggctgaa gttagtagct ccgcttccct tgtacagctc 4980

gtccatgccg agagtgatcc cggcggcggt cacgaactcc agcaggacca tgtgatcgcg 5040

cttctcgttg gggtctttgc tcagggcgga ctgggtgctc aggtagtggt tgtcgggcag 5100

cagcacgggg ccgtcgccga tgggggtgtt ctgctggtag tggtcggcga gctgcacgct 5160

gccgtcctcg atgttgtggc ggatcttgaa gttcaccttg atgccgttct tctgcttgtc 5220

ggccatgata tagacgttgt ggctgttgta gttgtactcc agcttgtgcc ccaggatgtt 5280

gccgtcctcc ttgaagtcga tgcccttcag ctcgatgcgg ttcaccaggg tgtcgccctc 5340

gaacttcacc tcggcgcggg tcttgtagtt gccgtcgtcc ttgaagaaga tggtgcgctc 5400

ctggacgtag ccttcgggca tggcggactt gaagaagtcg tgctgcttca tgtggtcggg 5460

gtagcggctg aagcactgca cgccgtaggt cagggtggtc acgagggtgg gccagggcac 5520

gggcagcttg ccggtggtgc agatgaactt cagggtcagc ttgccgtagg tggcatcgcc 5580

ctcgccctcg ccggacacgc tgaacttgtg gccgtttacg tcgccgtcca gctcgaccag 5640

gatgggcacc accccggtga acagctcctc gcccttgctc accattgtat cgataattgt 5700

aaatgtaatt gtaatgttgt ttgttgtttg ttgttgttgg taattgttgt aaaaatgagc 5760

tcttatactc gagcgtgtcc tctccaaatg aaatgaactt ccttatatag aggaagggtc 5820

ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca gtggagatgt cacatcaatc 5880

cacttgcttt gtagacgtgg ttggaacctc ttctttttcc acgatgctcc tcgtgggtgg 5940

gggtccatct ttgggaccac tgtcggcaga gagatcttga atgatagcct ttcctttatc 6000

gcaatgatgg catttgtagg agccaccttc cttttctact gtcctttcga tgaagtgaca 6060

gatagctggg caatggaatc cgaggaggtt tcccgaaatt atcctttgtt gaaaagtctc 6120

aatagccctt tgatcttctg agactgtatc tttgacattt ttggagtaga ccagagtgtc 6180

gtgctccacc atgttatcac atcaatccac ttgctttgta gacgtggttg gaacctcttc 6240

tttttccacg atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagagag 6300

atcttgaatg atagcctttc ctttatcgca atgatggcat ttgtaggagc caccttcctt 6360

ttctactgtc ctttcgatga agtgacagat agctgggcaa tggaatccga ggaggtttcc 6420

cgaaattatc ctttgttgaa aagtctcaat agccctttga tcttctgaga ctgtatcttt 6480

gacatttttg gagtagacca gagtgtcgtg ctccaccatg ttgacctcca agcttgaatt 6540

cttgcttgtc ttcacagagt ggggcccact gcatccaccc cagtacatta aaaacgtccg 6600

caatgtgtta ttaagttgtc taagcgtcaa tttgtttaca ccacaatata tcctgccacc 6660

agccagccaa cagctccccg accggcagct cggcacaaaa tcaccactcg atacaggcag 6720

cccatcagtc agatcaggat ctcctttgcg acgctcaccg ggctggttgc cctcgccgct 6780

gggctggcgg ccgtctatgg ccctgcaaac gcgccagaaa cgccgtcgaa gccgtgtgcg 6840

agacaccgcg gccgccggcg ttgtggatac ctcgcggaaa acttggccct cactgacaga 6900

tgaggggcgg acgttgacac ttgaggggcc gactcacccg gcgcggcgtt gacagatgag 6960

gggcaggctc gatttcggcc ggcgacgtgg agctggccag cctcgcaaat cggcgaaaac 7020

gcctgatttt acgcgagttt cccacagatg atgtggacaa gcctggggat aagtgccctg 7080

cggtattgac acttgagggg cgcgactact gacagatgag gggcgcgatc cttgacactt 7140

gaggggcaga gtgctgacag atgaggggcg cacctattga catttgaggg gctgtccaca 7200

ggcagaaaat ccagcatttg caagggtttc cgcccgtttt tcggccaccg ctaacctgtc 7260

ttttaacctg cttttaaacc aatatttata aaccttgttt ttaaccaggg ctgcgccctg 7320

tgcgcgtgac cgcgcacgcc gaaggggggt gccccccctt ctcgaaccct cccggcccgc 7380

taacgcgggc ctcccatccc cccaggggct gcgcccctcg gccgcgaacg gcctcacccc 7440

aaaaatggca gcgctggcca attcgtgcgc ggaaccccta tttgtttatt tttctaaata 7500

cattcaaata tgtatccgct catgagacaa taaccctgat aaatgcttca ataatattga 7560

aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc ttattccctt ttttgcggca 7620

ttttgccttc ctgtttttgc tcacccagaa acgctggtga aagtaaaaga tgctgaagat 7680

cagttgggtg cacgagtggg ttacatcgaa ctggatctca acagcggtaa gatccttgag 7740

agttttcgcc ccgaagaacg ttttccaatg atgagcactt ttaaagttct gctatgtggc 7800

gcggtattat cccgtattga cgccgggcaa gagcaactcg gtcgccgcat acactattct 7860

cagaatgact tggttgagta ctcaccagtc acagaaaagc atcttacgga tggcatgaca 7920

gtaagagaat tatgcagtgc tgccataacc atgagtgata acactgcggc caacttactt 7980

ctgacaacga tcggaggacc gaaggagcta accgcttttt tgcacaacat gggggatcat 8040

gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag ccataccaaa cgacgagcgt 8100

gacaccacga tgcctgtagc aatggcaaca acgttgcgca aactattaac tggcgaacta 8160

cttactctag cttcccggca acaattaata gactggatgg aggcggataa agttgcagga 8220

ccacttctgc gctcggccct tccggctggc tggtttattg ctgataaatc tggagccggt 8280

gagcgtggtt ctcgcggtat cattgcagca ctggggccag atggtaagcc ctcccgtatc 8340

gtagttatct acacgacggg gagtcaggca actatggatg aacgaaatag acagatcgct 8400

gagataggtg cctcactgat taagcattgg taa 8433

<210> 23

<211> 6604

<212> DNA

<213> Artificial sequence

<400> 23

cctgatctgg ggaaccctgt ggttggcatg cacatacaaa tggacgaacg gataaacctt 60

ttcacgccct tttaaatatc cgattattct aataaacgct cttttctctt aggtttaccc 120

gccaatatat cctgtcaaac actgatagtt taaaccactt cgtgcagaag acaatctggg 180

agaattgtga gcgctcacaa ttgaaagact agaaagaaga aagggaagag aaagaattgt 240

gagcgctcac aattgaaaga ctagaaagaa gaaagggaag agaaagaatt gtgagcgctc 300

acaattgaaa gactagaaag aagaaaggga agagaaagaa ttgtgagcgc tcacaattga 360

aagactagaa agaagaaagg gaagagaaag aattgtgagc gctcacaatt gaaagactag 420

aaagaagaaa gggaagagaa agaattgtga gcgctcacaa ttgaaagact agtggatcga 480

tcttcgcaag acccttcctc tatataagga agttcatttc atttggagag gacacgaatg 540

tcaaatttgt taacagttca tcaaaatctc ccggcgctgc cggtggatgc aacttctgat 600

gaagttagga agaacttgat ggacatgttc cgcgacaggc aagcattttc tgagcacact 660

tggaagatgc tgctatctgt ctgtcgctcg tgggcggcgt ggtgcaagct aaacaacaga 720

aaatggttcc ctgcagaacc agaagatgtg agagactacc tgctgtatct gcaagctcgg 780

ggacttgccg tcaagaccat ccagcagcac cttggacagc tcaacatgct ccaccgccgc 840

tcggggttgc ctcgcccctc ggactccaat gctgtgtcac tcgtcatgag gagaattagg 900

aaagagaacg tcgacgctgg ggaaagagca aagcaggcgc tcgccttcga gagaactgat 960

tttgatcagg tattgcttct tttcctttac tctttacaga aatggtaatc tcagatatag 1020

taatggataa gatccaaaaa tgacactttt aaccaagatt gtacgaagat ctttttaaac 1080

tccatttttt attttgacat ctaaattgga tttaactcgg ccttgctgta ttttggcagg 1140

tgcgatcact gatggagaat agcgaccgct gccaggacat tcgtaatctg gcgttcctgg 1200

gcatcgccta taacactctc ctcaggattg ctgaaatagc acggatacga gtcaaggaca 1260

tcagtcgtac agatggtggt cgcatgctta tacatattgg ccgcaccaag acattggttt 1320

ccaccgccgg ggttgagaag gcccttagct tgggcgtcac gaaactcgtg gagaggtgga 1380

tcagcgtatc gggagtcgcc gacgacccca acaattatct cttctgccgt gtccggaaaa 1440

atggtgtggc cgccccatca gctacgtccc aactatctac gagggcactg gaggggatat 1500

ttgaggccac ccatcggctt atttacggcg ccaaggatga ttccgggcag aggtaccttg 1560

catggagcgg ccacagcgcg cgggttggtg ctgcgagaga tatggcgcgt gctggtgtat 1620

ccatcccgga gatcatgcag gccggcggct ggaccaacgt gaacatcgtg atgaactaca 1680

tcaggaattt ggatagtgag acaggagcca tggtaagact gctcgaggac ggcgactgag 1740

cttagagctt tcgttcgtat catcggtttc gacaacgttc gtcaagttca atgcatcagt 1800

ttcattgcgc acacaccaga atcctactga gtttgagtat tatggcattg ggaaaactgt 1860

ttttcttgta ccatttgttg tgcttgtaat ttactgtgtt ttttattcgg ttttcgctat 1920

cgaactgtga aatggaaatg gatggagaag agttaatgaa tgatatggtc cttttgttca 1980

ttctcaaatt aatattattt gttttttctc ttatttgttg tgtgttgaat ttgaaattat 2040

aagagatatg caaacatttt gttttgagta aaaatgtgtc aaatcgtggc ctctaatgac 2100

cgaagttaat atgaggagta aaacacttgt agttgtacca ttatgcttat tcactaggca 2160

acaaatatat tttcagacct agaaaagctg caaatgttac tgaatacaag tatgtcctct 2220

tgtgttttag acatttatga actttccttt atgtaatttt ccagaatcct tgtcagattc 2280

taatcattgc tttataatta tagttatact catggatttg tagttgagta tgaaaatatt 2340

ttttaatgca ttttatgact tgccaattga ttgacaacga attcgtaatc atggtcatag 2400

ctgtttcctg cgctccatgg gaattcgtaa ttgtcttcac agagtggggc ccactgcatc 2460

caccccagta cattaaaaac gtccgcaatg tgttattaag ttgtctaagc gtcaatttgt 2520

ttacaccaca atatatcctg ccaccagcca gccaacagct ccccgaccgg cagctcggca 2580

caaaatcacc actcgataca ggcagcccat cagtcagatc aggatctcct ttgcgacgct 2640

caccgggctg gttgccctcg ccgctgggct ggcggccgtc tatggccctg caaacgcgcc 2700

agaaacgccg tcgaagccgt gtgcgagaca ccgcggccgc cggcgttgtg gatacctcgc 2760

ggaaaacttg gccctcactg acagatgagg ggcggacgtt gacacttgag gggccgactc 2820

acccggcgcg gcgttgacag atgaggggca ggctcgattt cggccggcga cgtggagctg 2880

gccagcctcg caaatcggcg aaaacgcctg attttacgcg agtttcccac agatgatgtg 2940

gacaagcctg gggataagtg ccctgcggta ttgacacttg aggggcgcga ctactgacag 3000

atgaggggcg cgatccttga cacttgaggg gcagagtgct gacagatgag gggcgcacct 3060

attgacattt gaggggctgt ccacaggcag aaaatccagc atttgcaagg gtttccgccc 3120

gtttttcggc caccgctaac ctgtctttta acctgctttt aaaccaatat ttataaacct 3180

tgtttttaac cagggctgcg ccctgtgcgc gtgaccgcgc acgccgaagg ggggtgcccc 3240

cccttctcga accctcccgg cccgctaacg cgggcctccc atccccccag gggctgcgcc 3300

cctcggccgc gaacggcctc accccaaaaa tggcagcgct ggccaattcg tgcgcggaac 3360

ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 3420

ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 3480

cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 3540

ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 3600

tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 3660

cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca 3720

actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 3780

aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 3840

tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 3900

ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 3960

tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 4020

gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 4080

gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 4140

tattgctgat aaatctggag ccggtgagcg tggttctcgc ggtatcattg cagcactggg 4200

gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat 4260

ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 4320

gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 4380

aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 4440

ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 4500

ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 4560

tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 4620

gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 4680

agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 4740

taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 4800

gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact 4860

gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga 4920

caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg 4980

aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 5040

tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 5100

acggttcctg gcagatccta gatgtggcgc aacgatgccg gcgacaagca ggagcgcacc 5160

gacttcttcc gcatcaagtg ttttggctct caggccgagg cccacggcaa gtatttgggc 5220

aaggggtcgc tggtattcgt gcagggcaag attcggaata ccaagtacga gaaggacggc 5280

cagacggtct acgggaccga cttcattgcc gataaggtgg attatctgga caccaaggca 5340

ccaggcgggt caaatcagga ataagggcac attgccccgg cgtgagtcgg ggcaatcccg 5400

caaggagggt gaatgaatcg gacgtttgac cggaaggcat acaggcaaga actgatcgac 5460

gcggggtttt ccgccgagga tgccgaaacc atcgcaagcc gcaccgtcat gcgtgcgccc 5520

cgcgaaacct tccagtccgt cggctcgatg gtccagcaag ctacggccaa gatcgagcgc 5580

gacagcgtgc aactggctcc ccctgccctg cccgcgccat cggccgccgt ggagcgttcg 5640

cgtcgtcttg aacaggaggc ggcaggtttg gcgaagtcga tgaccatcga cacgcgagga 5700

actatgacga ccaagaagcg aaaaaccgcc ggcgaggacc tggcaaaaca ggtcagcgag 5760

gccaagcagg ccgcgttgct gaaacacacg aagcagcaga tcaaggaaat gcagctttcc 5820

ttgttcgata ttgcgccgtg gccggacacg atgcgagcga tgccaaacga cacggcccgc 5880

tctgccctgt tcaccacgcg caacaagaaa atcccgcgcg aggcgctgca aaacaaggtc 5940

attttccacg tcaacaagga cgtgaagatc acctacaccg gcgtcgagct gcgggccgac 6000

gatgacgaac tggtgtggca gcaggtgttg gagtacgcga agcgcacccc tatcggcgag 6060

ccgatcacct tcacgttcta cgagctttgc caggacctgg gctggtcgat caatggccgg 6120

tattacacga aggccgagga atgcctgtcg cgcctacagg cgacggcgat gggcttcacg 6180

tccgaccgcg ttgggcacct ggaatcggtg tcgctgctgc accgcttccg cgtcctggac 6240

cgtggcaaga aaacgtcccg ttgccaggtc ctgatcgacg aggaaatcgt cgtgctgttt 6300

gctggcgacc actacacgaa attcatatgg gagaagtacc gcaagctgtc gccgacggcc 6360

cgacggatgt tcgactattt cagctcgcac cgggagccgt acccgctcaa gctggaaacc 6420

ttccgcctca tgtgcggatc ggattccacc cgcgtgaaga agtggcgcga gcaggtcggc 6480

gaagcctgcg aagagttgcg aggcagcggc ctggtggaac acgcctgggt caatgatgac 6540

ctggtgcatt gcaaacgcta gggccttgtg gggtcagttc cggctggggg ttcagcagcc 6600

agcg 6604

<210> 24

<211> 5985

<212> DNA

<213> Artificial sequence

<400> 24

ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt 60

aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag 120

ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct 180

ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt 240

tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg 300

cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt caagaactct 360

gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc 420

gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg 480

tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa 540

ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg 600

gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg 660

ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga 720

tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt 780

ttacggttcc tggcagatcc tagatgtggc gcaacgatgc cggcgacaag caggagcgca 840

ccgacttctt ccgcatcaag tgttttggct ctcaggccga ggcccacggc aagtatttgg 900

gcaaggggtc gctggtattc gtgcagggca agattcggaa taccaagtac gagaaggacg 960

gccagacggt ctacgggacc gacttcattg ccgataaggt ggattatctg gacaccaagg 1020

caccaggcgg gtcaaatcag gaataagggc acattgcccc ggcgtgagtc ggggcaatcc 1080

cgcaaggagg gtgaatgaat cggacgtttg accggaaggc atacaggcaa gaactgatcg 1140

acgcggggtt ttccgccgag gatgccgaaa ccatcgcaag ccgcaccgtc atgcgtgcgc 1200

cccgcgaaac cttccagtcc gtcggctcga tggtccagca agctacggcc aagatcgagc 1260

gcgacagcgt gcaactggct ccccctgccc tgcccgcgcc atcggccgcc gtggagcgtt 1320

cgcgtcgtct tgaacaggag gcggcaggtt tggcgaagtc gatgaccatc gacacgcgag 1380

gaactatgac gaccaagaag cgaaaaaccg ccggcgagga cctggcaaaa caggtcagcg 1440

aggccaagca ggccgcgttg ctgaaacaca cgaagcagca gatcaaggaa atgcagcttt 1500

ccttgttcga tattgcgccg tggccggaca cgatgcgagc gatgccaaac gacacggccc 1560

gctctgccct gttcaccacg cgcaacaaga aaatcccgcg cgaggcgctg caaaacaagg 1620

tcattttcca cgtcaacaag gacgtgaaga tcacctacac cggcgtcgag ctgcgggccg 1680

acgatgacga actggtgtgg cagcaggtgt tggagtacgc gaagcgcacc cctatcggcg 1740

agccgatcac cttcacgttc tacgagcttt gccaggacct gggctggtcg atcaatggcc 1800

ggtattacac gaaggccgag gaatgcctgt cgcgcctaca ggcgacggcg atgggcttca 1860

cgtccgaccg cgttgggcac ctggaatcgg tgtcgctgct gcaccgcttc cgcgtcctgg 1920

accgtggcaa gaaaacgtcc cgttgccagg tcctgatcga cgaggaaatc gtcgtgctgt 1980

ttgctggcga ccactacacg aaattcatat gggagaagta ccgcaagctg tcgccgacgg 2040

cccgacggat gttcgactat ttcagctcgc accgggagcc gtacccgctc aagctggaaa 2100

ccttccgcct catgtgcgga tcggattcca cccgcgtgaa gaagtggcgc gagcaggtcg 2160

gcgaagcctg cgaagagttg cgaggcagcg gcctggtgga acacgcctgg gtcaatgatg 2220

acctggtgca ttgcaaacgc tagggccttg tggggtcagt tccggctggg ggttcagcag 2280

ccagcgcctg atctggggaa ccctgtggtt ggcatgcaca tacaaatgga cgaacggata 2340

aaccttttca cgccctttta aatatccgat tattctaata aacgctcttt tctcttaggt 2400

ttacccgcca atatatcctg tcaaacactg atagtttaaa ccacttcgtg cagaagacaa 2460

ttgcagcgac taaatggagc aacctactgt ttttgaagtt tgggttgcca tgtaatcact 2520

tgcaataaat atatgtacta atgactgcat cggcttgcgt gtctaaattt gtagcttatt 2580

gaaaactttt tgtggttaaa gacgaatcca gttaactaac ataagtttaa caaaacaaga 2640

ccttttccat atatagacca ccgttaccaa cttacaaaga agccaaataa agtacaacac 2700

aacacttgca agttacaaaa agagaggaaa aaaaacatgg taccatttga caacatatag 2760

aaacacacat aaacattact tataacaaaa agattcaaac tcggctttta ttatctcccc 2820

ctgatcaaat tctaaacact ttattcctca taaactaact ccccgacatt ggagttattg 2880

gactatgacg atgacatcag tggggtaagc ttacttgtac agctcgtcca tgccgagagt 2940

gatcccggcg gcggtcacga actccagcag gaccatgtga tcgcgcttct cgttggggtc 3000

tttgctcagg gcggactggg tgctcaggta gtggttgtcg ggcagcagca cggggccgtc 3060

gccgatgggg gtgttctgct ggtagtggtc ggcgagctgc acgctgccgt cctcgatgtt 3120

gtggcggatc ttgaagttca ccttgatgcc gttcttctgc ttgtcggcca tgatatagac 3180

gttgtggctg ttgtagttgt actccagctt gtgccccagg atgttgccgt cctccttgaa 3240

gtcgatgccc ttcagctcga tgcggttcac cagggtgtcg ccctcgaact tcacctcggc 3300

gcgggtcttg tagttgccgt cgtccttgaa gaagatggtg cgctcctgga cgtagccttc 3360

gggcatggcg gacttgaaga agtcgtgctg cttcatgtgg tcggggtagc ggctgaagca 3420

ctgcacgccg taggtcaggg tggtcacgag ggtgggccag ggcacgggca gcttgccggt 3480

ggtgcagatg aacttcaggg tcagcttgcc gtaggtggca tcgccctcgc cctcgccgga 3540

cacgctgaac ttgtggccgt ttacgtcgcc gtccagctcg accaggatgg gcaccacccc 3600

ggtgaacagc tcctcgccct tgctcaccat tttttttgtt cttgtttact agagagaatg 3660

agattttgaa tgagagattg atcaaaaaga tgtgtatata ttttggaaga ggtaggagtg 3720

tttgttagat atattaagaa aggagacgag aagtcacgtg tcaatggaga catcatgcaa 3780

ttgtaggcca cgtgttaatg gcgtcaccat gcagccgctg catgtgttaa cgagaggagt 3840

ctattcaaag acacgtttgt tttttgccta gctcagaatg tggcgttggc atcgaaccga 3900

aacataaaac gcaaaacgaa cctttgggct cgtcagtatg ggtttgggcc ttcaatagat 3960

tccttctata cggcccacat atccactatt ggcaacaaaa ttagaaaaat ttaggattta 4020

gttttaaaat ttgttccgcg acattctccg gatcataact tcgtataatg tatgctatac 4080

gaagttataa ttcggcattg tcttcacaga gtggggccca ctgcatccac cccagtacat 4140

taaaaacgtc cgcaatgtgt tattaagttg tctaagcgtc aatttgttta caccacaata 4200

tatcctgcca ccagccagcc aacagctccc cgaccggcag ctcggcacaa aatcaccact 4260

cgatacaggc agcccatcag tcagatcagg atctcctttg cgacgctcac cgggctggtt 4320

gccctcgccg ctgggctggc ggccgtctat ggccctgcaa acgcgccaga aacgccgtcg 4380

aagccgtgtg cgagacaccg cggccgccgg cgttgtggat acctcgcgga aaacttggcc 4440

ctcactgaca gatgaggggc ggacgttgac acttgagggg ccgactcacc cggcgcggcg 4500

ttgacagatg aggggcaggc tcgatttcgg ccggcgacgt ggagctggcc agcctcgcaa 4560

atcggcgaaa acgcctgatt ttacgcgagt ttcccacaga tgatgtggac aagcctgggg 4620

ataagtgccc tgcggtattg acacttgagg ggcgcgacta ctgacagatg aggggcgcga 4680

tccttgacac ttgaggggca gagtgctgac agatgagggg cgcacctatt gacatttgag 4740

gggctgtcca caggcagaaa atccagcatt tgcaagggtt tccgcccgtt tttcggccac 4800

cgctaacctg tcttttaacc tgcttttaaa ccaatattta taaaccttgt ttttaaccag 4860

ggctgcgccc tgtgcgcgtg accgcgcacg ccgaaggggg gtgccccccc ttctcgaacc 4920

ctcccggccc gctaacgcgg gcctcccatc cccccagggg ctgcgcccct cggccgcgaa 4980

cggcctcacc ccaaaaatgg cagcgctggc caattcgtgc gcggaacccc tatttgttta 5040

tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg ataaatgctt 5100

caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc ccttattccc 5160

ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt gaaagtaaaa 5220

gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct caacagcggt 5280

aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt 5340

ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact cggtcgccgc 5400

atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa gcatcttacg 5460

gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga taacactgcg 5520

gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt tttgcacaac 5580

atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga agccatacca 5640

aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg caaactatta 5700

actggcgaac tacttactct agcttcccgg caacaattaa tagactggat ggaggcggat 5760

aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat tgctgataaa 5820

tctggagccg gtgagcgtgg ttctcgcggt atcattgcag cactggggcc agatggtaag 5880

ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga tgaacgaaat 5940

agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaa 5985

Claims (26)

1. A method of obtaining a plant DH line, comprising the steps of:

(A) Hybridizing by taking a parthenogenesis haploid induction line of a plant as a male parent and taking a dominant male sterile material or a photo-thermo-sensitive male sterile material or a sterile material subjected to chemical emasculation treatment of a heterozygous genotype of the plant or a material introduced with a dominant male sterile gene and an induction excision element as a female parent to obtain an F1 generation;

(B) Identifying and separating a haploid of female parent origin from the F1 generation obtained by the hybridization in the step (A);

(C) Carrying out chromosome doubling on the haploid from the female parent obtained in the step (B), and selecting a fertile material from a doubled plant to obtain a DH (DH) of the plant;

in the step (A), the introduction of the material carrying the dominant male-sterile gene and the induced excision element leads to male sterility under the condition of expression of the dominant male-sterile gene, and the dominant male-sterile gene can be excised after chemical induction to restore fertility;

the plant is a self-pollinating plant.

2. The method of claim 1, wherein:

the plant satisfies the following conditions: 1) Can realize dominant sterility or chemical male killing or photo-thermo-sensitive sterility; and 2) capable of achieving haploid induction.

3. The method of claim 1, wherein: the plant is a monocotyledon or a dicotyledon.

4. The method of claim 1, wherein: the plant is selected from wheat, rice, sorghum, barley, oat, soybean, pea, mung bean, peanut, sesame, potato, flax, tobacco, arabidopsis thaliana, rape, tomato, sunflower, cucumber, sweet potato, chinese cabbage, radish and carrot.

5. The method of claim 3, wherein: when the plant is a monocotyledonous plant, the parthenogenesis haploid inducer is a plant in which the PLA gene is silenced or inhibited or knocked out; when the plant is a dicotyledonous plant, the parthenogenesis haploid inducer is a plant in which the DMP gene is silenced or inhibited or knocked out.

6. The method of claim 5, wherein: when the plant is wheat; the parthenogenesis haploid inducer is wheat with a PLA gene silenced or inhibited or knocked out;

when the plant is barley; the parthenogenesis haploid inducer is barley with a PLA gene silenced or inhibited or knocked out;

when the plant is rice; the parthenogenesis haploid inducer is rice with a PLA gene silenced or inhibited or knocked out;

when the plant is oilseed rape; the parthenogenesis haploid induction line is rape with a DMP gene silenced or inhibited or knocked out;

when the plant is arabidopsis; the parthenogenesis haploid induction line is arabidopsis with a DMP gene silenced or inhibited or knocked out.

7. The method of claim 6, wherein: when the plant is wheat, the PLA gene isbase:Sub>A PLA-A gene inbase:Sub>A wheat A genome and/orbase:Sub>A PLA-B gene inbase:Sub>A wheat B genome and/orbase:Sub>A PLA-D gene inbase:Sub>A wheat D genome;

when the plant is barley, the PLA gene is a PLA gene in the barley genome;

when the plant is rice, the PLA gene is a PLA gene in a rice genome;

when the plant is rape, the DMP gene is a DMP1A gene, a DMP2A gene and/or a DMP2C gene in rape genome;

when the plant is arabidopsis thaliana, the DMP gene is a DMP8 gene and/or a DMP9 gene in an arabidopsis thaliana genome.

8. The method of claim 7, wherein: the sequence of the PLA-A gene in the wheat A genome is shown as SEQ ID No. 1; the sequence of the PLA-B gene in the wheat B genome is shown as SEQ ID No. 2; the sequence of the PLA-D gene in the wheat D genome is shown as SEQ ID No. 3;

the sequence of the PLA gene in the barley genome is shown as SEQ ID No. 4;

the sequence of the PLA gene in the rice genome is shown as SEQ ID No. 5;

the sequence of the DMP1A gene in the rape genome is shown as SEQ ID No. 7; the sequence of the DMP2A gene in the rape genome is shown as SEQ ID No. 8; the sequence of the DMP2C gene in the rape genome is shown as SEQ ID No. 9;

the sequence of the DMP8 gene in the arabidopsis genome is shown as SEQ ID No. 16; the sequence of the DMP9 gene in the arabidopsis genome is shown as SEQ ID No. 17.

9. The method of claim 7, wherein: in the method, when the plant is wheat, the PLA gene in the wheat genome is silenced or inhibited or knocked out to be a mutant PLA gene in the wheat genome, so that the expression level of the PLA gene in the wheat genome is reduced, or the PLA gene in the wheat genome is subjected to deletion mutation or insertion mutation or base substitution;

in the method, when the plant is barley, the silencing or inhibiting or knocking out the PLA gene in the barley genome is carried out to mutate the PLA gene in the barley genome so that the expression level of the PLA gene in the barley genome is reduced or the PLA gene in the barley genome is subjected to deletion mutation or insertion mutation or base substitution;

in the method, when the plant is rice, the PLA gene in the rice genome is silenced or inhibited or knocked out to be a mutant PLA gene in the rice genome, so that the expression quantity of the PLA gene in the rice genome is reduced, or the PLA gene in the rice genome is subjected to deletion mutation or insertion mutation or base substitution;

in the method, when the plant is rape, the DMP gene in the rape genome is silenced or inhibited or knocked out, namely the DMP gene in the mutant rape genome reduces the expression level of the DMP gene in the rape genome or causes the DMP gene in the rape genome to generate deletion mutation or insertion mutation or base substitution;

in the method, when the plant is arabidopsis thaliana, the DMP gene in the genome of the arabidopsis thaliana is silenced or inhibited or knocked out, so that the expression level of the DMP gene in the genome of the arabidopsis thaliana is reduced or the DMP gene in the genome of the arabidopsis thaliana is subjected to deletion mutation, insertion mutation or base substitution.

10. The method of claim 9, wherein: the deletion mutation or insertion mutation or base substitution of the PLA gene in the wheat genome is realized by a CRISPR/Cas9 technology;

the deletion mutation or insertion mutation or base substitution of the PLA gene in the barley genome is realized by a CRISPR/Cas9 technology;

the deletion mutation or insertion mutation or base substitution of the PLA gene in the rice genome is realized by a CRISPR/Cas9 technology;

the deletion mutation or insertion mutation or base substitution of the DMP gene in the rape genome is realized by a CRISPR/Cas9 technology;

the deletion mutation or insertion mutation or base substitution of the DMP gene in the arabidopsis genome is realized by a CRISPR/Cas9 technology.

11. The method of claim 10, wherein: when the plant is wheat, the target sequence of the CRISPR/Cas9 is SEQ ID No.6;

when the plant is rape, the target sequence of the CRISPR/Cas9 is SEQ ID No.10, SEQ ID No.11, SEQ ID No.12 and/or SEQ ID No.13;

when the plant is arabidopsis thaliana, the target sequence of CRISPR/Cas9 is SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, and/or SEQ ID No.21.

12. The method of claim 1, wherein: in the step (A), the dominant male sterile gene carried in the dominant male sterile material of the heterozygous genotype as the female parent is MS2 gene; the genotype of the dominant male sterile material of the heterozygous genotype is MS2MS2;

in the step (A), the photo-thermo-sensitive male sterile material is a photosensitive, thermo-sensitive or photo-temperature interactive male sterile material, and shows male sterility in a specific photo-temperature environment;

in the step (A), the sterile material subjected to chemical emasculation treatment is a material which is in a stamen-stamen differentiation stage in a growth period and is subjected to male sterility caused by spraying a chemical emasculation agent on leaf surfaces.

13. The method of claim 12, wherein: in the step (A), dominant male sterile material of heterozygous genotype as the female parent is prepared according to the method comprising the following steps (a 1) or (a 2):

(a1) Hybridizing the Taigu genic sterile wheat with the genotype of 'rhtrht, MS2MS 2' with the common wheat with the genotype of 'rhtrht, MS2MS 2' to obtain an F1 generation of the genotype of 'rhtrht, MS2MS 2' as a dominant male sterile material of the heterozygous genotype of the female parent in the step (A);

(a2) Hybridizing dwarf-male-sterile wheat with the genotype of Rhtrht, MS2MS2 with common wheat with the genotype of Rhtrht, MS2MS2 to obtain an F1 generation of the genotype of Rhtrht, MS2MS2, which is the dominant male sterile material of the heterozygous genotype used as the female parent in the step (A).

14. The method of claim 12, wherein: in the step (A), the dominant male sterile material of the heterozygous genotype used as the female parent is a heterozygous photo-thermo-sensitive cell nucleus male sterile material Mmsrfrf controlled by double genes.

15. The method of claim 12, wherein: in the step (A), the female parent is prepared according to a method comprising the following steps: constructing a vector which can express a sterile gene and comprises a Cre/loxP recombinase and an LhGR/pOp6 chemical induction system, transferring the vector into the plant, and obtaining a positive transgenic plant which is the female parent.

16. The method of claim 12, wherein: in the step (A), the photo-thermo-sensitive male sterile material as the female parent is prepared according to the following method: the light-temperature sensitive sterile material controlled by recessive gene is hybridized with the material with normal fertility, F1 shows that the material is all fertile, F1 selfing progeny generates fertility separation at low temperature in a short day, and the separation ratio of fertile plants to sterile plants is 3: the sterile plant in the 1,F1 selfing progeny is the female parent.

17. The method of claim 12, wherein: in the step (A), the sterile material which is used as the female parent and is subjected to chemical male killing treatment is obtained by spraying a chemical male killing agent.

18. The method of claim 13, wherein: in the step (a 1), after the Taigu genic sterile wheat with the genotype of 'rhtrht, MS2MS 2' and the common wheat with the genotype of 'rhtrht, MS2MS 2' are hybridized, fertile plants and sterile plants in the F1 generation are distinguished according to the ear morphology before flowering, the fertile plants are removed, and the rest sterile plants are the F1 generation with the genotype of 'rhtrht, MS2MS 2';

in the step (a 2), after the dwarf-male-sterile wheat with the genotype of rhtrrht and MS2MS2 and the common wheat with the genotype of Rhtrht and MS2MS2 are hybridized, all high-stalk plants in the F1 generation are removed, and the remaining dwarf-stalk plants are the F1 generation with the genotype of Rhtrht and MS2MS2.

19. The method of claim 16, wherein: the photo-thermo-sensitive male sterile material as the female parent is thermo-sensitive male sterile rape polTCMS.

20. The method according to any one of claims 1-19, wherein: in step (a), the female parent and the male parent meet at flowering time.

21. The method according to any one of claims 1-19, wherein: in the step (A), the hybridization mode is a mode of open pollination in an isolation area or a mode of single plant bagging hybridization.

22. The method according to any one of claims 1-19, wherein: in the step (B), the method for identifying a maternal-derived haploid includes any one of the following:

(b1) And (3) carrying out fluorescence identification on the haploid from the female parent: if the parthenogenesis haploid inducer line as the male parent expresses fluorescent protein, and the dominant male sterile material of the heterozygous genotype as the female parent does not express fluorescent protein, selecting a plant without fluorescent characteristics from the F1 generation obtained by the hybridization in the step (A), namely, the haploid from the female parent;

(b2) Identification of haploid by molecular marker: identifying by utilizing polymorphic molecular markers between a male parent and a female parent, and selecting a plant with a female parent banding pattern from the F1 generation obtained by the hybridization in the step (A), wherein the plant is or is a candidate of a haploid from the female parent;

(b3) Flow cytometry for leaf ploidy: extracting wheat leaf cell nucleuses, carrying out flow cytometry detection, and selecting plants with cell nucleus signal peak positions half of those of hexaploid wheat cell nucleus from F1 generations obtained by hybridization in the step (A), wherein the plants are haploids from female parents; or extracting rape leaf cell nucleuses, carrying out flow cytometry detection, and selecting plants with cell nucleus signal peak positions half of those of tetraploid rape cell nucleus signals from the F1 generation obtained by the hybridization in the step (A), namely the haploid from the female parent; or extracting the cell nucleus of the arabidopsis thaliana leaf, carrying out flow cytometry detection, and selecting a plant with a cell nucleus signal peak position being half of the cell nucleus signal peak position of the diploid arabidopsis thaliana from the F1 generation obtained by the hybridization in the step (A), namely the haploid from the female parent.

23. The method according to any one of claims 1-19, wherein: in the step (C), the haploid from the female parent is processed by colchicine to realize chromosome doubling.

24. The method of claim 23, wherein: in step (C), the selection of fertile material from the doubled plants is performed according to a method comprising the following steps (C1) or (C2):

(c1) If the dominant male sterile material of said heterozygous genotype as the female parent in step (a) is prepared according to step (a 1) in claim 13 or 18, distinguishing fertile plants and sterile plants according to ear morphology before flowering in step (C), and removing sterile plants;

(c2) If dominant male sterile material of said heterozygous genotype used as the female parent in step (a) is prepared according to step (a 2) of claim 13 or 18, dwarf plants are removed in step (C).

25. Use of the method of any one of claims 1 to 24 in plant breeding.

26. Any one of the following methods:

the method I comprises the following steps: a breeding method suitable for a plant, comprising the steps (a) to (C) of any one of claims 1 to 8;

method II: a method of haploid induction in a plant comprising steps (a) and (B) of any one of claims 1 to 8.

Images