CN106834316B - Rice pollen germination hole development and pollen fertility gene OsAOM, mutant gene, recombinant expression vector and application thereof - Google Patents

Abstract

The invention relates to a rice pollen germination hole development and pollen fertility gene OsAOM, a mutant gene, a recombinant expression vector and application thereof, wherein the protein coded by the gene is an amino acid sequence shown in SEQ ID No.1, or a protein which is substituted, deleted or added with at least one amino acid and has the same function as the OsAOM; the OsAOM gene disclosed by the invention codes a GDSL lipase, has the functions of regulating and controlling pollen germination hole growth, microspore cell membrane expansion and pollen inner wall and cytoplasm development, is an essential gene for developing fertile pollen by microspores, and can cause germination hole structural disorder, microspore cell membrane and cytoplasm degradation and pollen inner wall incapability to form so as to generate rice male sterility.

Description

Rice pollen germination hole development and pollen fertility gene OsAOM, mutant gene, recombinant expression vector and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a rice pollen germination hole development and pollen fertility gene OsAOM, a mutant gene of the rice pollen germination hole development and pollen fertility gene OsAOM, and application of the rice pollen germination hole development and pollen fertility gene OsAOM in regulation and control of pollen fertility.

Background

Rice (Oryza sativa) is one of the major food crops, and rice is the staple food for about half of the world population. The successful application of heterosis plays an important role in the improvement of rice varieties in China. The rice is self-bred and fruitful crop, and the utilization of the heterosis depends on the breeding of sterile line.

At present, people mainly realize the heterosis of rice by a cytoplasmic-nuclear interaction sterile line (three-line method) and a temperature-sensitive sterile line (two-line method). However, due to the reasons that the cytoplasmic-nuclear interaction sterile line is not freely matched, the available parents are limited, the seed production is more complicated than that of a two-line method, the fertility of the thermo-photo sensitive sterile line is influenced by natural thermo-photo conditions, the risk of large-area seed production is high and the like, the heterosis of the rice cannot be fully reflected by the two sterile lines. The common recessive nuclear sterile line has fertility which is not influenced by environmental factors such as temperature and light, the fertility is stable, the fertility can be recovered by all normally fertile materials, and the hybrid rice can be freely matched. The study on the sterility mechanism and regulation of the sterile line is vigorous, and the method has important significance for the full utilization of the rice heterosis.

The pollen germination hole is a specialized structure of the outer wall of pollen, and has an important function for the pollen to be rapidly absorbed and germinate on stigma and finish insemination. The development of the germinating pores is regulated by complex and elaborate genetic mechanisms. Any gene related to pollen hole development approach can generate common nuclear sterile material when mutation occurs. The development and research of sterile mutants related to the development of germination pores, the cloning, verification and regulation of related genes, the cultivation of novel sterile lines and the establishment of a foundation for the full utilization of heterosis.

Disclosure of Invention

In view of the above, one of the objectives of the present invention is to provide a rice pollen germination pore development and pollen fertility gene OsAOM, which encodes GDSL lipase, has the functions of regulating and controlling the normal development of germination pore structure, microspore cell membrane, cytoplasm and inner wall, and is an essential gene for microspore development into fertile pollen, and the functional deletion of the gene can cause male sterility, thereby producing a new rice male sterile line, which can be used for hybrid seed production, and the technical scheme is as follows:

the rice pollen germination hole development and pollen fertility gene OsAOM has an amino acid sequence shown as SEQ ID No. 1; or the amino acid sequence shown in SEQ ID NO.1 is substituted, deleted or added with at least one amino acid and has the amino acid sequence with the same function as the OsAOM protein.

Further, the nucleotide sequence of the rice pollen germination hole development and pollen fertility gene OsAOM is shown in SEQ ID NO. 2; or the sequence shown in SEQ ID NO.2 is substituted, deleted or added with at least one nucleotide and has the nucleotide sequence with the same functions as the rice pollen germination hole development and pollen fertility gene OsAOM.

Further, the genome sequence of the gene OsAOM for encoding the rice pollen germination hole development and pollen fertility is shown as SEQ ID NO. 3; or the nucleotide sequence of the gene OsAOM with the functions of encoding the development of the rice pollen germination holes and the pollen fertility gene through replacing, deleting or adding at least one nucleotide in the sequence shown in SEQ ID NO. 3.

The second purpose of the invention is to provide a recombinant expression vector of a rice pollen germination hole development and pollen fertility gene OsAOM, and the technical scheme is as follows:

the recombinant expression vector contains the rice pollen germination hole development and pollen fertility gene OsAOM.

Furthermore, the recombinant expression vector is formed by connecting a sequence shown in SEQ ID NO.25 into the KpnI and SbfI enzyme cutting sites of the pCAMBIA1301 vector.

The invention also aims to provide application of the rice pollen germination hole development and pollen fertility gene OsAOM in restoring mutant pollen sterility traits, and the technical scheme is as follows:

the rice pollen germination hole development and the application of the pollen fertility gene OsAOM in restoring the pollen fertility of the mutant are pollen sterile mutants generated by OsAOM gene variation.

The fourth purpose of the invention is to provide a mutant gene of a rice pollen germination hole development and pollen fertility gene OsAOM, and the technical scheme is as follows:

the nucleotide sequence of the mutant gene is shown as SEQ ID NO.4, 775 of the nucleotide sequence shown as SEQ ID NO.2 is mutated from T to C, or 5084 of the nucleotide sequence shown as SEQ ID NO.3 is mutated from T to C, and male sterility is caused by mutation.

The fifth purpose of the invention is to provide the application of the mutant gene OsAOM of the rice pollen germination hole development and pollen fertility gene in the rice breeding preparation, and the technical scheme is as follows:

the application of the mutant gene of the rice pollen germination hole development and pollen fertility gene OsAOM in rice breeding.

Further, the application of the mutant gene of the rice pollen germination hole development and pollen fertility gene OsAOM in the preparation of a rice male sterile line.

The invention has the beneficial effects that: the invention discloses a rice pollen germination hole development and pollen fertility gene OsAOM, which mainly influences the development of a pollen hole, a cell membrane, cytoplasm and an inner wall of pollen in rice pollen development, and further influences aspects such as pollen fertility and the like. After the OsAOM gene loses functions by mutation, knockout or inhibition expression and the like, pollen germination hole structure disorder, pollen cytoplasm and cell membrane degradation are caused, and the inner wall of pollen cannot be formed, so that a new rice male sterile line is obtained, and a material with a normal OsAOM gene is used for pollinating the sterile line to restore the first generation fertility of a hybrid, so that the rice male sterile line can be used for producing hybrid seeds and has very important application in agricultural production; the invention also discloses a recombinant expression vector of the OsAOM gene, which can restore the rice male sterile line into a fertile line and has wide application prospect.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. l is a morphological observation picture of Minghui 63 with normal OsAOM gene and its mutant plant, anther and pollen (A: Minghui 63 ear of rice; B: OsAOM mutant ear of rice; C: Minghui 63 anther; D: OsAOM mutant anther; E: Minghui 63 pollen iodine staining result; F: OsAOM mutant pollen iodine staining result; G: Minghui 63 pollen scanning electron microscope picture; H: OsAOM mutant pollen scanning electron microscope picture).

FIG. 2 is a schematic view showing OsAOM gene localization and mutation site of the present invention (A: OsAOM gene localization; B: OsAOM gene mutation site).

FIG. 3 shows anther morphology and pollen iodine staining pattern of OsAOM complementary plant of the present invention (A: Minghui 63 anther morphology B: OsAOM mutant anther morphology; C: OsAOM complementary plant anther morphology; D: Minghui 63 pollen iodine staining result; E: OsAOM mutant pollen iodine staining result; F: OsAOM complementary plant pollen iodine staining result).

Detailed Description

The invention will be further illustrated with reference to the following specific examples. These examples are intended to illustrate the invention and are not intended to limit the scope of the invention. The experimental procedures, for which specific conditions are not indicated in the following examples, are generally carried out according to conventional conditions, for example as described in the handbook of molecular cloning laboratories (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

The term "pollen germination hole development and pollen fertility gene" refers to a nucleic acid sequence encoding GDSL lipase protein which can regulate normal development of pollen germination holes, cell membranes, cytoplasm and pollen inner walls and finally enable pollen fertility to be normal, a nucleotide sequence with a base sequence shown as 1-1200 th in SEQID NO.2 and a degenerate sequence thereof. Degenerate sequences are sequences which are the result of one or more codons having been replaced by degenerate codons which code for the same amino acid in the nucleotides 1 to 1200 of the coding frame of the sequence of SEQ ID No. 2. Due to the degeneracy of the codons, degenerate sequences with homology as low as about 70% to the nucleotide sequence 1-1200 of SEQ ID NO.2 can also encode the sequence depicted in SEQ ID NO. 1. The term also includes nucleotide sequences that hybridize under moderate stringency conditions, and more preferably, under high stringency conditions, to the nucleotide sequence of SEQ ID No.2 from nucleotides 1-1200. The term also includes nucleotide sequences having at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% homology to the nucleotide sequence from nucleotides 1 to 1200 of SEQ ID NO. 2. The term also includes variants of the open reading frame sequence of SEQ ID NO.2 which encode proteins having the same function as the native regulatory pollen pore, cell membrane, cytoplasm and pollen wall. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 90, preferably 1 to 60, more preferably 1 to 20, most preferably 1 to 10) nucleotides, and addition of several (usually less than 60, preferably less than 30, more preferably less than 10, most preferably less than 5) nucleotides at the 5 'and/or 3' end.

In the examples, various vectors known in the art, such as commercially available vectors including plasmids, cosmids, and the like, may be used. When the GDSL lipase for regulating and controlling the development of rice pollen germination holes is produced, the coding sequence of the protein can be operably connected with an expression regulating and controlling sequence, so that an expression vector for regulating and controlling the development of rice pollen germination holes, pollen cytoplasm, cell membranes and pollen inner walls is formed.

The full-length sequence of related nucleotides or fragments thereof can be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed based on the nucleotide sequences disclosed in this example, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art, or genomic DNA as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Example 1 acquisition and morphological Observation of osaom mutant plants

The osaom mutant is derived from mutation of indica rice Minghui 63, normal Minghui 63 is used as a male parent to be hybridized with the osaom mutant, the mutant gene is stored in a heterozygote, the heterozygote is subjected to self-reproduction when the mutant is needed, and the mutant osaom can be separated from the offspring. Hybridization of osaom mutant with Minghui 63, F_lAll generations are fertile and selfed F₂Segregation occurs in generations, wherein the normal plant is 293, the mutant is 120, and the proportion is in accordance with

Indicating that the male sterile mutant phenotype is caused by a nuclear gene mutation. Morphological observations on osaom mutant plants: the Minghui 63 rice spike droops after fructification (figure 1, A), while the osaom mutant spikelet is not fructified and stands vertically (figure 1, B); the Minghui 63 anthers were robust and plump (FIG. 1, C), the osaom mutant anthers were finer (FIG. 1, D); minghui 63 pollen stained black by iodine (FIG. 1, E), osaom mutant pollen stained light by iodine, and pollen small and abnormal (FIG. 1, F); minghui 63 pollen under scanning electron microscope had a plug-like hole cover at the pollen hole (FIG. 1, G), while the hole cover of mutant osaom was missing, allowing a void to form at the germinating hole (FIG. 1, H).

Example 2 mapping and cloning of OsAOM Gene

Positioning group

Hybridizing the OsAOM mutant with japonica rice Nipponbare, and selfing to obtain F₂And selecting male sterile plants as a positioning population.

Second, extracting the DNA of the rice

The parent is extracted by adopting an improved CTAB method, and the method comprises the following steps: taking 0.1-0.2 g (about half piece) of leaf, putting into a small mortar, adding a proper amount of liquid nitrogen, immediately grinding into powder, putting into a 2m1 centrifuge tube, adding 700 mu L of 1.5 × CTAB solution preheated at 100 ℃ into the centrifuge tube, carefully and uniformly mixing, putting into a 65 ℃ water bath, taking out the centrifuge tube after 20 minutes, adding equal volume of chloroform/isoamylol,mixing strongly, centrifuging at 13000rpm for 10 min, collecting supernatant, adding 900 μ L anhydrous ethanol, mixing well, and standing at-20 deg.C for more than half an hour. The precipitated DNA was centrifuged at 14000rpm for 10 minutes. The supernatant was removed, and the precipitate was washed once with 1mL volume fraction of 70% ethanol, dried by centrifugation, dissolved in 200. mu.L of TE solution and stored in a refrigerator at 4 ℃. The individual plant DNA of the positioning population is extracted by adopting an improved alkaline cooking method, and the method comprises the following steps: cutting tender leaf into pieces of 1-2cm²The mixture was put into a 0.5M1 centrifuge tube, 100. mu.L of 0.125M NaOH solution was added, and the mixture was boiled in a water bath for 30 seconds, then 50. mu.L of 1.0M Tris-HCl (pH8.0) was added, and finally 100. mu.L of 0.125M HCl was added, and the mixture was kept in a refrigerator at 4 ℃ after 2 minutes in a boiling water bath for further use.

Third, group separation analysis initial positioning

137 pairs of polymorphic markers were designed, including 42 SSR primers and 95 InDel molecular marker primers. Wherein SSR primers are synthesized according to published sequences (see in particularhttp://www.gramene.org.microsat/ ssr.html) In other InDel molecular marker designs, primers are designed for different parts according to published nucleic acid sequences of japonica rice Nipponbare and indica rice 9311 lines, and polymorphism between 2 parent japonica rice Nipponbare and indica rice OsAOM mutants is verified. And (3) amplifying the parent and the gene pool simultaneously by using the designed 137 pair InDel primers, wherein the PCR amplification program comprises the following steps: mu.L of template, mu.L of 10 pmol/. mu.L of upstream primer, mu.L of 10 pmol/. mu.L of downstream primer, and mu.L of 10 XBuffer (Mg) in a 10. mu.L system^{2 Ten}) mu.L of 2mM dNTP, 0. mu.L of Taq, and 3.9. mu.L of water; and detecting the PCR product by PAGE gel electrophoresis with the mass volume fraction of 10% and a silver staining method. As a result, it was found that the primer R02004 on chromosome 2 exhibited polymorphism between the parent and the gene pool at the same time, single strain verification showed that the primer was linked to the OsAOM gene, and in order to localize the gene between the two primer sites, SSR or InDel primer 12 pairs were co-synthesized in the vicinity of the primer R02004 at 10.0Mb, and screening was performed with the parent OsAOM and Nipponbare, and as a result, the primer R02001, SSR primers RM452, RM300, and RM8254 exhibited polymorphism between the parents, and single strain verification showed that the R02001 consensus recombinant 18 strain had a genetic distance of 4.66cM, RM8524 consensus recombinant 49 strain having a genetic distance of 12.69cM, and the two crossover strains exhibited polymorphism with each otherAre not included, indicating that the target gene is between the two. Preliminary mapping work finally mapped the OsAOM gene between R02004 and RM300, with 3 and 18 recombinants, respectively, and a genetic distance of 0.78cM and 4.66cM, respectively (FIG. 2, A). The primary targeting primer sequences are shown in Table 1.

Four, fine positioning

To further narrow the scope of candidate gene screening, we subsequently refined the mapping to construct F of mutant osaom XJH 1₂2688 sterile single plants are obtained in the generation group. Between the primer R02004 and RM300, 34 pairs of primers are designed and synthesized, and sterile parent, fertile parent and F are utilized₁Screening differential primers, and co-selecting 5 pairs of primers R02004, RM1106, RM13010, RM13013 and R02013 which have obvious difference and are linked with the gene, wherein the genotype analysis result of recessive individuals shows that R02004 shares a single cross-over strain 187 with an inheritance distance of 3.48cM, RM13013 shares a single cross-over strain 100 with an inheritance distance of 1.86cM, and the single cross-over strains of the two do not contain each other, RM1106 shares a single cross-over strain 1 with an inheritance distance of 0.02cM, RM13010 shares a single cross-over strain 11 with an inheritance distance of 0.20cM, R02013 has a single cross-over strain 2 with an inheritance distance of 0.04cM, wherein the cross-over strain of RM1106 is contained in the cross-over strain of R02004, the single cross-over strain of RM02013 is contained in the cross-over strain of RM13010, the cross-over strain of RM13010 is contained in the cross-over strain of RM13013, and the cross-over strain of R02004 and the RM13013 contains each other cross-over strain and AOA (FIG. shows that the two AOA markers are contained in the Os02013). In thathttp://www.gramene.org/On the 2 nd chromosome of the rice Nipponbare of the website, the physical positions of the two markers are 10997625 and 11045788 (version number: Oryza _ sativa. IRGSP-1.0.21), the distance between the two markers is about 48Kb, and only seven gene loci are predicted in the range. The analysis of BAR (http:// BAR. utonto. ca/efprice/cgi-bin/efpWeb. cgi) found that Loc _ Os02g18870 was expressed in the middle and late inflorescences, and was most likely to be a candidate gene OsAOM among seven genes. The sequence alignment of Loc _ Os02g18870 gene in minghui 63 and mutant osaom revealed that: a T → C base mutation in the fourth exon of the Loc _ Os02g18870 gene in the osaom mutant resulted in the encodedThe amino acid changes from cysteine (Cys) to arginine (Arg). Therefore, it was preliminarily determined that Loc _ Os02g18870 is the target gene OsAOM (fig. 2, B). The gene codes GDSL lipase protein, the amino acid sequence of the coded protein is shown as SEQ ID NO.1, the nucleotide sequence is shown as SEQ ID NO.2, the corresponding genome sequence of the OsAOM gene is shown as SEQ ID NO.3, and the mutant gene of the OsAOM gene is shown as SEQ ID NO. 4.

TABLE 1 Gene mapping and functional verification primer sequences

Example 3 functional analysis of OsAOM Gene

In order to further confirm that the OsAOM gene is the gene causing the phenotype of the male sterile mutant, the OsAOM gene and an expression regulation region (comprising 5603bp exon and intron, 1254bp upstream promoter and 1589bp downstream terminator) are amplified from a rice BAC (bacterial artificial chromosome) OSJNBb0062H16r containing the OsAOM gene, and the nucleotide sequence is shown as SEQ ID NO. 25. The specific operation is segmented amplification and ligation of pCAMBIA1301 vector: utilizing a single enzyme cutting site XbaI existing in the middle of a coding region, adding an enzyme cutting site KpnI at the tail end of a first half upstream primer CF1, a first half downstream primer CR1 is positioned behind the XbaI site, a second half upstream primer CF2 is positioned in front of the XbaI site, and a second half downstream primer CR2 is added with an enzyme cutting site SbfI at the tail end, wherein the sequences of cloning primers are shown in a table 1; firstly, using KpnI and XbaI to expand the first half segment and then connecting the first half segment with pCAMBIA1301 to obtain an intermediate vector, then using XbaI and SbfI to expand the second half segment and then connecting the second half segment with the intermediate vector, sequencing to ensure the correct sequence, finally obtaining a complementary vector pCAMBIA1301-OsAOM of the OsAOM gene, and transforming the obtained recombinant expression vector into agrobacterium tumefaciens 440LBA 4 by adopting a freeze-thaw method to obtain agrobacterium tumefaciens LBA4404 containing the recombinant expression vector pCAMBIA1301-OsAOM, which is named as LBA 4404-OsAOM.

The obtained LBA4404-OsAOM is transformed into rice OsAOM mutant to observe whether the pollen fertility is restored. The results are shown in FIG. 3, and the results show T₀Generation to obtain complementary plant, T₀Generation-complementary plant pollen fertility restoration and antherContains mature pollen and turns into normal yellow, and iodine stains pollen into black. Therefore, the cloned OsAOM gene can restore pollen fertility of the mutant and is the target gene of the invention, and the mutation of the target gene generates a male sterile phenotype. The combination of the previous comparison of pollen fertility between the mutant and the wild Minghui 63 shows that the OsAOM gene is a gene for regulating the development of rice pollen and has a regulating effect on the development of pollen germination pore structures, pollen cell membranes, cytoplasm and pollen inner walls.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

<110> university of southwest;

<120> rice pollen germination hole development and pollen fertility gene OsAOM, mutant gene, recombinant expression vector and application thereof

<160>29

<210>1

<211>399

<212>PTR

<213> Rice (Oryza sativa)

<220>

<223> pollen germination hole development and pollen fertility gene OsAOM amino acid sequence

<400>1

Met Ala Leu Pro Phe Leu Leu Leu Leu Ala Phe Ala Leu Leu Phe

1 5 10 15

Pro Leu Ser Ala Pro Pro Arg Cys Cys Ser Ala Ala Pro Ala Ser

20 25 30

Ser Pro Pro Pro Ser Pro Pro Pro Ser Pro Ala Ala Ala Ala Ala

35 40 45

Ala Pro Arg Arg Thr Pro Leu Val Pro Ala Leu Phe Val Ile Gly

50 55 60

Asp Ser Thr Ala Asp Val Gly Thr Asn Asn Tyr Leu Gly Thr Leu

65 70 75

Ala Arg Ala Asp Arg Glu Pro Tyr Gly Arg Asp Phe Asp Thr Arg

80 85 90

Arg Pro Thr Gly Arg Phe Ser Asn Gly Arg Ile Pro Val Asp Tyr

95 100 105

Ile Ala Glu Lys Leu Gly Leu Pro Phe Val Pro Pro Tyr Leu Glu

110 115 120

Gln Asn Met Arg Met Gly Val Gly Ser Val Asp Leu Ser Asn Ile

125 130 135

Asp Gly Met Ile Gln Gly Val Asn Tyr Ala Ser Ala Ala Ala Gly

140 145 150

Ile Leu Ser Ser Ser Gly Ser Glu Leu Gly Met His Val Ser Leu

155 160 165

Ser Gln Gln Val Gln Gln Val Glu Asp Thr Tyr Glu Gln Leu Ser

170 175 180

Leu Ala Leu Gly Glu Ala Ala Thr Thr Asp Leu Phe Arg Lys Ser

185 190 195

Val Phe Phe Phe Ser Ile Gly Ser Asn Asp Phe Ile His Tyr Tyr

200 205 210

Leu Arg Asn Val Ser Gly Val Gln Met Arg Tyr Leu Pro Trp Glu

215 220 225

Phe Asn Gln Leu Leu Val Asn Ala Met Arg Gln Glu Ile Lys Asn

230 235 240

Leu Tyr Asn Ile Asn Val Arg Lys Val Val Met Met Gly Leu Pro

245 250 255

Pro Val Gly Cys Ala Pro His Phe Leu Trp Glu Tyr Gly Ser Gln

260 265 270

Asp Gly Glu Cys Ile Asp Tyr Ile Asn Asn Val Val Ile Gln Phe

275 280 285

Asn Tyr Ala Leu Arg Tyr Met Ser Ser Glu Phe Ile Arg Gln His

290 295 300

Pro Gly Ser Met Ile Ser Tyr Cys Asp Thr Phe Glu Gly Ser Val

305 310 315

Asp Ile Leu Lys Asn Arg Asp Arg Tyr Gly Phe Leu Thr Thr Thr

320 325 330

Asp Ala Cys Cys Gly Leu Gly Lys Tyr Gly Gly Leu Phe Met Cys

335 340 345

Val Leu Pro Gln Met Ala Cys Ser Asp Ala Ser Ser His Val Trp

350 355 360

Trp Asp Glu Phe His Pro Thr Asp Ala Val Asn Arg Ile Leu Ala

365 370 375

Asp Asn Val Trp Ser Gly Glu His Thr Lys Met Cys Tyr Pro Val

380 385 390

Asp Leu Gln Gln Met Val Lys Leu Lys

395 399

<210>2

<211>1200

<212>DNA

<213> Rice (Oryza sativa)

<220>

<223> pollen germination hole development and pollen fertility gene OsAOM sequence

<400>2

atggcgctcc ccttcctcct cctcctcgcc ttcgccctgc tcttcccgct ctccgctccc 60

ccgcgctgct gctccgcggc ccccgcctcc tcgccgcccc cgtccccgcc cccttcccct 120

gcggcggcgg cggcggcccc gcgccgcacg ccgctcgtcc cggcgctctt cgtgatcggc 180

gactccacgg cggacgtcgg caccaacaac tacctcggca cgctcgcccg cgccgaccgc 240

gagccgtacg gccgcgactt cgacacccgc cgccccacgg ggcgcttctc caacggccgc 300

atccccgtcg actacatcgc agagaagctg gggcttcctt ttgtgcctcc ataccttgaa 360

cagaacatgc gcatgggtgt cggcagtgtc gacctcagca acattgatgg gatgatacaa 420

ggtgtcaact atgcatccgc ggcagctggc attctctcca gcagtggttc tgagctggga 480

atgcatgtgt cgctgagcca gcaggtgcag caggttgagg acacatatga gcagctctct 540

ctggctctcg gggaggcagc aacaactgac cttttcagaa agtccgtgtt ctttttctca 600

atcgggagca acgacttcat ccactattac ctgcgcaatg tgtctggcgt ccagatgcgt 660

tacctcccat gggagttcaa ccagcttctt gtcaatgcaa tgaggcagga aatcaagaat 720

ttgtacaata tcaatgttcg gaaggtcgtc atgatgggcc tccctcctgt tggctgcgca 780

cctcactttc tctgggagta cggcagtcaa gacggggaat gcatcgacta catcaataac 840

gtcgtgattc agttcaacta tgccctgaga tacatgtcta gtgaattcat ccgccagcac 900

ccaggctcta tgatcagtta ctgtgatact tttgaggggt ctgtggacat actgaagaat 960

cgtgaccgct acggttttct gaccaccact gatgcctgct gtgggctggg gaagtatggg 1021

ggcctgttca tgtgtgttct tccacagatg gcgtgcagcg acgcgtcgag ccatgtctgg 1081

tgggacgagt tccaccccac ggatgctgtg aaccgaatcc tggctgataa tgtgtggtct 1141

ggtgagcata ccaagatgtg ctatcctgtg gatttgcagc agatggtaaa actcaagtag 1200

<210>3

<211>5603

<212>DNA

<213> Rice (Oryza sativa)

<220>

<223> pollen germination hole development and pollen fertility gene OsAOM genome sequence

<400>3

atggcgctcc ccttcctcct cctcctcgcc ttcgccctgc tcttcccgct ctccgctccc 60

ccgcgctgct gctccgcggc ccccgcctcc tcgccgcccc cgtccccgcc cccttcccct 120

gcggcggcgg cggcggcccc gcgccgcacg ccgctcgtcc cggcgctctt cgtgatcggc 180

gactccacgg cggacgtcgg caccaacaac tacctcggca cgctcgcccg cgccgaccgc 240

gagccgtacg gccgcgactt cgacacccgc cgccccacgg ggcgcttctc caacggccgc 300

atccccgtcg actacatcgg tacgcgcccc ccaccttctc gatcggcggc gccatggctg 360

tggccccttt gctctctcgt gaatcctccc ccccccgctt caaaggttgc aggtggttct 420

ggaatcgtcg atccgatgct gctttgcctc tcgtacgcct atggatgcag catgttgtgg 480

gtttagtgta atctgggttt tgggtttctg gtatacgaag gttttgctta gttgttggtt 540

cctatgaatt tggggcatct gatctcatac atcgggggta tgtggatttt tgcccaacaa 600

ttgctgaagc tgaagagtaa tcagttcata gcactctcct acacagctga ccacctggat 660

ctcacataca tagactcctg cggcttcctc tccttgatct cacatagcaa tgttgtgggt 720

ttagtgtaat ctgggtattt gggtttctcg catgcgaggg gcttgctcag ttgttggttc 780

gtctgtgggt ttctgccgaa caattgctga agctgaagag taaccagttt tgcagcacaa 840

ccaccacagt ctgggcatca tttgatcctg ctgttcttag cactcctgca gagctgacca 900

cctggatctc acgtatctat atagaatcct gcggcttcct ctccaaatca gtatccagta 960

tccaccaccg ttatcagccg ttgaggcaat gcattggcag aatgccagaa cattaagaag 1020

tgccatcata atgtacacca ttagtccatg catccagaaa acattgccag aatcctgcaa 1080

tgtatccatt tgatagtcct gagtcccgac cagttgtcta catgctccag tctctttgcc 1140

accacacact gttaaatctc tcttgtccaa tgtccaccac attctggaca gtttcaaggt 1200

cctcacagga agcacagctg cacaaccttt gttaatgttg ctttaagaaa gtcatatcta 1260

ctcattagtt tctttgggag agtaaggagg gaaaaggcat aggaaagaaa catttaacta 1320

gggctactgg ctcactatgt gaaagatgtt tcccttcaat ttcatttagc tggtgttctt 1380

tatctctttt gcccgtctct gtcagtactt atgtttttca tgaatcaata gtatcttgtt 1440

ctttcttctg tttttaaatt attttttccg tgatttctta atcttagact tttttgtgca 1500

tttgcagcag agaagctggg gcttcctttt gtgcctccat accttgaaca gaacatgcgc 1560

atgggtgtcg gcagtgtcga cctcagcaac attgatggga tgatacaagg tgtcaactat 1620

gcatccgcgg cagctggcat tctctccagc agtggttctg agctggtttg tcctcctaac 1680

ttcccaacaa ctctatttca cgcttataat ctagcaggaa tgtctttgtg agacccttct 1740

ctagaggacg aatcagaagg agggtgtttc aacaacagac tagaagcaat gactcttctc 1800

atagtgtcta catcctctct agttaggaag aatacttgct caaccatttg aactaatgct 1860

gaaagattct cctgttcggc tgctcccttc cttccatgtg ttccaactag tgtggattat 1920

cagggcatca aattcccttc ttagttccta ggaattcatg acttatatat gcttcctacc 1980

agatgtgaga ttgtctacac gagacgattg atatgctggt gctgatgggg ggtttattta 2040

tgctgctggc cttgtccaag tttgcttgtg aagctacagt gctataagtt gtatggttgt 2100

tttattttcc tgcacgcata aagcaaaagg agatatatgt agccatctac tcaaagctaa 2160

tttatcataa tttttttatt gtctgaaact aaaaaactgc atttgttcta tactatggct 2220

tttgggatga tcaaggagtt agtaagaatc actgatccgg caccaatgtg atgaaattga 2280

tgtatatcat cctgaacatt ccattttcat atcaatcttt attcctgctt atgttgttga 2340

atctccaatc tttgtgccca aaacaacaaa aacttgtgga gctgcaaatg ctaattttgt 2400

catttcaata aaacatcatg gtggtgtcta aagaggagaa atgtttacgt atgaacattg 2460

ctgcaaagtt ttcctttatg tggctatatg ttttaacttt ctataaagga ttggagcctc 2520

ttggttagag tcaagcttgt tgatttgcat accttttcat tattcttaaa tgtacttgaa 2580

actaaatcga catgatcatt aactatataa caccagtcta aagaacacca atctaaagaa 2640

cacacttaat gcttctctat gaaggtttct cttttggtat gtaatacttg ctcatcggat 2700

gtatcctttt ttgttactat tttgtctcgt gaactataca tttgaagatt attttgtggt 2760

ggtattcttt actactgcgg cattccagca gctgtaaaag tatgtgcaat tatactgtta 2820

aaaaatctcc aacattggca gtcccctagc ttggaatctg tcgatatttt ctgtgtttat 2880

gttatgattt cttgcaaaca tattttagat tcttaaattt taatggcgtg gttgttctag 2940

cttaaatatg tttagaacaa gggatgtgac acctttactt tgtgcagaat aaaccttcat 3000

gctgatctct tgtgtatcaa gccttcaggc taggggtgta agtggctaac ccgcgaaacc 3060

cacttatagg ctaaaataag ccgcgaaccc gtttattttg acctataagt gggttcgcgg 3120

ctgacccact tacagcccta cttcaggcac atgaggatca atcatttcat agtgtgacta 3180

tttgtagtta tctgtatggc cgtaaataat ggcctctata ttgttctgta ttggagtatc 3240

tctctactat ttttttctct gaagaagagc attcttttac ctatttttgg ttttcataat 3300

tcaatgtgat gcataatttg attctgttct tttttagata aaggaggcta atttgattct 3360

gttcttgcaa ttgtggatgc actgcaggga atgcatgtgt cgctgagcca gcaggtgcag 3420

caggttgagg acacatatga gcagctctct ctggctctcg gggaggcagc aacaactgac 3480

cttttcagaa agtccgtgtt ctttttctca atcgggagcaacgacttcat ccactattac 3540

ctgcgcaatg tgtctggcgt ccagatgcgt tacctcccat gggagttcaa ccagcttctt 3600

gtcaatgcaa tgaggcagga aatcaaggtg tggttattgt tctccagttt attctctctg 3660

tgcaacattt cttgcctcct tatgattcca gttttagttt tttgatcagt gtgttgcata 3720

ttgcccaaag gctgtagtat cgtgcttagc agtggccaat gttgtgagta tgaatttgat 3780

ccgtaattta cggcccgtaa atattctgtg cttgaaaggt atctgctctc agttccacca 3840

cccagatgtg aatagttctt tgtactcctg gttaggaata tgtttgagaa aaggaggagt 3900

gtggacctct ggggactgca gatacatgaa ttatggaaaa ctagctatga acattaattt 3960

ttatgtttca agggctagaa aattttcaaa tgtttataga gaaacctgat atagtacact 4020

ttttctgtag gttaaagttt tcaaatggtg gatgagttta aaaccgtgta cagttttgga 4080

ctgaagcttc tttgagttac tgaaatcctc aggctgtaca gtttttctgt agttatgaat 4140

taggttaaaa ggataggagg gtatttcatc tgtacatttg taatatggga aagttaactg 4200

ataaatacat ggaattgatt aactcaatgg atatttatat cgttggctgt tagcagttct 4260

gtggtgttat gtactttaca ttctccgtct accgtacctt agtttcagat ttgaggtagt 4320

acgttgcaac gttgctcaac aaggacatac ttgtttttta tatgttcatt ttgaattctt 4380

aacattttga tcagataagg cggccccaaa tctgataggg actgatgtaa agtcgatact 4440

gaatattgtc ttggactgaa tactgtgttt gagtccctta gttcttggtc tgcgcatact 4500

tccagagtgg attgtacttt gtactgcctc ccatttggaa gtgcaagcta aatgcgtgtt 4560

acttttgctc aacttgtagg acaccatgca cactaccaat atgcccatga tcttaccatg 4620

atacaaacat aattctcaca tcatgcataa atgcataatg cacaatttga ttttctccct 4680

aatttatccc ctttcctttt ttgaacggat aattttaatt tgcaaaagaa ttggtaaaaa 4740

tggccccaaa tttctattca gtaaatcttt ggcagagcat gcgatgcaca ttgattgagg 4800

ctgcatgcgc catgagttta tttgtactgt ccaacatttg agagcagaaa tttctgttac 4860

cattgtactc atccaagttg acttgagatg ttgctttctt gtttcttaac cttagtaaat 4920

cagttacaat gatgcatttt tttattattt agccatatgc agttcttgtc agattagatt 4980

attaagctat ttatatctat atataagagt tctgtacttc ctgcagaatt tgtacaatat 5040

caatgttcgg aaggtcgtca tgatgggcct ccctcctgtt ggctgcgcac ctcactttct 5100

ctgggagtac ggcagtcaag acggggaatg catcgactac atcaataacg tcgtgattca 5160

gttcaactat gccctgagat acatgtctag tgaattcatc cgccagcacc caggctctat 5220

gatcagttac tgtgatactt ttgaggggtc tgtggacata ctgaagaatc gtgaccgcta 5280

cggtgagcag atgtatcatt gttactactg tcagattgcc tttctgtcct tagggaagaa 5340

ctcacattac gatggaatca cattgtgcag gttttctgac caccactgat gcctgctgtg 5400

ggctggggaa gtatgggggc ctgttcatgt gtgttcttcc acagatggcg tgcagcgacg 5460

cgtcgagcca tgtctggtgg gacgagttcc accccacgga tgctgtgaac cgaatcctgg 5520

ctgataatgt gtggtctggt gagcatacca agatgtgcta tcctgtggat ttgcagcaga 5580

tggtaaaact caagtagaac tga 5603

<210>4

<211>1200

<212>DNA

<213> Rice (Oryza sativa)

<220>

<223> mutant gene sequence of pollen germination hole development and pollen fertility gene OsAOM

<400>4

atggcgctcc ccttcctcct cctcctcgcc ttcgccctgc tcttcccgct ctccgctccc 60

ccgcgctgct gctccgcggc ccccgcctcc tcgccgcccc cgtccccgcc cccttcccct 120

gcggcggcgg cggcggcccc gcgccgcacg ccgctcgtcc cggcgctctt cgtgatcggc 180

gactccacgg cggacgtcgg caccaacaac tacctcggca cgctcgcccg cgccgaccgc 240

gagccgtacg gccgcgactt cgacacccgc cgccccacgg ggcgcttctc caacggccgc 300

atccccgtcg actacatcgc agagaagctg gggcttcctt ttgtgcctcc ataccttgaa 360

cagaacatgc gcatgggtgt cggcagtgtc gacctcagca acattgatgg gatgatacaa 420

ggtgtcaact atgcatccgc ggcagctggc attctctcca gcagtggttc tgagctggga 480

atgcatgtgt cgctgagcca gcaggtgcag caggttgagg acacatatga gcagctctct 540

ctggctctcg gggaggcagc aacaactgac cttttcagaa agtccgtgtt ctttttctca 600

atcgggagca acgacttcat ccactattac ctgcgcaatg tgtctggcgt ccagatgcgt 660

tacctcccat gggagttcaa ccagcttctt gtcaatgcaa tgaggcagga aatcaagaat 720

ttgtacaata tcaatgttcg gaaggtcgtc atgatgggcc tccctcctgt tggccgcgca 780

cctcactttc tctgggagta cggcagtcaa gacggggaat gcatcgacta catcaataac 840

gtcgtgattc agttcaacta tgccctgaga tacatgtcta gtgaattcat ccgccagcac 900

ccaggctcta tgatcagtta ctgtgatact tttgaggggt ctgtggacat actgaagaat 960

cgtgaccgct acggttttct gaccaccact gatgcctgct gtgggctggg gaagtatggg 1021

ggcctgttca tgtgtgttct tccacagatg gcgtgcagcg acgcgtcgag ccatgtctgg 1081

tgggacgagt tccaccccac ggatgctgtg aaccgaatcc tggctgataa tgtgtggtct 1141

ggtgagcata ccaagatgtg ctatcctgtg gatttgcagc agatggtaaa actcaagtag 1200

<210>5

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> R02001 upstream primer

<400>5

cgataggcaa ctaaaacatt 20

<210>6

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> R02001 downstream primer

<400>6

cttgtcctcc tgctctgta 19

<210>7

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> R02004 upstream primer

<400>7

gcaatttaac ccttattcct g 21

<210>8

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> R02004 downstream primer

<400>8

gggaagaaga aagccattag 20

<210>9

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> RM1106 upstream primer

<400>9

cggaaagtga atcggagaac 20

<210>10

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> RM1106 downstream primer

<400>10

gcaccacgct aagctaaacc 20

<210>11

<211>16

<212>DNA

<213> Artificial sequence

<220>

<223> R02013 upstream primer

<400>11

tgcctataat ctcaac 16

<210>12

<211>16

<212>DNA

<213> Artificial sequence

<220>

<223> R02013 downstream primer

<400>12

ttctacactg cctgtg 16

<210>13

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> RM13010 upstream primer

<400>13

cagtatggtc acaggaaaca acc 23

<210>14

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> RM13010 downstream primer

<400>14

ctttgtgatc ctctaatggt ctgc 24

<210>15

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> RM13013 upstream primer

<400>15

ccgttaggag cctttcact 19

<210>16

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> RM13013 downstream primer

<400>16

ctgagatgtt tatgcctttc c 21

<210>17

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> RM300 upstream primer

<400>17

gcttaaggac ttctgcgaac c 21

<210>18

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> RM300 downstream primer

<400>18

caacagcgat ccacatcatc 20

<210>19

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> RM8254 upstream primer

<400>19

aaagggaccc acttgtcagc 20

<210>20

<211>19

<212>DNA

<213> Artificial sequence

<220>

<223> RM8254 downstream primer

<400>20

gtcgaggatg gatcgatgg 19

<210>21

<211>31

<212>DNA

<213> Artificial sequence

<220>

<223> upstream primer of CF1

<400>21

accggtaccg ctctcgcacc aatcttgatc a 31

<210>22

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> CR1 downstream primer

<400>22

gccagcagca taaataaacc c 21

<210>23

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223> upstream primer of CF2

<400>23

tgatgggatg atacaagg 18

<210>24

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> CR2 downstream primer

<400>24

cagcctgcag gtccatgcat agctagcctt cag 33

<210>25

<211>8441

<212>DNA

<213> Rice (Oryza sativa)

<220>

<223> OsAOM gene and expression regulatory region

<400>25

gctctcgcac caatcttgat caagacaaca tcatgaccgc atattatgga gagttgttga 60

aaactgatcg ccaggtgttt gagactcaac ttgaagaatt gcttcaaaag atggcttcgt 120

actaccgtaa gacgaggcaa ggcatcatca agcaacaaaa attcatgtta cccatccatg 180

caaaatcaaa ggtaacaacg attctagcag tgcctattct aacatatgaa gttgtgatgg 240

tgatgttatt tctagtttaa ataatcggtt tacttctttg aatactacct ttgagaaaac 300

ctttagtact accttggaaa gccctagatg atcacatgag tgagttagag aatcgactaa 360

atagccggtt ccttggtggt gcatgtattt catgcaacaa cgagcatatg catggtattc 420

cttcatattt tcatatacca aaattttctg tacaacaaga ttggccgatg aaaaataccc 480

acaattccct cgatacaata gatcctagat tcactcctac gatactgtat gctggtccga 540

ccgatgtgtt attgctggtc agaccggacg catcgatcgg accgacgggt gtaataccac 600

cagtccgact agaggcagca gccgatccga ttggagggac atcaccggtc agactacgct 660

cggcatgttt cgtagaatca gctcatgtct ggtgctcctc taaaagacat tgacatgtgg 720

ggtccacggg ctgactcaac aagattggat aaactgcctc ctaaaccgtt caaggagtca 780

atttgtaatg gttttgtgag ttggaggata ggttataggg atgcgattca accatgggca 840

tgagttgagg gaagcaaagt agacttaggg cctgttcact ttgatgaaaa aaaaaacctt 900

accaaatttt ggtaggcaac ttgccaaaat tttggcagga tttcttatat agttatcaaa 960

atttggcagc aaattaaata tagtcacttt tttggcaaat ttactaaaat ttggtaaggt 1020

tgaaaatgac atcaaagtaa acaggccctt attacccacg ggaatggtgt ggggtgggct 1080

ggtaatataa gcccagaaac caatccatcc agcccagcaa ctgcgaggtc ggctgctagt 1140

ctaacgtgca cccaagccat caccccacac gtgaaaaatc cccgctccac ccgcgccgcg 1200

ccgcgcccag gtagttcagc cgcgcgccaa cccaagctcg ctcgccggcc ggaaatggcg 1260

ctccccttcc tcctcctcct cgccttcgcc ctgctcttcc cgctctccgc tcccccgcgc 1320

tgctgctccg cggcccccgc ctcctcgccg cccccgtccc cgcccccttc ccctgcggcg 1380

gcggcggcgg ccccgcgccg cacgccgctc gtcccggcgc tcttcgtgat cggcgactcc 1440

acggcggacg tcggcaccaa caactacctc ggcacgctcg cccgcgccga ccgcgagccg 1500

tacggccgcg acttcgacac ccgccgcccc acggggcgct tctccaacgg ccgcatcccc 1560

gtcgactaca tcggtacgcg ccccccacct tctcgatcgg cggcgccatg gctgtggccc 1620

ctttgctctc tcgtgaatcc tccccccccc cgcttcaaag gttgcaggtg gttctggaat 1680

cgtcgatccg atgctgcttt gcctctcgta cgcctatgga tgcagcatgt tgtgggttta 1740

gtgtaatctg ggttttgggt ttctggtata cgaaggtttt gcttagttgt tggttcctat 1800

gaatttgggg catctgatct catacatcgg gggtatgtgg atttttgccc aacaattgct 1860

gaagctgaag agtaatcagt tcatagcact ctcctacaca gctgaccacc tggatctcac 1920

atacatagac tcctgcggct tcctctcctt gatctcacat agcaatgttg tgggtttagt 1980

gtaatctggg tatttgggtt tctcgcatgc gaggggcttg ctcagttgtt ggttcgtctg 2040

tgggtttctg ccgaacaatt gctgaagctg aagagtaacc agttttgcag cacaaccacc 2100

acagtctggg catcatttga tcctgctgtt cttagcactc ctgcagagct gaccacctgg 2160

atctcacgta tctatataga atcctgcggc ttcctctcca aatcagtatc cagtatccac 2220

caccgttatc agccgttgag gcaatgcatt ggcagaatgc cagaacatta agaagtgcca 2280

tcataatgta caccattagt ccatgcatcc agaaaacatt gccagaatcc tgcaatgtat 2340

ccatttgata gtcctgagtc ccgaccagtt gtctacatgc tccagtctct ttgccaccac 2400

acactgttaa atctctcttg tccaatgtcc accacattct ggacagtttc aaggtcctca 2460

caggaagcac agctgcacaa cctttgttaa tgttgcttta agaaagtcat atctactcat 2520

tagtttcttt gggagagtaa ggagggaaaa ggcataggaa agaaacattt aactagggct 2580

actggctcac tatgtgaaag atgtttccct tcaatttcat ttagctggtg ttctttatct 2640

cttttgcccg tctctgtcag tacttatgtt tttcatgaat caatagtatc ttgttctttc 2700

ttctgttttt aaattatttt ttccgtgatt tcttaatctt agactttttt gtgcatttgc 2760

agcagagaag ctggggcttc cttttgtgcc tccatacctt gaacagaaca tgcgcatggg 2820

tgtcggcagt gtcgacctca gcaacattga tgggatgata caaggtgtca actatgcatc 2880

cgcggcagct ggcattctct ccagcagtgg ttctgagctg gtttgtcctc ctaacttccc 2940

aacaactcta tttcacgctt ataatctagc aggaatgtct ttgtgagacc cttctctaga 3000

ggacgaatca gaaggagggt gtttcaacaa cagactagaa gcaatgactc ttctcatagt 3060

gtctacatcc tctctagtta ggaagaatac ttgctcaacc atttgaacta atgctgaaag 3120

attctcctgt tcggctgctc ccttccttcc atgtgttcca actagtgtgg attatcaggg 3180

catcaaattc ccttcttagt tcctaggaat tcatgactta tatatgcttc ctaccagatg 3240

tgagattgtc tacacgagac gattgatatg ctggtgctga tggggggttt atttatgctg 3300

ctggccttgt ccaagtttgc ttgtgaagct acagtgctat aagttgtatg gttgttttat 3360

tttcctgcac gcataaagca aaaggagata tatgtagcca tctactcaaa gctaatttat 3420

cataattttt ttattgtctg aaactaaaaa actgcatttg ttctatacta tggcttttgg 3480

gatgatcaag gagttagtaa gaatcactga tccggcacca atgtgatgaa attgatgtat 3540

atcatcctga acattccatt ttcatatcaa tctttattcc tgcttatgtt gttgaatctc 3600

caatctttgt gcccaaaaca acaaaaactt gtggagctgc aaatgctaat tttgtcattt 3660

caataaaaca tcatggtggt gtctaaagag gagaaatgtt tacgtatgaa cattgctgca 3720

aagttttcct ttatgtggct atatgtttta actttctata aaggattgga gcctcttggt 3780

tagagtcaag cttgttgatt tgcatacctt ttcattattc ttaaatgtac ttgaaactaa 3840

atcgacatga tcattaacta tataacacca gtctaaagaa caccaatcta aagaacacac 3900

ttaatgcttc tctatgaagg tttctctttt ggtatgtaat acttgctcat cggatgtatc 3960

cttttttgtt actattttgt ctcgtgaact atacatttga agattatttt gtggtggtat 4020

tctttactac tgcggcattc cagcagctgt aaaagtatgt gcaattatac tgttaaaaaa 4080

tctccaacat tggcagtccc ctagcttgga atctgtcgat attttctgtg tttatgttat 4140

gatttcttgc aaacatattt tagattctta aattttaatg gcgtggttgt tctagcttaa 4200

atatgtttag aacaagggat gtgacacctt tactttgtgc agaataaacc ttcatgctga 4260

tctcttgtgt atcaagcctt caggctaggg gtgtaagtgg ctaacccgcg aaacccactt 4320

ataggctaaa ataagccgcg aacccgttta ttttgaccta taagtgggtt cgcggctgac 4380

ccacttacag ccctacttca ggcacatgag gatcaatcat ttcatagtgt gactatttgt 4440

agttatctgt atggccgtaa ataatggcct ctatattgtt ctgtattgga gtatctctct 4500

actatttttt tctctgaaga agagcattct tttacctatt tttggttttc ataatttaat 4560

gtgatgcata atttgattct gttctttttt agataaagga ggctaatttg attctgttct 4620

tgcaattgtg gatgcactgc agggaatgca tgtgtcgctg agccagcagg tgcagcaggt 4680

tgaggacaca tatgagcagc tctctctggc tctcggggag gcagcaacaa ctgacctttt 4740

cagaaagtcc gtgttctttt tctcaatcgg gagcaacgac ttcatccact attacctgcg 4800

caatgtgtct ggcgtccaga tgcgttacct cccatgggag ttcaaccagc ttcttgtcaa 4860

tgcaatgagg caggaaatca aggtgtggtt attgttctcc agtttattct ctctgtgcaa 4920

catttcttgc ctccttatga ttccagtttt agttttttga tcagtgtgtt gcatattgcc 4980

caaaggctgt agtatcgtgc ttagcagtgg ccaatgttgt gagtatgaat ttgatccgta 5040

atttacggcc cgtaaatatt ctgtgcttga aaggtatctg ctctcagttc caccacccag 5100

atgtgaatag ttctttgtac tcctggttag gaatatgttt gagaaaagga ggagtgtgga 5160

cctctgggga ctgcagatac atgaattatg gaaaactagc tatgaacatt aatttttatg 5220

tttcaagggc tagaaaattt tcaaatgttt atagagaaac ctgatatagt acactttttc 5280

tgtaggttaa agttttcaaa tggtggatga gtttaaaacc gtgtacagtt ttggactgaa 5340

gcttctttga gttactgaaa tcctcaggct gtacagtttt tctgtagtta tgaattaggt 5400

taaaaggata ggagggtatt tcatctgtac atttgtaata tgggaaagtt aactgataaa 5460

tacatggaat tgattaactc aatggatatt tatatcgttg gctgttagca gttctgtggt 5520

gttatgtact ttacattctc cgtctaccgt accttagttt cagatttgag gtagtacgtt 5580

gcaacgttgc tcaacaagga catacttgtt ttttatatgt tcattttgaa ttcttaacat 5640

tttgatcaga taaggcggcc ccaaatctga tagggactga tgtaaagtcg atactgaata 5700

ttgtcttgga ctgaatactg tgtttgagtc ccttagttct tggtctgcgc atacttccag 5760

agtggattgt actttgtact gcctcccatt tggaagtgca agctaaatgc gtgttacttt 5820

tgctcaactt gtaggacacc atgcacacta ccaatatgcc catgatctta ccatgataca 5880

aacataattc tcacatcatg cataaatgca taatgcacaa tttgattttc tccctaattt 5940

atcccctttc cttttttgaa cggataattt taatttgcaa aagaattggt aaaaatggcc 6000

ccaaatttct attcagtaaa tctttggcag agcatgcgat gcacattgat tgaggctgca 6060

tgcgccatga gtttatttgt actgtccaac atttgagagc agaaatttct gttaccattg 6120

tactcatcca agttgacttg agatgttgct ttcttgtttc ttaaccttag taaatcagtt 6180

acaatgatgc atttttttat tatttagcca tatgcagttc ttgtcagattagattattaa 6240

gctatttata tctatatata agagttctgt acttcctgca gaatttgtac aatatcaatg 6300

ttcggaaggt cgtcatgatg ggcctccctc ctgttggctg cgcacctcac tttctctggg 6360

agtacggcag tcaagacggg gaatgcatcg actacatcaa taacgtcgtg attcagttca 6420

actatgccct gagatacatg tctagtgaat tcatccgcca gcacccaggc tctatgatca 6480

gttactgtga tacttttgag gggtctgtgg acatactgaa gaatcgtgac cgctacggtg 6540

agcagatgta tcattgttac tactgtcaga ttgcctttct gtccttaggg aagaactcac 6600

attacgatgg aatcacattg tgcaggtttt ctgaccacca ctgatgcctg ctgtgggctg 6660

gggaagtatg ggggcctgtt catgtgtgtt cttccacaga tggcgtgcag cgacgcgtcg 6720

agccatgtct ggtgggacga gttccacccc acggatgctg tgaaccgaat cctggctgat 6780

aatgtgtggt ctggtgagca taccaagatg tgctatcctg tggatttgca gcagatggta 6840

aaactcaagt agaactgaac caacccttaa actccattgt agttacttgc tcagcttttg 6900

tgattttctg accaaaaaat gaaaaactta acaaggcggc acggagaagt gtatatcttg 6960

agagctagta aaattttttc gtagatacag atttgtgtag aaataccatg ttcatatgtg 7020

ggcactgcac tgtaaaggat ctgtatggcc aaactgcatg aggtgcttgg taggtgaaca 7080

taaaacattg ctgagaactc acctggtgtg cttaactccc caattctcac atgttttgtt 7140

taacttctga tacggttata gatttatggt gaaatgttat tatgtgttgc agttttctgc 7200

ttttctggtg aatccatatg ggcaacatca aaggtatttc caagaacaca agttttatgg 7260

tactctggta ctagctatgt tctgttatca actgatttat cctcttatag atcaaaacac 7320

tgcttccact gcctcctact gcactaatca acaagcagta acatcttgtc ctgctttaca 7380

cggtcagttt acaaaataca gccttgccca taacagagag acaaattaca acctccatat 7440

caacatgccc cttaattaca atcaactcct cagctgacca ccttgtagct tgtttagatt 7500

ctgatttgca atcctatcct tccaagtgct gacagctgga gctctctctg ttgctgcaac 7560

tagagaaact ctgaattcca aagctctgta tctgaagtcc tgatgcttta gcaagctgag 7620

ctatctctct tcccatggtt tggccatact cataagagaa aaatataagg aagagcatgg 7680

agagtagctg agtagccatg gatgctacaa ctcttcatca tcaactccag agttgagaac 7740

aaaactgggg aatgccattg ttatgtccct gaacacgaaa atcgacaagg caatacatca 7800

gaatttcatt tatagttgaa agcaatgtaa aaggtaacta cggtgaagag aaacctgaaa 7860

aattgtagat ggtacttact tcaggtatgg gagggtcatg ttcttcagca aagcagggtt 7920

tttacttgcg aacgccttcc attcatccgg gtcgatcttc ccgtcgctgt ttaagtctgc 7980

ttgcttgaac gtctgtcaaa aagtagcata aattcaaact tcagttatat ggggaagaaa 8040

taaattgaga ctagtattac atcttcatgt gctttacctg atccacaatc tgctcaacag 8100

cgtcatcaga aaggagcaga tctgattcat tcagaatggc gagcaccatt tcgtacaact 8160

gcttgattca taagggaaaa aaaaagaggt ttcagtaact ttaggatttt ctctgtcaaa 8220

atgaaaatgc agtacaaata ttgttccgaa acaatacttt gtatctccag ttttccacgc 8280

tcagcctctg gatgttttag gatttaaaca agtctttaac agggttcaat acatatattc 8340

ttcaccattt atacaaccat tatttatgca tgttttcttt gatatcgcca agaaaactgg 8400

tgtaccatcg ccatcagtac tgaaggctag ctatgcatgg a 8441

Claims (3)

1. Rice pollen germination hole development and pollen fertility geneOsAOMThe mutant gene of (1), characterized in that: the nucleotide sequence of the mutant gene is shown as SEQ ID NO. 4.

2. The rice pollen germination hole development and pollen fertility gene of claim 1OsAOMThe mutant gene of (2) is applied to rice breeding.

3. Use according to claim 2, characterized in that: the rice pollen germination hole development and pollen fertility geneOsAOMThe mutant gene of (2) is applied to the preparation of a rice male sterile line.

Images