CN112143735B - Male sterile gene, protein, carrier, engineering bacterium of brassica napus and application thereof - Google Patents
Male sterile gene, protein, carrier, engineering bacterium of brassica napus and application thereof Download PDFInfo
- Publication number
- CN112143735B CN112143735B CN202010903840.4A CN202010903840A CN112143735B CN 112143735 B CN112143735 B CN 112143735B CN 202010903840 A CN202010903840 A CN 202010903840A CN 112143735 B CN112143735 B CN 112143735B
- Authority
- CN
- China
- Prior art keywords
- gene
- rape
- bnms5
- brassica napus
- sterile
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a male sterility gene BnMS5 of brassica napus f Protein, carrier, engineering bacteria and application thereof. The nucleotide sequence of the gene is shown in SEQ ID NO. 1. The gene BnMS5 of the invention f Can be used as a functional gene for regulating the development of rape male gametes and applied to the creation of a rape genetic engineering male sterile system.
Description
Technical Field
The invention relates to the technical field of biological breeding, in particular to a male sterility gene BnMS5 of brassica napus f Protein, carrier, engineering bacteria and application thereof.
Background
At present, male sterile systems for rape heterosis utilization in China are mainly cytoplasmic male sterile systems and nuclear male sterile systems, but the cytoplasmic male sterile systems are unsatisfactory in rape production application. The sterility of the nucleus male sterile system is stable and thorough, the potential risks of negative effect of sterile cytoplasm and cytoplasm simplification do not exist, the restriction of restoring and maintaining relation is generally avoided, strong advantage combination is easy to obtain, and the method has wide prospect in heterosis utilization. In recent years, China continuously makes breakthroughs in the field of rape male sterility research, and the development of a large number of rape fertility-related molecular markers and the cloning and function research of fertility-related genes not only promote the application of male sterility in rape heterosis utilization, but also point forward the research and application of light-and temperature-sensitive male sterility of rape.
The restorer genes BnMs1 and BnMs2 of rape recessive nuclear sterility S45AB (Yi B, Zeng FQ, Lei SL, Chen YN, Yao XQ, Zhu Y, Wen J, Shen JX, Ma CZ, Tu JX, Fu TD.two dual CYP704B 1-homologus genes BnMs1 and BnMs2 are required for polar expression and target level expression in plant J.2010,6:925 Brass 938) were successfully cloned in rape by Yi et al for the first time by using map-based cloning. The sterile gene BnMs3 of the rape recessive epistatic interacting male sterile line 9012A is homologous with an Arabidopsis gene AtTIC40, and the BnMs3 gene is mainly involved in development of the rape stamen tapetum (Dun XL, Zhou ZF, Xia SQ, Wen J, Yi B, Shen JX, Ma CZ, Tu JX, Fu TD.BnaC.TiC40, a planar inner membrane transfer addressing from branched algorithm, is for target function and micro destination function in viral gene J.68: 532: 2011J, Hong DF, He 2012, Ma L, Wan LL, Liu PW, Yang-based cloning of a genetic gene coding of molecular gene, 234.223: 234. major gene coding gene of molecular gene, 125. K.125. the BnMs3 gene is mainly involved in development of rape tapetum development of male sterile line;dun XL, Shen WH, Zhou ZF, Xia SQ, Wen J, Yi B, Shen JX, Ma CZ, Tu JX, Fu TD, Lagercantz U.Neoformulation of purified Tic40 genes used a gain-of-function variation related to mass transfer in Brassica oleracea lines.plant physical.2014, 166:1403 1419). Further research shows that fertility of 9012A is only controlled by interaction of 2 loci (Bnms3 and Bnrf), and multiple alleles (Dong, Hongteng, Liuping Wu, Xiyan Yanzhou, He Qing Biao, Yanguang san. cabbage type rape recessive cell nucleus male sterile line 9012AB genetic pattern is newly released, Huazhong agriculture university report, 2010,29(3): 262-267; Shang Feng, Xiasheng, Duanluoling, Zhongzheng Fu, Zangqin, Yibin, Wenzhen, Ma Kong Zhi, Shenjin, Tanjing, Fu Lingtian. molecular marker-based rape recessive cell nucleus sterility 7-7365AB genetic pattern research, China agriculture science, 2010,43(15): 3067-3067 3075) are arranged between BnMs4, Bnrf and Bnrf. Later on, the function and mechanism of action of BnRf gene was analyzed based on the successful cloning of BnRf gene, and the relationship among BnMs4, BnRf and Bnrf was clarified (Deng ZH, Li X, Wang ZZ, Jiang YF, Wan LL, Dong FM, Chen FX, Hong DF, Yang GS. map based cloning recovery of the BnRf cloning and leaves to the identification of BnRfb, a major stability gene, in Brassica napus. applied gene. 2016,129(1): 53-64; Xia, Wang ZX, Zhang, Hu KN, Zhang ZQ, Qin 206XL, Yi B, Wen J, Shen J, Jen X, J, K of transform Zhang gene, M2070. M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.M.. The fertility of the rape dominant nuclear male sterile line, preferably 3A (or the sterile line transferred by the rape dominant nuclear male sterile line) is controlled by three multiple alleles at the same locus, BnMS5 a (restorer gene), BnMS5 b (sterile genes) and BnMS5 c (normally fertile or temporary maintainer genes) and the dominant-recessive relationship between these 3 alleles is BnMS5 a >BnMS5 b >BnMS5 c (Loevec. cloning of Gene BnMS5a restoring the male sterility of Brassica napus karyon & lt. & gt, doctor's academic paper]Wuhan Huazhong university of agriculture, 2013). Xin and the like successfully clone sterile gene BnMS5 suitable for 3A b And restoring gene BnMS5 a Sterile gene BnMS5 b Is BnMS5 a Deletion mutations caused by transposon insertions in intron regions, BnMS5 a Gene energy recovery sterile line (BnMS 5) b ) Fertility (Xin Q, Shen Y, Li X, Lu W, Wang X, Han X, Dong FM, Wan LL, Yang GS, Hong DF, Cheng ZK.MS5 media early mechanical progress and quality biological variables major cellular activities for hybrid production in Brassica napus.plant.2016, 28: 1263-. Meanwhile, Zeng et al successfully cloned the sterile gene BnMS5 of thermo-sensitive cell nucleus dominant sterile line TE5A d (Zeng XH, Yan XH, Yuan R, Li KQ, Wu YH, Liu F, Luo JL, Li J, Wu G.identification and analysis of MS5d: A gene that is produced by microorganisms double-strand break (DSB) repair reducing microorganisms I in Brassica napus microorganisms. front.plant Sci.2016,7: e 1006). However, either BnMS5 b Or BnMS5 d The male sterility of rape is affected by temperature, and pollen is produced at low temperature.
Disclosure of Invention
The invention aims to provide a male sterility gene BnMS5 of brassica napus f Protein, carrier, engineering bacteria and application thereof. The gene BnMS5 of the invention f The functional gene can be used as a functional gene for regulating the development of rape male gametes and applied to the creation of a rape genetic engineering male sterile system, the fertility of the obtained transgenic rape is not influenced by temperature, the transgenic rape is thoroughly sterile, no micro powder exists, and the vegetative growth of the transgenic rape is completely normal.
The invention provides a male sterility gene BnMS5 of Brassica napus f The nucleotide sequence of the gene is shown as SEQ ID NO. 1.
The invention also provides the gene BnMS5 in the technical scheme f The amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.
The invention also provides an expression cassette, an expression vector or a cloning vector containing the gene in the technical scheme.
The invention also provides an engineering bacterium or a transgenic cell line containing the gene or the expression cassette, the expression vector or the cloning vector of the technical scheme.
The invention also provides the application of the gene in the technical scheme in the preparation of transgenic plants.
The invention also provides the application of the gene in the technical scheme in the improvement of rape and other crop varieties.
The invention also provides the application of the gene in the technical scheme in the creation of a male sterile system of rape genetic engineering.
The invention also provides application of the gene in the technical scheme in regulation and control of development of rape male gametes.
The invention provides a male sterility gene BnMS5 of Brassica napus f . The gene BnMS5 of the invention f The functional gene can be used as a functional gene for controlling the development of rape male gametes to be applied to the creation of a rape genetic engineering male sterile system, the fertility of the obtained transgenic rape is not influenced by temperature, the transgenic rape is sterile thoroughly, no micro powder exists, the vegetative growth of the transgenic rape is completely normal, and the transgenic rape can be used for hybrid seed production in the rape heterosis utilization process and can also be used for rape recurrent selection.
Drawings
FIG. 1 shows the setting of brassica napus E2B and E2A;
FIG. 2 shows the expression vector pC2300-BnMS5 for the complementation test of Brassica napus function f The construction diagram of (1);
FIG. 3 is T with TK5 genetic background 0 Comparison of the fertility phenotype after flowering of transgenic brassica napus plants with the TK5 phenotype.
Detailed Description
The invention provides a male sterility gene BnMS5 of Brassica napus f The nucleotide sequence of the gene is shown as SEQ ID NO.1 (ATGAGTAATTCTGCGCCTGGAGGGTCGATGAAGAGGAAGGGGGGTGGGCGTAAGCGTAATCCAGATGAGCTAATTGTTGTTGATTCCGAGTATCGTGCGCCAGGACGTTCATATCGGCGCTTGAAAAAGAAGCGAGAGGCTCGCCGTAAGGCTCAGAGGGAGGAGATTTATCGAAGAGAAGAAGAGACTATTCGTAAGGCCGAGGAGGTTTTTTGGCGTAAAGTGGATGAAACAGATGGCTTCGATATCGAGATCGAGGGTGCTCCTTGTTATTTTGGTGGTATGAGTGTTTATAAAGGTGGAGTAGATTGTCCCCTTGTAGTGAAGCTTTATGCAACGGTGGGACTTCATCGTTACAATATGCTAGAGGGGACCAACTTGTATCTTCACAAAATAGAGAAATACGTTGTAGTTTGCACCCTCATGCCTGTCTCGTATAACATTACTTTGATTGCT)GAGGATCCAGCTACCTCCTCCTTTGTTGTTTTCGAGACTAATGTTGACCAAAGAAGTTTAGGCCAGATTGATTTCACTTGTTATATCTCAAGACCTAAAGGGATCAAGAGTGAGATTTATCCGAACCAGTTCTTCGATGCCAAGGACTTGCCTGACAAGTGGCCTTCAAAGGAGGCTTTTGCTGATCAAAGTCGATTTTTGTACAAGATGCAGAAATCAGATTGGGAAGAACATGACTGGATTCGCTTGTATATGGAAATTTCATTCTTTAACAGAGATAGGTGTCTGGATCACAACATGTCTGATTTAAAGATTTTGGACGTAGTGGTAGAGACTGAGGAAAATGTGCCACGTGAGACTGTACTCAAGAGTCTTAGGAATGTCCTTGTCTACATAAGATATGATCAAGACTTGGGAGCGGATGGTGTTTGCAAACACATAGCCATTGTTCGAAGAACTGTCGAGCCGACAACTCACTGCGTTTGTCTCTTGGGCGAGTCTCAGCTTGTGCCCGACTCTGAGTAA)。
The invention obtains a BnMS5f function deletion mutant (genetic stable male sterile mutant (cabbage type rape male sterile mutant E2A)) through Ethyl Methane Sulfonate (EMS) mutagenesis, and the mutant shows that the vegetative growth of plants is normal, the male sterility of the plants is 100 percent of the abortion of pollen and the development of female gametes is abnormal in a field planting environment. The meiotic tabletting results show that BnMS5 is responsible f The loss of function severely affects the behavior of chromosomes in the meiosis process, and finally causes microspore development defects. Gene BnMS5 f Can be used as a functional gene for regulating the development of rape male gametes and applied to the creation of a rape genetic engineering male sterile system.
The male sterility gene BnMS5 of the cabbage type rape f The cDNA sequence of the gene is shown in SEQ ID NO.1, and the gene and the cDNA sequence thereof can be obtained by an artificial synthesis mode.
The invention also provides the gene BnMS5 in the technical scheme f The amino acid sequence of the encoded protein is shown as SEQ ID NO.2 (MSNSAPGGSMKRKGGGRKRNPDELIVVDSEYRAPGRSYRRLKKKREARRKAQREEIYRREEETIRKAEEVFWRKVDETDGFDIEIEGAPCYFGGMSVYKGGVDCPLVVKLYATVGLHRYNMLEGTNLYLHKIEKYVVVCTLMPVSYNITLIAEDPATSSFVVFETNVDQRSLGQIDFTCYISRPKGIKSEIYPNQFFDAKDLPDKWPSKEAFADQSRFLYKMQKSDWEEHDWIRLYMEISFFNRDRCLDHNMSDLKILDVVVETEENVPRETVLKSLRNVLVYIRYDQDLGADGVCKHIAIVRRTVEPTTHCVCLLGESQLVPDSE).
The invention also provides an expression cassette, an expression vector or a cloning vector containing the gene in the technical scheme. The expression vectors of the invention are preferably introduced into Plant cells by conventional biotechnological methods using Ti plasmids, Plant viral vectors, direct DNA transformation, microinjection or electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, academic Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology, 2nd Edition).
The invention also provides an engineering bacterium or a transgenic cell line containing the gene in the technical scheme or the expression cassette, the expression vector or the cloning vector in the technical scheme.
The invention also provides the application of the gene in the technical scheme in the preparation of transgenic plants.
The invention also provides the application of the gene in the technical scheme in the improvement of rape and other crop varieties.
The invention also provides the application of the gene in the technical scheme in the creation of a male sterile system of rape genetic engineering.
The invention also provides application of the gene in the technical scheme in regulation and control of development of rape male gametes.
The following description will discuss the male sterility gene BnMS5 of Brassica napus according to the present invention with reference to the specific embodiments f The protein, the carrier, the engineering bacteria and the application thereof are further described in detail, and the technical scheme of the invention comprises but is not limited to the following examples.
The following detailed description is made with reference to the accompanying drawings and examples. The experimental methods in the following examples, in which specific conditions are not specified, are generally performed according to conventional conditions such as "molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory, 1989), or according to the conditions suggested in the operating manual supplied by the manufacturer.
Example 1
Analysis of genetic rule of dominant sterile material of cabbage type rape cell nucleus
1. Experimental Material
The sterile strain was designated E2A and the fertile strain was designated E2B. EMS mutagenesis is carried out on the Brassica napus inbred line TE5 to obtain 1 sterile individual plant E2A (the sterile plant is called E2A, and the fertile plant is called E2B), and the sterile plant is used forThe single plant is hybridized with Zhongshuang No. 11, and the Zhongshuang No. 11 is used as a recurrent parent for backcross to obtain an isogenic line. And BnMS5 b And BnMS5 d The male sterility of rape caused by gene is affected by different temperatures, and after the rape is treated at different temperatures in the flowering period, the fertility of sterile single plant E2A is not affected by temperature, the sterility is thorough, no micropowder exists, but the vegetative growth is completely normal. Sterile strain E2A has poor fruit set and is basically not fruit set under the condition of artificial supplementary pollination or natural pollination (figure 1, the fruit set conditions of Brassica napus E2B and E2A, wherein A is E2B siliques, and B is E2A siliques), which indicates that the development of female gametes is also influenced, thereby causing female abortion.
2. Genetic rule of cell nucleus dominant sterile material
Adopting a classical genetics method to hybridize the sterile material E2A with the double 11 in the fertility normal cabbage type rape 1 And backcrossing the segregating populations for analysis. The results of the test showed (table 1): the sterility character of the sterile material E2A is controlled by a pair of dominant nuclear genes.
TABLE 1 genetic analysis of dominant nuclear male sterile line E2A
Example 2
Dominant nuclear sterile gene BnMS5 of brassica napus f And BnMS5 d Allelic analysis of
Zeng et al (Xinhua Zeng, Wenpin Li, Yuhua Wu, Fan Liu, Junling Luo, Yinglong Cao, Li Zhu, Yunjing Li, Jun Li, Qingbo You, gan Wu.Fine mapping of a negative thermal-sensitive genetic code (BntsMs) in rapeseed with AFLP-and Brassica rapa-derivative PCR markers. the application gene t.2014,127: 1733- d . To verify whether the sterile gene E2A is related to BnMS5 d The invention utilizes homozygous E2A sterile line and homozygous TE5A (genotype is BnMS 5) which can be fertile under low temperature condition d BnMS5 d ) Hetero compoundCrossing to obtain F 1 . F is to be 1 Planting in greenhouse, maintaining stable at 25 deg.C in flowering period, and observing F after flowering 1 Plant fertility, F 1 All showed complete sterility. Using F 1 Sterile plants are used as female parent, double No. 11 in the brassica napus maintainer line is used as male parent for hybridization, and BC is harvested 1 And (4) seeds. Mixing BC 1 Planting in greenhouse, maintaining stable 25 deg.C in flowering period, and investigating 200 BC plants after flowering 1 Group fertility, results show BC 1 All the individuals of the group are sterile and have no fertile plants. The result shows that the sterile gene E2A and the sterile gene BnMS5 in the thermo-sensitive cell nucleus male sterile line TE5A d Allelic or close linkage.
Dominant nuclear sterile gene BnMS5 of brassica napus f Isolation and cloning of
Using bioinformatics analysis, based on Brassica napus BnMS5 d Genome sequence information, design primer SA-1L (forward primer): CTATTAATAAATTAATGACTCAGCT (SEQ ID NO. 3); and SA-1R (reverse primer): CCAAGAAGAGAATTGATTCCACA (SEQ ID NO. 4). Extracting genome DNA of sterile line of Brassica napus E2A, using the extracted genome DNA as a template, utilizing ZT-1L and ZT-1R primers to carry out PCR amplification, recovering amplification products, cloning and sequencing, and displaying the result that the cloned target gene coding frame sequence and the cloned genome sequence are both equal to BnMS5 d The gene sequences are highly homologous.
Example 3
Dominant nuclear sterile gene BnMS5 of brassica napus f Function verification of
1、BnMS5 f Transgenic experiment of rape
In this example, plant expression vector pCAMBIA2300 was used as a transgene vector for Brassica napus. The vector encodes a bacterial origin of replication (ori), kanamycin resistance gene (Kan'), CaMV35S promoter, terminator for NOS gene and restriction endonuclease multiple cloning site. A3.951 kb fragment was obtained by analyzing the relationship between the restriction site of the BAC clone sequence carrying the candidate gene and the candidate gene, and amplifying the fragment by using the primer ZT-1L, ZT-1R and the High Fidelity PCR technique (PhusionTM High-Fidelity DNA polymerase from New England Biolads Co.),
ZT-1L (forward primer): CCGGAATTCCTATTAATAAATTAATGACTCAGCT (SEQ ID NO. 5);
ZT-1R (reverse primer): CAACTGCAGCCAAGAAGAGAATTGATTCCACA (SEQ ID NO. 6).
This fragment contains the Ecol I and Pst I cleavage sites. The fragment comprises a sequence of 1,417bp of an upstream untranslated region of the gene, a sequence of 1,394bp of a gene interval and a sequence of 1,124bp of a downstream untranslated region. The amplified fragment was recovered with a gel recovery kit (purchased from Shanghai Bioengineering Co., Ltd.), and 3.94kb fragment was recovered after double digestion with Ecol I and Pst I, and ligated to the expression vector pCAMBIA2300 digested with Ecol I and Pst I (FIG. 2, Brassica napus functional complementation test expression vector pC2300-BnMS 5) f The construction map of (b), the ligation product transforms an escherichia coli strain DH5 alpha, transformants are screened on an LB culture medium containing 50ug/ml kanamycin, a single colony is selected to extract plasmids, the nucleotide sequence is determined to be completely correct by sequencing detection, and a vector pc2300-BnMS5 of a transformed plant is successfully constructed f (FIG. 2). The correct recombinant plasmid was introduced into Agrobacterium strain GV1301 by freeze-thaw method. The rape genetic transformation adopts a conventional agrobacterium transformation method to transform rape TE5, the seeds are sterilized, the seeds are soaked in alcohol with the concentration of 70 percent for 15min, the mercuric chloride with the concentration of 0.1 percent is sterilized for 15min, the sodium hypochlorite with the concentration of 20 percent to 30 percent is sterilized for 15min, and the seeds are washed for 3 times with sterile water at intervals of 5 min. The sterilized seeds were sown in Medium0 Medium (formula shown in Table 2) and incubated at 25 ℃ for 7 days in the dark. Cutting the hypocotyl of the obtained test-tube seedling into small sections of 0.5-0.8 cm in an ultraclean workbench, inoculating the small sections onto Medium 1 (formula shown in table 2) containing agrobacterium (suspended overnight to logarithmic phase) for dip-dyeing for 25-30 min, sucking the liquid, and co-culturing for 3d in dark at 25 ℃. The explants are transferred to callus induction Medium (formula shown in table 2) on Medium 2, and are cultured for 15-18 days at 25 ℃ in the light. Transferring the explants to a differentiation Medium on Medium 3 for culture, and subculturing for 1 time every 15-18 days until seedlings are differentiated. When the seedlings grow to 2-3 cm high, the seedlings are transferred to a Medium 4 rooting culture Medium for culture. After the transformed plants had rooted, they were temporarily planted in fine soil paper cups mixed with humus soil, maintained at 70% relative humidity, and moved to the field one month later.
Positive plants were extracted and total DNA from leaves was extracted, and transformed plants were further identified by PCR using the primers NPT-F (5'-ACTGGGCACAACAGACAATCG-3', SEQ ID NO.7) and NPT-R (5'-GCATCAGCCATGATGGATACTTT-3', SEQ ID NO. 8). Using transgenic T 0 And observing the expression of fertility, and verifying whether the introduced candidate gene has a male sterility function. The results showed that 20 transgenic T strains 0 Of the generations, 5 showed shortened filaments, shriveled anthers, deteriorated anthers, and aborted anthers (see FIG. 3, a graph of the fertility phenotype of flowering T0 genetically transformed Brassica napus plants with TE5 genetic background versus TE5 phenotype; TE5 genetically transformed T 0 The generation plant carries dominant gene BnMS5 f The candidate gene shows that the filaments are degenerated, the fertility is aborted, and KI dyeing does not have normal pollen; a, B are the forms of transgenic male sterile rape and normal fertile rape flower; c, normal rape pollen potassium iodide staining; d is potassium iodide staining of transgenic male sterile rape pollen).
TABLE 2 formulation of various media used in the genetic transformation step
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> institute of oil crop of academy of agricultural sciences of China
<120> male sterile gene, protein, vector, engineering bacterium of brassica napus and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 981
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgagtaatt ctgcgcctgg agggtcgatg aagaggaagg ggggtgggcg taagcgtaat 60
ccagatgagc taattgttgt tgattccgag tatcgtgcgc caggacgttc atatcggcgc 120
ttgaaaaaga agcgagaggc tcgccgtaag gctcagaggg aggagattta tcgaagagaa 180
gaagagacta ttcgtaaggc cgaggaggtt ttttggcgta aagtggatga aacagatggc 240
ttcgatatcg agatcgaggg tgctccttgt tattttggtg gtatgagtgt ttataaaggt 300
ggagtagatt gtccccttgt agtgaagctt tatgcaacgg tgggacttca tcgttacaat 360
atgctagagg ggaccaactt gtatcttcac aaaatagaga aatacgttgt agtttgcacc 420
ctcatgcctg tctcgtataa cattactttg attgctgagg atccagctac ctcctccttt 480
gttgttttcg agactaatgt tgaccaaaga agtttaggcc agattgattt cacttgttat 540
atctcaagac ctaaagggat caagagtgag atttatccga accagttctt cgatgccaag 600
gacttgcctg acaagtggcc ttcaaaggag gcttttgctg atcaaagtcg atttttgtac 660
aagatgcaga aatcagattg ggaagaacat gactggattc gcttgtatat ggaaatttca 720
ttctttaaca gagataggtg tctggatcac aacatgtctg atttaaagat tttggacgta 780
gtggtagaga ctgaggaaaa tgtgccacgt gagactgtac tcaagagtct taggaatgtc 840
cttgtctaca taagatatga tcaagacttg ggagcggatg gtgtttgcaa acacatagcc 900
attgttcgaa gaactgtcga gccgacaact cactgcgttt gtctcttggg cgagtctcag 960
cttgtgcccg actctgagta a 981
<210> 2
<211> 326
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ser Asn Ser Ala Pro Gly Gly Ser Met Lys Arg Lys Gly Gly Gly
1 5 10 15
Arg Lys Arg Asn Pro Asp Glu Leu Ile Val Val Asp Ser Glu Tyr Arg
20 25 30
Ala Pro Gly Arg Ser Tyr Arg Arg Leu Lys Lys Lys Arg Glu Ala Arg
35 40 45
Arg Lys Ala Gln Arg Glu Glu Ile Tyr Arg Arg Glu Glu Glu Thr Ile
50 55 60
Arg Lys Ala Glu Glu Val Phe Trp Arg Lys Val Asp Glu Thr Asp Gly
65 70 75 80
Phe Asp Ile Glu Ile Glu Gly Ala Pro Cys Tyr Phe Gly Gly Met Ser
85 90 95
Val Tyr Lys Gly Gly Val Asp Cys Pro Leu Val Val Lys Leu Tyr Ala
100 105 110
Thr Val Gly Leu His Arg Tyr Asn Met Leu Glu Gly Thr Asn Leu Tyr
115 120 125
Leu His Lys Ile Glu Lys Tyr Val Val Val Cys Thr Leu Met Pro Val
130 135 140
Ser Tyr Asn Ile Thr Leu Ile Ala Glu Asp Pro Ala Thr Ser Ser Phe
145 150 155 160
Val Val Phe Glu Thr Asn Val Asp Gln Arg Ser Leu Gly Gln Ile Asp
165 170 175
Phe Thr Cys Tyr Ile Ser Arg Pro Lys Gly Ile Lys Ser Glu Ile Tyr
180 185 190
Pro Asn Gln Phe Phe Asp Ala Lys Asp Leu Pro Asp Lys Trp Pro Ser
195 200 205
Lys Glu Ala Phe Ala Asp Gln Ser Arg Phe Leu Tyr Lys Met Gln Lys
210 215 220
Ser Asp Trp Glu Glu His Asp Trp Ile Arg Leu Tyr Met Glu Ile Ser
225 230 235 240
Phe Phe Asn Arg Asp Arg Cys Leu Asp His Asn Met Ser Asp Leu Lys
245 250 255
Ile Leu Asp Val Val Val Glu Thr Glu Glu Asn Val Pro Arg Glu Thr
260 265 270
Val Leu Lys Ser Leu Arg Asn Val Leu Val Tyr Ile Arg Tyr Asp Gln
275 280 285
Asp Leu Gly Ala Asp Gly Val Cys Lys His Ile Ala Ile Val Arg Arg
290 295 300
Thr Val Glu Pro Thr Thr His Cys Val Cys Leu Leu Gly Glu Ser Gln
305 310 315 320
Leu Val Pro Asp Ser Glu
325
<210> 3
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctattaataa attaatgact cagct 25
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccaagaagag aattgattcc aca 23
<210> 5
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccggaattcc tattaataaa ttaatgactc agct 34
<210> 6
<211> 32
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
caactgcagc caagaagaga attgattcca ca 32
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
actgggcaca acagacaatc g 21
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gcatcagcca tgatggatac ttt 23
Claims (8)
1. Male sterile gene BnMS5 of brassica napus f The gene is characterized in that the nucleotide sequence of the gene is shown as SEQ ID NO. 1.
2. The method of claim 1Gene BnMS5 f The coded protein is characterized in that the amino acid sequence of the protein is shown as SEQ ID NO. 2.
3. An expression cassette, expression vector or cloning vector comprising the gene of claim 1.
4. An engineered bacterium or transgenic cell line comprising the gene of claim 1 or the expression cassette, expression vector or cloning vector of claim 3.
5. Use of the gene of claim 1 for the preparation of transgenic plants.
6. The use of the gene of claim 1 for the improvement of oilseed rape and other crop varieties.
7. The application of the gene of claim 1 in the preparation of male sterility system of rape genetic engineering.
8. The use of the gene of claim 1 for regulating the development of male gametes of rape.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010903840.4A CN112143735B (en) | 2020-09-01 | 2020-09-01 | Male sterile gene, protein, carrier, engineering bacterium of brassica napus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010903840.4A CN112143735B (en) | 2020-09-01 | 2020-09-01 | Male sterile gene, protein, carrier, engineering bacterium of brassica napus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112143735A CN112143735A (en) | 2020-12-29 |
| CN112143735B true CN112143735B (en) | 2022-09-20 |
Family
ID=73890426
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010903840.4A Active CN112143735B (en) | 2020-09-01 | 2020-09-01 | Male sterile gene, protein, carrier, engineering bacterium of brassica napus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112143735B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112266918B (en) * | 2020-09-25 | 2024-01-05 | 中国农业科学院油料作物研究所 | Cabbage type rape male sterile gene BnMS5e, cDNA, protein, vector, engineering bacteria and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695484A (en) * | 2016-04-26 | 2016-06-22 | 中国农业科学院油料作物研究所 | Cabbage type rape temperature sensitive type dominant genic male sterility gene BnaAtsMs |
| CN110438150A (en) * | 2019-08-22 | 2019-11-12 | 华中农业大学 | A kind of method and application for formulating rapeseed male sterility new germ plasm by gene editing |
| CN110452292A (en) * | 2019-08-20 | 2019-11-15 | 华中农业大学 | Brassica napus dominant genic male sterile gene MS5bAnd its application |
| CN111172156A (en) * | 2018-11-11 | 2020-05-19 | 上海市农业科学院 | SNP molecular marker of brassica napus dominant genic male sterile line and application thereof |
-
2020
- 2020-09-01 CN CN202010903840.4A patent/CN112143735B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695484A (en) * | 2016-04-26 | 2016-06-22 | 中国农业科学院油料作物研究所 | Cabbage type rape temperature sensitive type dominant genic male sterility gene BnaAtsMs |
| CN111172156A (en) * | 2018-11-11 | 2020-05-19 | 上海市农业科学院 | SNP molecular marker of brassica napus dominant genic male sterile line and application thereof |
| CN110452292A (en) * | 2019-08-20 | 2019-11-15 | 华中农业大学 | Brassica napus dominant genic male sterile gene MS5bAnd its application |
| CN110438150A (en) * | 2019-08-22 | 2019-11-12 | 华中农业大学 | A kind of method and application for formulating rapeseed male sterility new germ plasm by gene editing |
Non-Patent Citations (1)
| Title |
|---|
| Evolution of the Brassicaceae-specific MS5-Like family and neo-functionalization of the novel MALE STERILITY 5 gene essential for male fertility in Brassica napus;Zeng Xinhua等;《New Phytologist》;20201031;第229卷;第2339-2356页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112143735A (en) | 2020-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107267527B (en) | Method for maintaining male fertility and application thereof | |
| CN105602952B (en) | A kind of fertile gene and its application | |
| CN108130328B (en) | Application of male sterility gene OsDPW3 and rice fertility restoration method | |
| CN110213961A (en) | Crop based on genome editor is engineered and produces plant of short stem | |
| WO2013060136A1 (en) | Cloning and application of semi-dominant gene qgl3 capable of controlling grain length and grain weight of rice kernel | |
| CN101704881B (en) | Plant male fertility-associated protein, coding gene and application thereof | |
| WO2020248969A1 (en) | Male sterility maintainer line plant and use thereof | |
| CN111153974A (en) | Corn disease-resistant gene and molecular marker and application thereof | |
| CN108064297A (en) | Wheat fertility-related gene TaMS7 and its application process | |
| CN109566396A (en) | A kind of plant hybridization system and application | |
| CN106497936B (en) | The albumen and its encoding gene of control rice male fertility and application | |
| CN102432679A (en) | Rice extensin OsPEX1 and application thereof | |
| CN106834316B (en) | Rice pollen germination hole development and pollen fertility gene OsAOM, mutant gene, recombinant expression vector and application thereof | |
| CN110903368B (en) | Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method | |
| CN102559685A (en) | Anther tapetum specific expression promoter POsABCG15, recombinant expression vector thereof and application thereof | |
| CN112143735B (en) | Male sterile gene, protein, carrier, engineering bacterium of brassica napus and application thereof | |
| CN102747087B (en) | Cabbage type rape nucleic male sterility restoring gene BnaC.Tic40 and application thereof | |
| CN105441456B (en) | A kind of cabbage type rape genic male sterile gene Bnms4bAnd preparation method and application | |
| CN102268081B (en) | Rice lateral root control gene OsIAAII and use thereof | |
| CN101525630B (en) | Rapeseed plant recessive cytoblast sterile restoring gene BnCYP704B1 and application | |
| CN109666069B (en) | Plant flowering time character related protein AtJAZ5, and coding gene and application thereof | |
| CN113046377B (en) | Male sterile gene MsGAL and application thereof | |
| CN112266918B (en) | Cabbage type rape male sterile gene BnMS5e, cDNA, protein, vector, engineering bacteria and application thereof | |
| CN109161551A (en) | Wild cabbage BoMS1 gene and its application in initiative sterile material | |
| WO2013082865A1 (en) | Method for preparing fertility-lowered plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |