CN110714022B - A gene STK1 for pollen competitiveness; 2 and application thereof in improving efficiency of propagating plant nuclear male sterile line - Google Patents

Abstract

The invention discloses a pollen competitiveness gene STK1;2 and the application thereof in improving the efficiency of propagating the nuclear male sterile line of the plant. The invention reduces the expression level of pollen fertilization competitiveness regulatory genes STK1 and STK2 (serine threonine kinase1; 2) on the RNA level, reduces the competitiveness of corn pollen participating in fertilization, combines the corn pollen with a transgenic technology plant male sterile line propagation technical system, and improves the production efficiency of the sterile line.

Description

A gene STK1 for pollen competitiveness; 2 and application thereof in improving efficiency of expanding propagation of plant nuclear male sterile line

Technical Field

The invention belongs to the field of plant genetic breeding and seed production, and particularly relates to expression regulation of genes STK1 and STK2 for regulating and controlling pollen fertilization competitiveness and application of the genes in improving the efficiency of propagating plant nuclear male sterile lines.

Background

Due to the existence of heterosis, the biomass, the disease and insect resistance and the stress resistance (drought, high temperature, low temperature, saline alkali and the like) of the hybrid seeds are greatly improved compared with that of the parents, and for example, the yield of the hybrid corn and the hybrid rice is far higher than that of the homozygous parents. The methods generally employed for producing hybrids are: and (4) breeding the female parent and the male parent together, removing the tassel of the female parent, keeping the tassel of the male parent, and harvesting seeds of the female parent, namely the hybrid.

The plants in nature have three types of self-pollination, cross pollination and normal cross pollination, wherein the self-pollination refers to the phenomenon that the pollen of one plant pollinates pistils of the same individual. In the plants of the amphoteric flowers, the pollination can be divided into the same-plant cross pollination (Cajanus) for pollination between stamens and pistils of the same flower, the adjacent-plant pollination for pollination between different flowers in an inflorescence (individual) and the same-plant cross pollination for pollination between different flowers of the same plant. Some plants, the stamens and pistils of which do not grow in the same flower or even on the same plant, cannot self-pollinate, and the pistils of which only obtain the pollen of other flowers, which is called cross pollination. The crops with natural hybridization rate higher than 50% and self-declining performance are classified as normal cross-pollinated crops, such as corn.

The corn is a hermaphrodite plant, male and female flowers are positioned at different parts of the plant, the corn can propagate offspring through self-pollination or cross pollination, and natural pollination is completed when pollen is blown from the tassel to the filaments of the tassel under natural conditions.

In corn breeding, a homozygous corn inbred line is first developed, then the two inbred lines are crossed, and the progeny of the cross is evaluated for yield, stress resistance, etc. to determine whether it has commercial potential. Wherein each inbred line may have one or more elite traits that are lacking in the other inbred line, or complement one or more undesirable traits of the other inbred line. The first generation of seeds hybridized by the two inbred lines are F1 generation seeds, F1 generation plants are obtained after the seeds of the F1 generation germinate, and the F1 generation plants have strong advantages in the aspects of growth potential, stress resistance and the like compared with two inbred line parents (parents) and simultaneously have more biomass.

The hybrid can be produced by manually castrating the female parent, namely, removing the tassel of the female parent which is not pollen-dispersed (the female parent and the male parent can be sown at intervals in the field, such as sowing 5 rows of female parents and sowing one row of male parents), and keeping the tassel of the male parent. And then, as long as the foreign corn pollen is isolated, the female ear of the female parent can only accept the pollen of the male parent, and the obtained seed is the hybrid (F1), and the hybrid can be used for agricultural production.

In the process of producing the hybrid seeds, because environmental changes can cause tasseling of the plant after emasculation is finished or emasculation is incomplete, the two conditions can cause female parent self-pollination, so that the produced hybrid seeds are mixed with the seeds of the female parent self-bred line, the yield of the female parent self-bred line is far lower than that of the hybrid seeds, the seeds are unqualified products, the income of farmers can be influenced, the reputation of a seed production company can be influenced, and the seed production company can be seriously caused to bear corresponding compensation responsibility.

The female parent can also be castrated by a machine, which is substantially the same reliability as, but faster and less costly than, manual castration. However, most detasseling machines cause greater damage to plants than manual detasseling, and therefore, there is currently no completely satisfactory means of detasseling and a less costly and more thorough alternative to detasseling is sought.

The stable male sterility system provides a simple and efficient means by which the laborious detasseling can be avoided in some genotypes by using the Cytoplasmic Male Sterility (CMS) inbred line. The approach includes three main materials, namely the sterile line: male sterile material, maintainer line: can provide pollen for the sterile line, so that the progeny of the sterile line is still the sterile line, and the restoring line: the fertility of the sterile line can be restored. The sterile line is crossed with the restorer line to generate F1, namely a hybrid for agricultural production. More specifically, the sterile type of nuclear-cytoplasmic interaction is characterized by inheritance of nuclear-cytoplasmic interaction. It is required that the cytoplasm has a sterile gene S and that the nucleus has a homozygous sterile gene (rfrf) both, so that the plant can be male sterile. If the cytoplasmic gene is fertile N, then the nuclear gene is rendered male fertile, whether fertile (RfRf) or sterile (RfRf). Similarly, if the nucleus has a fertile gene (RfRf) or (Rfrf), the cytoplasmic gene is male fertile regardless of whether it is fertile N or sterile S. The male sterile line formed by the nuclear-cytoplasmic interaction has a genetic composition of S (rfrf), cannot produce normal pollen, but can be used as a female parent of a cross. Since the maintainer line N (rfrf) can be found [ with which to cross the sterile line, the resulting F1 can still remain male sterile, i.e.: s (RfRf) ((female) xn (RfRf) → S (RfRf) (sterile)) and can accept either restorer S (RfRf) or N (RfRf) [ with which the sterile line is crossed, the resulting F1 is fertile, i.e.: pollen of S (RfRf) (female) xS (RfRf) → S (Rfrf) (F1) (fertile), or S (RfRf) ((female) xN (RfRf) → S (Rfrf) (F1) (fertile)) restores F1 to male fertile, and F1 plants self-cross to generate F2, so the method can be widely applied to agricultural production. The male sterile line can avoid manual castration, save manpower, reduce seed cost and ensure seed purity. At present, rice, corn, sorghum, onion, castor, beet, rape and other crops utilize nucleoplasm interaction male sterility to produce hybrid seeds; extensive research is also being conducted on the nuclear-cytoplasmic interaction male sterile line of other crops.

CMS also has its drawbacks, one being that individual CMS materials are observed to be susceptible to disease, and the other being that restorers are relatively difficult to find, which hinders the wide application of CMS systems in seed production.

One type of genetic sterility is disclosed in U.S. patents 4654465 and 4727219 to Brar et al. However, this type of genetic sterility requires the maintenance of the corresponding genotype at a number of different sites within the genome, requiring molecular marker-chase detection of these sites for each generation. Patterson also describes a potentially useful chromosomal translocation gene system, but this system is more complex (see U.S. Pat. Nos. 3861709 and 3710511).

Attempts have been made to optimize male sterility systems, for example, fabijanski, et al, developed methods for male-sterilizing plants (EPO 89/3010153.8 publication No. 329308 and PCT application PCT/CA90/00037 published as WO 90/08828). The male flower fertility of a plant is inhibited mainly through the following two ways, one way is that a promoter specifically expressed by male tissues is connected with a cytotoxin gene and is transferred into the plant, so that the male flowers cannot normally loose powder and other characters are not influenced; the other is to interfere the cloned gene controlling the male flower fertility of the plant by means of gene interference through means of transgenosis, so that the plant cannot normally function. There are also means for influencing plant fertility by inhibiting gene expression through some gene regulatory elements (WO 90/08829).

In most cases, only nuclear gene recessive homozygous (Msms) plants that control male sterility will exhibit male sterility, and since male sterile plants cannot be selfed, male sterile plants (Msms) will only be obtained by crossing them with heterozygous plants (Msms). And the male sterile grains (Msms) and the fertile heterozygous grains (Msms) exist on the same cluster at the same time, and the grains cannot distinguish which are sterile grains and which are fertile grains, and can be distinguished only after sowing and pollen scattering of plants.

In recent years, transgenic approaches have also been used to maintain sterility in male sterile plants (US 6743968). The method constructs a pollen lethal gene and a male fertility restoring gene in a carrier, and introduces the pollen lethal gene and the male fertility restoring gene into a male sterile plant, so that transgenic offspring shows fertility, but only pollen without the restoring gene can be generated. When such plants are crossed with male sterile plants, the homozygous recessive state of the recessive sterile plants is maintained. Firstly, a transgenic vector is constructed, the vector contains a pollen cell lethal gene, and simultaneously the vector also contains a dominant gene for restoring plant fertility. The vector is transferred into a male sterile plant, and exists in a heterozygous state in the transgenic plant, the plant can be bred due to the existence of a fertility restoring gene, when the plant is hybridized with the male sterile plant, pollen (Msms) containing the restoration gene also contains a lethal gene, so that the pollen is aborted, and only the pollen (ms) without the restoration gene can be hybridized with a female gamete (ms) of the male sterile plant, and the offspring is recessive homozygous individuals (Msms).

As described above, an important issue in many of the production of seeds using male sterile systems is how to use the male-sterile genes and how to distinguish between male-sterile seeds and plants and fertile seeds and plants, and how to maintain sterility of the sterile individuals.

Various male-sterile mutants have been identified in maize (Skibbe et al 2005), in particular in the following table:

TABLE 1 Male sterile mutants caused by Nuclear genes

These genes have been cloned sequentially, such as ms45 (Albertsen et al 1993) and ms26 (PTC/US 2006/024273), and some male-sterile genes in rice have been cloned sequentially, such as dpw (sting Shi et al 2011) and some identified in Arabidopsis, such as (Aarts, et al 1993).

Disclosure of Invention

The invention aims to improve the production efficiency of sterile lines.

The invention provides a method for maintaining the homozygous recessive state of a male sterile plant, which comprises the following steps:

(a) Providing a first plant comprising a homozygous recessive allele that renders the plant male-sterile (in embodiments the homozygous recessive allele is specifically ms45ms 45);

(b) Providing a second plant comprising the same homozygous recessive allele as said first plant which renders the plant male sterile and containing a construct which (in the example transgenic element Ms 45-RNAi) is present in said second plant in heterozygous state (heterozygous Ms 45-RNAi/-inserts are present in only one chromatid, which sister chromatids do not contain a transgenic element), said construct comprising:

i. a first nucleotide sequence that when expressed in said first plant will restore said first plant male fertility;

a second nucleotide sequence which, when present in a heterozygous state, affects pollen fertilisation competitiveness;

the first nucleotide sequence (in the embodiment, ms45 gene expression element shown in sequence 1) is closely linked with the second nucleotide sequence (in the embodiment, interference fragments of STK1 and STK2 genes), and the two nucleotide sequences exist in the plant at the same time (in the embodiment of the invention, referred to as transgenic element Ms 45-RNAi);

(c) Fertilizing the male gamete of the second plant with the female gamete of the first plant to produce progeny that maintain the homozygous recessive condition of the first plant.

The method is a method for propagating the male sterile line of the plant;

and/or said plant, said first plant and said second plant are each a dicot or a monocot;

and/or, the plant, the first plant and the second plant can be not only corn (Zea mays), but also rice (Oryza sativa), sorghum (Sorghum bicolor), wheat (Triticumaestivum), soybean (Glycine max), cotton (Gossypiumhirsutum), sunflower (Helianthus annuus) and other crops.

In the above method, the first nucleotide sequence includes a male fertility controlling gene, such as the wild type allele Ms45 of Ms45 in table 1, the male fertility controlling gene is not limited to the genes listed in table 1, and the male fertility controlling gene in maize or other species can also achieve the purpose of the present invention and is therefore within the scope of the present invention.

In the above method, in the embodiment of the present invention, the first plant is a Maize male sterility mutant ms45, specifically a ms45 homozygous recessive inbred line Zheng58 (ms 45ms 45)), which is derived from backcross progeny of the ms45 homozygous recessive mutant (Maize Genetics collaboration Stock Center,905I; mutation site is described in table 1 as ms 45) and Zheng58 (zheng 58).

The first nucleotide sequence is Ms45 gene expression element in the embodiment of the invention, and the Ms45 gene expression element expresses protein Ms45 in the first plant.

The protein Ms45 is a) or b) as follows:

a) A protein consisting of amino acid residues shown in a sequence 2;

b) And (b) a protein which has the same function as the protein of the sequence 2 and is subjected to substitution and/or deletion and/or addition of one or more amino acid residues.

In the method, the Ms45 gene expression element comprises Ms45 gene promoter, ms45 gene 5'UTR, ms45 gene exon, ms45 gene intron, ms45 gene 3' UTR and Ms45 gene terminator;

the Ms45 gene expression element is a DNA molecule shown in the following 1) or 2) or 3):

1) The coding region comprises a DNA molecule of a sequence 1 or a DNA molecule of a reverse complementary sequence of a sequence 3 from 4762 to 8265 of the 5' end;

2) The coding region is DNA molecule of sequence 1 or DNA molecule of reverse complementary sequence from 4762-8265 th position of 5' end of sequence 3;

3) DNA molecules which are obtained by substituting and/or deleting and/or adding 1) or 2) by one or more nucleotides and have the same functions as 1) or 2).

In the above method, the second nucleotide sequence reduces pollen fertilization competitiveness when present in the second plant in a heterozygous state, but does not affect pollen fertility.

In the above method, the second nucleotide sequence comprises an interfering fragment of a specific gene; the specific gene is a gene capable of regulating the competitiveness of the pollen fertilization. The reduction of the expression level of the gene does not affect the fertility of corresponding pollen (different from pollen lethality), the pollen can normally develop, the pollen which changes the transgene expression is obviously different from the wild type pollen in the fertilization competitiveness, and the transgenic pollen has greatly reduced competitiveness in fertilization under the mixed condition with the wild type pollen. However, the transgenic pollen can complete normal pollination and fertilization, and pollination can be carried out under the condition that all the transgenic pollen (without competition) is used, so that normal fructification can be realized, and high fructification rate can be achieved.

In one embodiment of the invention, the second nucleotide sequence comprises interfering fragments of the STK1 and STK2 genes; the reverse complementary sequence of the interference fragment is shown as 11282-11875 th bits from the 5' end in the sequence 3 of the sequence table. The reverse complementary sequence of the second nucleotide sequence, i.e. the complete expression element of the interference fragment, is shown from position 10982-13578 of the 5' end in sequence 3 of the sequence listing.

The present invention relates to nucleotide sequences for controlling male fertility and plant pollen competitiveness, and a method for expanding and propagating plant male sterility, which is developed by using the nucleotide sequences and a transgenic technology.

It is another object of the present invention to provide a DNA construct.

The present invention provides a construct as described in the above method (in the examples, a circular plasmid represented by sequence 3 of the sequence listing).

The DNA construct can restore fertility of the male sterile mutant and change pollen competitiveness of plants.

The 3 rd object of the present invention is to provide any one of the following substances.

The invention provides the following substances:

1) A plant, which is a second plant as described in the above method;

2) A tissue culture of regenerative cells produced by the plant of 1);

3) Protoplasts produced from the tissue culture of 2);

4) A plant which is a homozygous recessive male sterile plant produced by the method described above.

The second plant can maintain the sterility of the male sterile plant.

The application of the homozygous recessive male sterile plant produced by the method in producing hybrid is also within the protection scope of the invention.

The key point of the invention is that a male recovery gene Ms45 and an element for controlling plant pollen competitiveness are built in a carrier, the carrier can recover the fertility of a male sterile mutant Ms45, and simultaneously, the plant pollen competitiveness containing a transgenic element is reduced, so that in the cultivation process of a sterile line, the proportion of plants (fertile individuals) containing the transgenic element is reduced, and the proportion of sterile individuals (sterile lines) is increased, thereby realizing the propagation of the sterile individuals (sterile lines).

In one embodiment of the invention, the inventor firstly constructs a plant transformation vector, the vector comprises an expression element of a gene for restoring the male fertility and interference fragments of genes STK1 and STK2 for regulating the maize pollen fertilization competitiveness, the vector is transferred into HiIIA × HiIIB maize hybrid, and then backcross is carried out on the obtained transgenic plant by using a male sterile plant, so that the interference fragments of the gene for controlling the plant male fertility Ms45 restoring gene and the genes STK1 and STK2 for regulating the maize pollen fertilization competitiveness are introduced into a male sterile plant Ms45. The transgenic plants appeared fertile due to the presence of the restoring gene Ms45. When a transgenic heterozygote plant (Msmsms) is hybridized with a male sterile plant (msms), the following two progeny can be generated, one is a male sterile individual (sterile line, genotype is msms) without a transgenic sequence, the sterile line can be restored by any wild plant, and can be used as a sterile line in the process of seed production; the other is fertile seeds (a maintainer line, the genotype is Mmsms) containing a transgenic element, the maintainer line controls the male fertility site to be recessive homozygous, the plant is fertile due to containing a transgenic sequence which can be complemented, and the plant pollen competitiveness is reduced due to containing interference segments of the genes STK1 and STK2 of the maize pollen fertilization competitiveness regulation genes, the proportion of the maintainer line relative to the sterile line is reduced, the proportion of the sterile line is increased, and the propagation of the sterile line is realized.

Other objects of the invention will be apparent from the description and claims that follow.

The present invention relates to the present method for propagating nuclear male sterile line of plant (for example, the patent applied by the inventor of the present invention) "

Compared with the method for expanding propagation of the plant nuclear male sterile line by the morphological marking method), has a remarkable advantage that the proportion of the obtained sterile line is obviously improved (the proportion of the sterile rate obtained by the method is improved to about 80 percent, and the proportion of the sterile rate obtained by the existing method is only about 50 percent).

The invention reduces the expression level of pollen fertilization competitiveness regulatory genes STK1 and STK2 (serine threonine kinase1; 2) on the RNA level, reduces the competitiveness of corn pollen participating in fertilization, combines the corn pollen with a transgenic technology plant male sterile line propagation technical system, and improves the production efficiency of the sterile line.

Drawings

FIG. 1 shows the male flower phenotype of male fertility mutant Ms45 (A) and wild type Ms45 (B).

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and unless otherwise specified, the techniques used or mentioned herein are standard techniques, materials, methods and examples recognized by one of ordinary skill in the art, which are set forth only and are not intended to be limiting.

Nuclear male sterility is the result of critical genes in the microspore formation process being mutated, suppressed or otherwise affected, collectively referred to as male sterility genes. The pollen development pathway is controlled by a plurality of genes, so that the mutation of the genes finally causes male sterility, and a large number of male sterility mutants (shown in table 1) are identified in maize at present, and each male sterility gene has a specific restoring gene, namely each male sterility mutant can only be restored by a wild type allele.

Taking one male sterile mutant in table 1 as an example, such as Ms45, male flowers of the mutant cannot be normally pollen shed (as shown in fig. 1, a is a male sterile mutant, and B is a wild type), and the fertility of the mutant can be restored by the Ms45 gene in the wild type plant. The wild type restoring gene Ms45 is derived from an inbred line B73, the sequence of the wild type restoring gene Ms45 is shown as a sequence 1, and the sequence comprises the complete expression element of the Ms45 gene, namely a promoter, 5'UTR, an exon, an intron, 3' UTR and a terminator. After the nucleotide shown in the sequence 1 is transferred into the ms45 male sterile mutant, the mutant plant becomes fertile. The Ms45 gene expression element shown in sequence 1 encodes the Ms45 protein shown in sequence 2.

Functional elements are introduced in the process of expanding propagation of the nuclear male sterile line of the plant, and the functional elements comprise a promoter, an interference fragment of maize pollen fertilization competitive regulatory genes STK1 and STK2 and a terminator. Expression of the functional element can lead to a decrease in the competitiveness of pollen pollination.

The STK1 gene has accession number Zm00001d045056 in MaizeGDB.

The STK2 gene has accession number Zm00001d003377 to MaizeGDB.

The following more detailed description is provided by way of illustration and description and is not intended to limit the scope of the invention.

Example 1 construction of a plant transformation vector comprising the Male fertility Gene Ms45 and functional elements and a selection marker Gene

The present invention specifically illustrates embodiments by taking ms45 male sterile mutants in Table 1 as examples.

The Ms45 gene complete expression element and the functional element are constructed into a vector to obtain a transformation vector (a circular plasmid shown in a sequence 3 of a sequence table) constructed by the method. The transformation vector comprises a male fertility gene Ms45, a functional element and a selection marker gene bar.

In the sequence 3 of the sequence table, the 4762 th to 8265 th positions from the 5 'end are the reverse complementary sequence of the complete expression element of the Ms45 gene (when a vector is constructed and amplified, the 5' 5664 th position in the sequence 3 is mutated to generate 1 base difference with the sequence 1, but the coded amino acid sequence is not changed, the protein function is not influenced, and the rest of the base is not changed), the 10982 th to 13578 th positions are the reverse complementary sequence of the functional element (the complete expression element comprises interference fragments of maize pollen fertilization competitiveness regulatory genes STK1 and STK2 genes, wherein the reverse complementary sequence of the interference fragments is shown as 11282 th to 11875 th positions, the reverse complementary sequence of the promoter is shown as 11876 th to 13578 th positions, the reverse complementary sequence of the terminator is shown as 10986 th to 11238 th positions), and the 13899 th to 15353 th positions are the complete expression element of the selection marker gene bar (wherein the 99 th to 13876 th positions code the promoter, the 14621 th to 15172 th positions code the selection marker gene, and the 15179 th to 15353 th positions code the terminator 15153 th positions 15153. The male fertility gene Ms45, the functional element and the selection marker gene bar are positioned on the same T-DNA.

Example 2 transformation of maize with plant transformation vectors to obtain transgenic maize

(I) transformation of maize with plant transformation vectors

The invention obtains transgenic plants by a method of infecting maize immature embryos with agrobacterium. Transforming agrobacterium tumefaciens EHA105 by using the plant transformation vector obtained in the embodiment 1 to obtain recombinant agrobacterium tumefaciens, and infecting corn immature embryos by using the recombinant agrobacterium tumefaciens, which comprises the following steps:

the plant transformation vector of example 1 was transformed into Agrobacterium EHA105 to obtain recombinant Agrobacterium.

The receptor used in the transgenic process of the laboratory is the F1 generation of the hybrid of the inbred lines HiIIA and HiIIB. Maize inbred lines HiIIA and HiIIB (Armstrong C L, green C E and Phillips R L. Development and availability of germplasm with high Type II culture transformation response. Maize Genetics Cooperation News Letter,1991, 65-93.

Firstly, planting maize inbred lines HiIIA and HiIIB in a field, and respectively bagging when the inbred lines disperse flour; then ready to pollinate, there are two modes of pollination: hiIIA is used as a female parent, and HiIIB is used as a male parent; taking HiIIA as a male parent and HiIIB as a female parent, and taking immature hybrid young embryos on pollinated ear grains 9-11 days after pollination; and then infecting by using the agrobacterium tumefaciens EHA105 indoors, placing the immature embryos invaded by the agrobacterium tumefaciens EHA105 on a selective culture medium for multiple times of screening to obtain resistant callus, and regenerating the resistant callus into seedlings to obtain transgenic T0 generation plants. After the transgenic T0 generation is obtained, some seed production female parents and Ms45 male sterile materials are hybridized by using pollen of T0 generation transgenic plants, and phenotypes are observed.

The plant transformation vector of example 1 was introduced into the immature embryo of a recipient plant by the Agrobacterium tumefaciens EHA105 infection method, and a transgenic plant was obtained after screening with the herbicide bialaphos. The specific method comprises the following steps:

the specific method comprises the following steps:

1. stripping of embryos

1. Removing the bracts. Cutting off the top end of the hybrid F1 generation fruit cluster of HiIIA and HiIIB by about 1cm, inserting the fruit cluster from the top end by using a pair of tweezers, taking the tweezers as a handle to facilitate operation, then putting the fruit cluster into a beaker containing disinfectant, and putting 4-6 fruit clusters into the same beaker according to actual needs.

2. Adding 700ml of disinfection solution (50% of bleaching agent or 5.25% of sodium hypochlorite, and adding a drop of Tween 20) into a beaker to soak the cluster, rotating the cluster at times while gently beating the beaker to remove air bubbles on the surface of the seeds during disinfection for 20 minutes so as to achieve the optimal disinfection effect, taking out the cluster after disinfection, putting the cluster into the beaker filled with sterilized water, washing the cluster in water for 3 times, and preparing for embryo peeling.

3. Placing one end of the sterilized ear on a large petri dish, and cutting off the top (1.5-1.8 mm) of the kernel with a large scalpel, wherein tools for sterilization are required, such as: surgical blades, petri dishes, embryo-stripping knives, and the like.

4. Inserting the tip of an embryo peeling knife between the embryo and the endosperm, prying the immature embryo upwards slightly, slightly supporting the immature embryo by a small operating tip to ensure that the immature embryo is not damaged, and tightly attaching the embryo axial surface of the immature embryo to an N6E culture medium containing filter paper, wherein the density of the embryo is about 2X2cm (30 embryos per dish).

5. Sealing the culture dish with a sealing film, and culturing at 28 deg.C in dark for 2-3 days.

2. Agrobacteria dip dyeing

1. The recombinant Agrobacterium is cultured on YEP (containing Kana33mg/L and Str100mg/L antibiotics) culture medium for one week before, and is preserved in 4 deg.C refrigerator for about one month, and preserved in-80 deg.C glycerol for long term

2. The recombinant Agrobacterium was cultured on YEP medium at 19 ℃ for 3 days with addition of Kana (33 mg/L), str (50 mg/L).

3. After 3 days, the recombinant Agrobacterium was picked into a 50mL centrifuge tube containing 5mL of the staining medium, while adding 100uM AS (inf + AS), and shaken at 75rpm for 2-4 hours at room temperature (25 ℃).

4. The immature embryos are impregnated, the just stripped immature embryos are put into a centrifuge tube containing inf + AS liquid medium (2 ml), about 20-100 immature embryos per tube are washed 2 times by the medium, then 1-1.5ml of agrobacterium with a specific concentration (OD 550= 0.3-0.4) is added, the centrifuge tube is slightly inverted for 20 times and then placed in a dark box for 5 minutes in an upright way, the immature embryos are all soaked in the agrobacterium liquid, and vortex oscillation is avoided in the whole process.

3. Co-cultivation

1. After the impregnation, transferring the impregnated young embryo to a co-culture medium (the solute is shown in table 2, and the solvent is water), so that the embryonic axis of the young embryo contacts the surface of the culture medium, and simultaneously, the redundant agrobacterium on the surface of the culture medium is removed;

2. the petri dish was sealed with a sealing film and incubated at 20 ℃ for 3 days in the dark.

4. Resting culture

1. After 3 days of co-cultivation, the embryos were transferred to a resting medium (solute as in Table 2, solvent water) while the petri dish was sealed with a sealing film and incubated at 28 ℃ for 7 days in the dark.

5. Selecting

1. After 7 days, all embryos were transferred to a selection medium (solute as in Table 2, solvent water) (35 embryos/dish) and cultured for two weeks, the selection medium contained 1.5mg/L of diphenylpropylamine phosphate, and after two weeks the concentration of diphenylpropylamine phosphate in subcultures was increased to 3mg/L.

2. After about 5 weeks of infection, cells containing the transformants grew into visible type II calli.

6. Regeneration of transgenic plants

1. Transgenic maize of the T0 generation was grown for 3 weeks on regeneration medium I (solutes as in Table 2, water as solvent) and then germinated (in a light chamber) on regeneration medium II (solutes as in Table 2, water as solvent) to yield transgenic maize.

2. When 3-4 leaves grow out from the regenerated seedling, the regenerated seedling is transferred to a greenhouse, and when the regenerated seedling grows to the stage of spinning and pollen scattering, pollination is carried out on the regenerated seedling.

TABLE 2 media solutes and content

In Table 2, MS salt was purchased from Phyto Technology Laboratories, inc. under the trade designation M524.

(II) analyzing the obtained transgenic plant

Crossing the T0 generation transgenic corn obtained in the step (one) with ms45 homozygous recessive mutant (ms 45 male sterile material, maize Genetics Cooperation Stock Center, 905I) to obtain a filial generation.

1. Detecting genotype of filial generation

Determining whether a transgenic element Ms45-RNAi is contained or not through the detection of a bar gene; the bar gene detection method comprises the following steps: PCR amplification is carried out on the filial generation by using the following primers Bar669F and Bar669R, if the size of the target fragment is 669bp, the filial generation is the filial generation containing the transgenic element Ms45-RNAi, and if the size of the target fragment is not 669bp, the filial generation is the filial generation not containing the transgenic element Ms 45-RNAi.

The sequences of the primers Bar669F and Bar669R are as follows:

Bar669F:5'TCTCGGTGACGGGCAGGAC 3'

Bar669R:5'TGACGCACAATCCCACTATCCTT 3'

the statistics of the proportion of kernels containing expression elements on the ears of the partial filial generations are shown in table 3.

TABLE 3

The result shows that the proportion of kernels containing the expression elements on the ears of the three transgenic lines is lower than 20 percent, because the competitiveness of pollen pollination of the plants containing the transgenic elements is reduced, and the proportion of the kernels containing the transgenic elements in the offspring generated by the hybridization of the transgenic plants and the male sterile mutant ms45 is low.

STK-68, STK-111 and STK-125 were used in subsequent experiments.

Example 3 Mass propagation of the ms45 Male-sterile inbred line Using the Male-sterile maintainer line

The embodiment can be adopted to prepare transgenic plants for carrying out propagation on ms45 male sterile inbred lines, which comprises the following steps:

firstly, the Ms45Ms45 wild type inbred line is converted into a first plant Ms45Ms45 homozygous recessive inbred line

Hybridizing an Ms45 homozygous recessive mutant (Maize Genetics Cooperation Stock Center, 905I) serving as a female parent with an inbred line (such as Zheng 58), continuously backcrossing obtained F1 with a Maize inbred line Zheng58 (grain institute of agricultural departments in Henan province), carrying out genotype analysis on the obtained BC1 population, screening an Ms45 locus as a heterozygous plant, continuously backcrossing the plant with the Zheng58, screening an Ms45 locus as a heterozygous by using a molecular marker after 5-6 generations of backcrossing, and carrying out inbreeding on a single plant with an agronomic trait phenotype close to the Zheng58 so as to obtain the Ms45 homozygous recessive inbred line Zheng58 (Ms 45Ms 45)), wherein the Ms45 homozygous recessive mutant can be used as a sterile line and is called as a first inbred plant;

the method for screening the genotype of the Ms45 locus comprises the following steps: PCR amplification was performed with the following primers Ms 45F and Ms 45R, the size of the Ms45 target fragment: 859bp, ms45 mesh fragment size: 811bp. If 859bp and 811bp target fragments are obtained simultaneously, the Ms45 locus is heterozygous Ms45/Ms45, and if 811bp fragments do not exist, the Ms45 locus is dominant homozygous Ms45/Ms 45; if no 859bp target fragment exists, the mutant is recessive homozygous at ms45/ms 45.

Ms45 F:5'-CTTGAGCGACAGCGGGAACT-3',

Ms45 R：5'-TGTTGTTTCTTGGCAAAGGTCAG-3'。

(II) preparing a second plant

Preparation of a second plant Ms45-RNAi heterozygous and Ms45 homozygous

The Ms45 homozygous recessive inbred line Zheng58 (Ms 45Ms 45)) (first plant, female parent) obtained in the step (one) is hybridized with the T0 generation transformed Ms45-RNAi corn (male parent) obtained in the step (2), then the Ms45 homozygous recessive inbred line Zheng58 (Ms 45Ms 45)) (first plant) is used as a recurrent parent to carry out multi-generation backcross, and the T0 generation transformed Ms45-RNAi corn from the step (2) is converted into an inbred line containing Ms45-RNAi heterozygous and Ms45 locus as homozygous recessive, wherein the inbred line is the second plant heterozygous Ms45-RNAi and Ms45 homozygous, and is called Zheng58 (Ms 45-Lc heterozygous and Ms45 homozygous recessive).

The specific method comprises the following steps:

selfing line Zheng58 (Ms 45Ms 45)) is hybridized, grains containing a transgenic element are selected from filial generations (whether the transgenic element is determined by detecting a bar gene and the same is applied below) and are sowed in a field, ms45-RNAi corn (male parent) is transformed from T0 generation in the embodiment 2 and Ms45 obtained in the step one are subjected to homozygous recessive spraying of 200mM of bialaphos, the surviving plant is subjected to backcross with the Zheng58 (Ms 45Ms 45), and therefore after 5-6 generations of backcross, grains or plants containing the transgenic element are always selected to be hybridized with the first plant in the backcross process, grains containing the transgenic element or plants containing the transgenic locus (Ms 45-RNAi), and the grains or the plant transgenic locus (Ms 45-RNAi) containing the transgenic element in the obtained progeny are both heterozygous. Pollinating a first plant by using pollen of grains or plants containing the transgenic element, if the obtained grains or normal plants not containing the transgenic element are sterile, providing the plant transgenic locus Ms45-RNAi of the pollen as heterozygous and the Ms45 locus as invisible homozygous, and obtaining a second plant.

(III) obtaining the maintainer line

The second plant of Zheng58 (Ms 45-RNAi heterozygous and Ms45 homozygous) obtained in the second step is taken as a male parent, and the second plant is hybridized with the Ms45 homozygous recessive inbred line Zheng58 (Ms 45Ms 45)) (female parent) obtained in the first step, so that the generated offspring not only has Zheng58 (Ms 45Ms 45), but also has a maintenance line Zheng58 of male sterile Zheng58 (Ms 45-RNAi heterozygous Ms45Ms 45). The grain of zheng58 (Ms 45Ms 45) is the grain without transgenic element, while it keeps zheng58 (Ms 45-RNAi heterozygous Ms45Ms 45) grain as the grain with transgenic element.

(IV) carrying out large-scale propagation on the ms45 male sterile inbred line by using the male sterile maintainer line

Taking an Zheng58 inbred line as an example, a first plant male sterile line Zheng58 (Ms 45Ms 45) obtained in the first step and a male sterile maintenance line Zheng58 (Ms 45-RNAi heterozygous Ms45Ms 45) obtained in the third step are sown in the field, the two materials are sown at intervals, 5 rows of sterile lines are sown at each sowing time corresponding to 1 row of maintenance lines, no other corn is sown in 300 meters around the seed reproduction, and the sterile lines and the maintenance lines are naturally pollinated in the field. The maintainer line can only accept own pollen, the grains containing homozygous transgenic components and heterozygous grains in the generated offspring can not be distinguished, the grains are discarded, and the grains without transgenic elements can be used as the sterile line. The sterile line material receives pollen from the maintainer line, and progeny of the line that do not contain the transgenic element are sterile lines and those that contain the transgenic element are maintainer lines. The maintainer line is used for the next year of expanding propagation of the sterile line and the maintainer line, while most of the sterile line is used for the producer variety, and the rest of the sterile line is used for the next year of expanding propagation of the sterile line and the maintainer line. Because the competitiveness of pollen pollination of plants containing a transgenic element Ms45-RNAi is reduced, the proportion of the maintainer line is far smaller than that of the sterile line (the maintainer line accounts for about 20 percent, and the sterile line accounts for about 80 percent), thereby realizing the improvement of the propagation coefficient of the sterile line and reducing the cost.

EXAMPLE 4 Mass production of hybrid seeds Using the Male sterile line of example 3

The sterile line produced in example 3 is a nucleus controlled recessive homozygous sterile line which can be restored to fertility by any wild type plant (Ms 45).

Therefore, only one inbred line with high combining ability with the male sterile (ms 45ms 45), such as the male sterile Zheng58 (ms 45ms 45), such as Chang 7-2, is selected for hybridization, so that hybrid seeds with excellent agronomic characters can be produced. In order to achieve the purpose, the male sterile inbred line and the wild type inbred line are sown in the field in an interlaced mode, no other corn is sown in 300 meters around the seed reproduction, the fruit cluster of the sterile line can only accept the pollen of the wild type inbred line, and the wild type inbred line can only inbred. The seeds produced on the sterile line ears are hybrid seeds.

Sequence listing

<110> university of agriculture in China

<120> expression regulation and control of pollen competitiveness gene STK1;2 and application thereof in improving efficiency of propagating plant nuclear male sterile line

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3504

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tgctgagttc tccttgggtt atccatggtg tctctatgaa aaagatgagt acaatgtgtc 60

tatatccgtt ttcttagggt cccttcttct gccttattac tgactgaatc ggggttacaa 120

aaaaacttcc acgggtgcat gatctccatg ttccacttct cccacctcgc gttgcacatt 180

tcttggatgt cggtggttcc catctgaccg aggcccatca gacacctttc gggacaccca 240

tcaagggcct ttcggatggc ccacgagacg tatcgggtcg tggtgatcca ggggatatat 300

gtcccccaca atcgtcacct atattattat tctttagata ttatttaatt tttggaaaaa 360

taacaaactt atacttttgt gtagggcctc agcatagatt ttcgcttagg gcccagaaat 420

gcgaggacca gccatgtcta gtgtccacta ttggcactac ccagaacaag atttaaaaaa 480

ataaccaaag taactaatcc actcgaaagc tatcatgtaa tgtttaaaga aacatctatt 540

aaaaccacga tcctcttaaa aaacaagcat atttcgaaag agacaaatta tgttacagtt 600

tacaaacatc taagagcgac aaattatatc gaaaggtaag ctatgacgtt cagatttttc 660

tttttcattc ttgttatttt gttattgttt ttatatacat tttcttctct tacaatagag 720

tgattttctt ccgattttat aaaatgacta taaagtcatt tttatataag agcacgcatg 780

tcgtagattc tcgttcaaaa atctttctga tttttttaag agctagtttg gcaaccctgt 840

ttctttcaaa gaattttgat tttttcaaaa aaaattagtt tattttctct ttataaaata 900

gaaaacactt agaaaaatag agttgccaga ctagccctag aatgttttcc caataaatta 960

caatcactgt gtataattat ttggccagcc ccataaatta tttaaaccga aactgaaatc 1020

gagcgaaacc aaatctgagc tatttctcta gattagtaaa aagggagaga gagaggaaga 1080

aatcagtttt aagtcattgt ccctgagatg tgcggtttgg caacgatagc caccgtaatc 1140

atagctcata ggtgcctacg tcaggttcgg cagctctcgt gtcatctcac atggcatact 1200

acatgcttgt tcaaccgttc gtcttgttcc atcgtccaag ccttgcctat tctgaaccaa 1260

gaggatacct actcccaaac aatccatctt actcatgcaa cttccatgca aacacgcaca 1320

tatgtttcct gaaccaatcc attaaagatc acaacagcta gcgttctccc gctagcttcc 1380

ctctctcctc tgccgatctt tttcgtccac cagcatggag aagaggaacc tgcagtggcg 1440

gcgagggcgt gatggcatcg tgcagtaccc tcacctcttc ttcgcggccc tggcgctggc 1500

cctcctagtc gcggacccgt tcggcctcag tccgctggcc gaggtcgact accggccggt 1560

gaagcacgag ctcgcgccgt acggggaggt catgggcagc tggcccagag acaatgccag 1620

ccggctcagg cgcgggaggc tggagttcgt cggcgaggtg ttcgggccgg agtctatcga 1680

gttcgatctc cagggccgcg ggccgtacgc cggcctcgcc gacggccgcg tcgtgcggtg 1740

gatgggcgag gaggccgggt gggagacgtt cgccgtcatg aatcctgact ggtaagtgct 1800

cgatatcgct ccggcgtcca ctcgttacat gctataatat agtagtacta agatattttg 1860

atctgatttt ttgcattctt gggagaaacg tcatgcaaaa tttgttgttt cttggcaaag 1920

gtcagaagaa gtctgtgcca atggagtgaa ctcaacgacg aggaagcagc acgagaagga 1980

ggagttctgc ggccggccgc tcggcctgag gttccacggg gagaccggcg agctctacgt 2040

cgccgacgcg tactacggtc tcatggtcgt tggccagagc ggcggcgtgg cgtcctccgt 2100

cgcgagggaa gccgacgggg accccatccg gttcgcgaac gacctcgatg tgcacaggaa 2160

tggatccgta ttcttcactg acacgagcat gagatacagc agaaagtgag caaagcgacg 2220

taacaatccg gcttctcatt ttcaaacgcc tctgtattct ctgctgaaag agtagctcac 2280

cagacaagag ctgaatttgc agggaccatc tgaacatcct gttagaagga gaaggcaccg 2340

ggaggctgct caggtatgat ccagaaacaa gcggtgtcca tgtcgtgctc aaggggctgg 2400

tgttcccaaa cggcgtgcag atctcagagg accatcagtt tcttctcttc tccgagacaa 2460

caaactgcag gtaacaaaaa tactatctga cgatgctcat gattctaccg tatccatagt 2520

catgaacaca aaccacacga atctggcctt gaccaggata atgaggtact ggctggaagg 2580

cccaagagcg ggcgaggtag aggtgttcgc gaacctgccg ggcttccccg acaacgtgcg 2640

ctccaacggc aggggccagt tctgggtggc gatcgactgc tgccggacgc cggcgcagga 2700

ggtgttcgcc aagaggccgt ggctccggac cctgtacttc aagttcccgc tgtcgctcaa 2760

ggtgctcact tggaaggccg ccaggaggat gcacacggtg ctcgcgctcc tcgacggcga 2820

agggcgcgtc gtggaggtgc tcgaggaccg gggccacgag gtgatgaagc tggtgagcga 2880

ggtgcgggag gtgggccgca agctgtggat cggaaccgtg gcgcacaacc acatcgccac 2940

catcccctac cctttagagg actaaccatg atctatgctg tttcaatgcc tcctaatctg 3000

tgtacgtcta taaatgtcta atgcagtcac tggttgtaat cttgtttgtg tttggcaaat 3060

tggcataata atggacagat tcaatgggca ttggtgctgt agtcgcatca cactaattga 3120

atgggatcat gttgagctct cactttgcta caatttgctc cagcttgtac ggttgtaccc 3180

tcttgctcgt ctatagtaag ggccatctaa aaaaaactca aattagatct gcaatacaag 3240

tatgattggg ccgaatttgg attgtcacgg gtccgcgacc gcgaattggg ctcggtttga 3300

tttagccgac atagtagtga ccgacccgag ccggcggcga gccaaaccga gcggacgccg 3360

ccatggatcg cgagtggggc tccaagcccg gcagcggcgg cgccgcctcc gcgcagaatg 3420

aggccatcga ccggcgggag cgcctccgcc gcctggccct cgagaccatc gacctcgcca 3480

aggaccccta tttcatgcgc aacc 3504

<210> 2

<211> 412

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Glu Lys Arg Asn Leu Gln Trp Arg Arg Gly Arg Asp Gly Ile Val

1 5 10 15

Gln Tyr Pro His Leu Phe Phe Ala Ala Leu Ala Leu Ala Leu Leu Val

20 25 30

Ala Asp Pro Phe Gly Leu Ser Pro Leu Ala Glu Val Asp Tyr Arg Pro

35 40 45

Val Lys His Glu Leu Ala Pro Tyr Gly Glu Val Met Gly Ser Trp Pro

50 55 60

Arg Asp Asn Ala Ser Arg Leu Arg Arg Gly Arg Leu Glu Phe Val Gly

65 70 75 80

Glu Val Phe Gly Pro Glu Ser Ile Glu Phe Asp Leu Gln Gly Arg Gly

85 90 95

Pro Tyr Ala Gly Leu Ala Asp Gly Arg Val Val Arg Trp Met Gly Glu

100 105 110

Glu Ala Gly Trp Glu Thr Phe Ala Val Met Asn Pro Asp Trp Ser Glu

115 120 125

Glu Val Cys Ala Asn Gly Val Asn Ser Thr Thr Arg Lys Gln His Glu

130 135 140

Lys Glu Glu Phe Cys Gly Arg Pro Leu Gly Leu Arg Phe His Gly Glu

145 150 155 160

Thr Gly Glu Leu Tyr Val Ala Asp Ala Tyr Tyr Gly Leu Met Val Val

165 170 175

Gly Gln Ser Gly Gly Val Ala Ser Ser Val Ala Arg Glu Ala Asp Gly

180 185 190

Asp Pro Ile Arg Phe Ala Asn Asp Leu Asp Val His Arg Asn Gly Ser

195 200 205

Val Phe Phe Thr Asp Thr Ser Met Arg Tyr Ser Arg Lys Asp His Leu

210 215 220

Asn Ile Leu Leu Glu Gly Glu Gly Thr Gly Arg Leu Leu Arg Tyr Asp

225 230 235 240

Pro Glu Thr Ser Gly Val His Val Val Leu Lys Gly Leu Val Phe Pro

245 250 255

Asn Gly Val Gln Ile Ser Glu Asp His Gln Phe Leu Leu Phe Ser Glu

260 265 270

Thr Thr Asn Cys Arg Ile Met Arg Tyr Trp Leu Glu Gly Pro Arg Ala

275 280 285

Gly Glu Val Glu Val Phe Ala Asn Leu Pro Gly Phe Pro Asp Asn Val

290 295 300

Arg Ser Asn Gly Arg Gly Gln Phe Trp Val Ala Ile Asp Cys Cys Arg

305 310 315 320

Thr Pro Ala Gln Glu Val Phe Ala Lys Arg Pro Trp Leu Arg Thr Leu

325 330 335

Tyr Phe Lys Phe Pro Leu Ser Leu Lys Val Leu Thr Trp Lys Ala Ala

340 345 350

Arg Arg Met His Thr Val Leu Ala Leu Leu Asp Gly Glu Gly Arg Val

355 360 365

Val Glu Val Leu Glu Asp Arg Gly His Glu Val Met Lys Leu Val Ser

370 375 380

Glu Val Arg Glu Val Gly Arg Lys Leu Trp Ile Gly Thr Val Ala His

385 390 395 400

Asn His Ile Ala Thr Ile Pro Tyr Pro Leu Glu Asp

405 410

<210> 3

<211> 21708

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtttacccgc caatatatcc tgtcaaacac tgatagttta attcccgatc tagtaacata 60

gatgacaccg cgcgcgataa tttatcctag tttgcgcgct atattttgtt ttctatcgcg 120

tattaaatgt ataattgcgg gactctaatc ataaaaaccc atctcataaa taacgtcatg 180

cattacatgt taattattac atgcttaacg taattcaaca gaaattatat gataatcatc 240

gcaagaccgg caacaggatt caatcttaag aaactttatt gccaaatgtt tgaacgatcg 300

gggaaattcg agctggtcac caagtttcgc ttcggcgtgc ttgctgctgc tgttgcagct 360

cgcaggagcg tcgcatgtcg tctacaacta caaggacctc gaagccgagg ctgctgcggc 420

gacggaccag gtgccgccgt ccatcgtcaa ccccctgctc aggacggggt accacttcca 480

gccccccaag aactggatca atgatcccaa cgcgcccatg tactacaagg ggtggtacca 540

tttcttctac caatacaatc ccaagggcgc cgtatggggc aacatcgtgt attggtccct 600

ctcccgtccc agagaaaccc tccctccctc ctccattgga ctgcttgctc cctgttgacc 660

attgggtatt ctgaaccatc gagccatggc tgccaagctg actcgcctcc acagtcttcg 720

cgaacgcctt ggtgccacct tctcctccca tcccaatgaa ctgatagcac tcttttccag 780

gtatgttcac cagggcaagg gaatgcttca ggagggtagc tggaccccga ctgccgagct 840

acctctgcga caggacccgg cggtggacga cgacctgccg caggtggtgg tccaggagaa 900

gcagcatggc ggcggtgctg ccgctcggac tgcgatggcg acggcgacgg cgacgcggga 960

cgggtcggtg ggttggagcg gcaagccgtg ccgcagagac aggtccgggg gatggttcgc 1020

cggcttcctc atgctcgcag tggtggatcg gtcgtgagga gttccttaac atttcttgcg 1080

acatggagta caaaaagagg gtggatgcgc tagtgttttt ctctttactt ctcctaggat 1140

actttgctgc tcatgcgcat gggaacggtc atgtcacgga tgatgtcaat gtttctgctc 1200

cagctgaaga aggaattttg cgagaaaaaa gagcacaatg cgctcaaggg tttcttccat 1260

gaatcctaac aattgattac gaggttaaat cattgtctaa gaaaagtgga ataaaaaggt 1320

caaaataata gtaaaatgtt tagttttgga taagttttgc ttaattaccc tctcatggaa 1380

gaaacccttg agcgcattgt gctctttttt ctcgcaaaat tccttcttca gctggagcag 1440

aaacattgac atcatccgtg acatgaccgt tcccatgcgc atgagcagca aagtatccta 1500

ggagaagtaa agagaaaaac actagcgcat ccaccctctt tttgtactcc atgtcgcaag 1560

aaatgttaag gaactcctca cgaccgatcc accactgcga gcatgaggaa gccggcgaac 1620

catcccccgg acctgtctct gcggcacggc ttgccgctcc aacccaccga cccgtcccgc 1680

gtcgccgtcg ccgtcgccat cgcagtccga gcggcagcac cgccgccatg ctgcttctcc 1740

tggaccacca cctgcggcag gtcgtcgtcc accgccgggt cctgtcgcag aggtagctcg 1800

gcagtcgggg tccagctacc ctcctgaagc attcccttgc cctggtgaac atacctggaa 1860

aagagtgcta tcagttcatt gggatgggag gagaaggtgg caccaaggcg ttcgcgaaga 1920

ctgtggaggc gagtcagctt ggcagccatg gctcgatggt tcagaatacc caatggtcaa 1980

cagggagcaa gcagtccaat ggaggaggga gggagggttt ctctgggacg ggagagggac 2040

caatacacga tgttgcccca tacggcgccc ttgggattgt attggtagaa gaaatggtac 2100

caccccttgt agtacatggg cgcgttggga tcattgatcc agttcttggg gggctggaag 2160

tggtaccccg tcctgagcag ggggttgacg atggacggcg gcacctggtc cgtcgccgca 2220

gcagcctcgg cttcgaggtc cttgtagttg tagacgacat gcgacgctcc tgcgagctgc 2280

aacagcagca gcaagcacgc cgaagcgaaa cttaagcttg ggggtgctat ttgtactgtg 2340

caggcgcagg ccggccggcc ggccggagcg ccggctgacc ggctgcttcg tcgtcccaca 2400

agggagatat accactacta ctaaaacata ctctctacca caaatctgtg gatctttttg 2460

acgaatatac aaaaatctgt gggttgactc tgaggtctgg agttataagc atatattgct 2520

atatctctgg attaaagttt ttttttgtac gaaggtcagt tgaccatttt agctacgtgt 2580

ctgtctatct agctatacta ttatagaaac aaacttgttg aaaactagct cttagctgcc 2640

atatcacatt ctctatctca cctcttattt caaaattcac tctctaaaca acataaatat 2700

tgctatctac agtgtaaaat agtgttttgc atagctatat atatgatctg ctgaacacaa 2760

ctttagtcgt atgaatctat atatatctac tccatcccaa cctgtctatt ccatatgtcg 2820

ccttaaatat atcctatcat ttctaaaata aatgcacatc gtctatcttt ctgaggagcc 2880

aaatctttta aagttcgatc aaatatataa aagtaattat tgttagatta agcattaaat 2940

gtgtcgacgt ttcgagaccg gggggtccct gggccgacga gtgagtgtcg ccgcgtgccc 3000

cagcccagat gggtcgagcg cgagggcgag cgcgaagggg ggagagcgag gcggccggag 3060

accggcgtga gagaggtggg aatcccgcgg ccttcatgtt cgtcccgcgc cccggtcggg 3120

tgcgcttgca gtagggggtt acaagcgtcc acgcgggaga gggagcgagc ggctccaggc 3180

gagcgcctgt ctcgtcctcg tccccgcgcg gccaaccctc tccaagaggg ccctggtcct 3240

tccttttata ggcgtaagga gaggatccag gtgtacaatg gggggtgtag cagagtgcta 3300

cgtgtctagc ggaggagagc tagcgcccta agtacatgcc gttgtggcag acggagagac 3360

tttggcaccc agctggtgtg atgtcgtggc cgtcggagga gcgatggagc ctggcggagg 3420

gacagctgtc ggagcggttg ggtccttgct gacgtcctct tgcttccgta agggggctga 3480

gagccgccgt cgttacagag tatgcggggc gccatcattg cctatctggc ggagctagcc 3540

agatgggacg ccggtcttgt tccctgcggc ccgagtcagc tcggggtagg gtgatgatgg 3600

cgcctcctgt tgacgtggct ggcctgcgcc ctaggttggg cgatgtggag gctcctccga 3660

agccgaggtc gagtctgtct tccgtggccg aggccgagtc cgagcccctg ggtcgggcga 3720

ggcggaggcc gtcggctgag gccagggcgg agtccgagcc ctgggtcggg cgaagcggag 3780

ttcgtcgtct tctggggctg agcccgagtc cgagccctgg gtcgggcgga gcggagttcg 3840

ccgtcttccg ggacttagcc cgagtccgag ccctgggtcg ggcggagcgg agttcgccgt 3900

cttccgggac ttagcccgag tccgagccct gggtcgggcg gagcggagtt cgccgtcttc 3960

cgggacttag cccgagtccg agccctgggt cgggcgaagc ggagcttcct atggtgcctt 4020

cggcagggcc tgactgcctg tcagtctcac tctgtcaagt ggcactgcag tcagagtggc 4080

gcaggcgacg ctgtccttct gtcaggccgg tcagtggagc ggcgaagtga cggcggtcac 4140

ttcggctctg ccggggggcg cgcgtcagga taaaggtgtc aggccacctt tgcattaaat 4200

gctcctgcga tttggtcggt cggtgcggtg atttagtcag ggttgcttct tagcgaaggc 4260

agggctcggg cgagccggaa atatgttcgc cgttggaggg gggcctcggg cgagacggaa 4320

atccttcggg gtcggctgcc cttgtccgag gctaggctcg ggcgaggcgt gatcgagtcg 4380

ctcgaacgga ctaatccctg acttaatcgc acccatcagg ccttagcagc tttatgctga 4440

tgggggttac cagctgagaa ttaggagtct tgagggtacc cctaattatg gtccccgaca 4500

gtagcccccg agcctcgaag ggagtgttag cactcgcttg gaggctttcg tcgcactttt 4560

ttgcaagggg accagccttt ctcggttgca ttttgttccg gtgggtgcgc gcgagcgcac 4620

ccgccgggtg tagcccccga ggcctcggag gagtggtttc actcctttga ggtcttaatg 4680

cctcgcgtaa tgcttcggct ggtctggttg ttctctcatg cgagcccggg ctagggttta 4740

gggcgggtta cctgccgagg tggttgcgca tgaaataggg gtccttggcg aggtcgatgg 4800

tctcgagggc caggcggcgg aggcgctccc gccggtcgat ggcctcattc tgcgcggagg 4860

cggcgccgcc gctgccgggc ttggagcccc actcgcgatc catggcggcg tccgctcggt 4920

ttggctcgcc gccggctcgg gtcggtcact actatgtcgg ctaaatcaaa ccgagcccaa 4980

ttcgcggtcg cggacccgtg acaatccaaa ttcggcccaa tcatacttgt attgcagatc 5040

taatttgagt tttttttaga tggcccttac tatagacgag caagagggta caaccgtaca 5100

agctggagca aattgtagca aagtgagagc tcaacatgat cccattcaat tagtgtgatg 5160

cgactacagc accaatgccc attgaatctg tccattatta tgccaatttg ccaaacacaa 5220

acaagattac aaccagtgac tgcattagac atttatagac gtacacagat taggaggcat 5280

tgaaacagca tagatcatgg ttagtcctct aaagggtagg ggatggtggc gatgtggttg 5340

tgcgccacgg ttccgatcca cagcttgcgg cccacctccc gcacctcgct caccagcttc 5400

atcacctcgt ggccccggtc ctcgagcacc tccacgacgc gcccttcgcc gtcgaggagc 5460

gcgagcaccg tgtgcatcct cctggcggcc ttccaagtga gcaccttgag cgacagcggg 5520

aacttgaagt acagggtccg gagccacggc ctcttggcga acacctcctg cgccggcgtc 5580

cggcagcagt cgatcgccac ccagaactgg cccctgccgt tggagcgcac gttgtcgggg 5640

aagcccggca ggttcgcgaa cacttctacc tcgcccgctc ttgggccttc cagccagtac 5700

ctcattatcc tggtcaaggc cagattcgtg tggtttgtgt tcatgactat ggatacggta 5760

gaatcatgag catcgtcaga tagtattttt gttacctgca gtttgttgtc tcggagaaga 5820

gaagaaactg atggtcctct gagatctgca cgccgtttgg gaacaccagc cccttgagca 5880

cgacatggac accgcttgtt tctggatcat acctgagcag cctcccggtg ccttctcctt 5940

ctaacaggat gttcagatgg tccctgcaaa ttcagctctt gtctggtgag ctactctttc 6000

agcagagaat acagaggcgt ttgaaaatga gaagccggat tgttacgtcg ctttgctcac 6060

tttctgctgt atctcatgct cgtgtcagtg aagaatacgg atccattcct gtgcacatcg 6120

aggtcgttcg cgaaccggat ggggtccccg tcggcttccc tcgcgacgga ggacgccacg 6180

ccgccgctct ggccaacgac catgagaccg tagtacgcgt cggcgacgta gagctcgccg 6240

gtctccccgt ggaacctcag gccgagcggc cggccgcaga actcctcctt ctcgtgctgc 6300

ttcctcgtcg ttgagttcac tccattggca cagacttctt ctgacctttg ccaagaaaca 6360

acaaattttg catgacgttt ctcccaagaa tgcaaaaaat cagatcaaaa tatcttagta 6420

ctactatatt atagcatgta acgagtggac gccggagcga tatcgagcac ttaccagtca 6480

ggattcatga cggcgaacgt ctcccacccg gcctcctcgc ccatccaccg cacgacgcgg 6540

ccgtcggcga ggccggcgta cggcccgcgg ccctggagat cgaactcgat agactccggc 6600

ccgaacacct cgccgacgaa ctccagcctc ccgcgcctga gccggctggc attgtctctg 6660

ggccagctgc ccatgacctc cccgtacggc gcgagctcgt gcttcaccgg ccggtagtcg 6720

acctcggcca gcggactgag gccgaacggg tccgcgacta ggagggccag cgccagggcc 6780

gcgaagaaga ggtgagggta ctgcacgatg ccatcacgcc ctcgccgcca ctgcaggttc 6840

ctcttctcca tgctggtgga cgaaaaagat cggcagagga gagagggaag ctagcgggag 6900

aacgctagct gttgtgatct ttaatggatt ggttcaggaa acatatgtgc gtgtttgcat 6960

ggaagttgca tgagtaagat ggattgtttg ggagtaggta tcctcttggt tcagaatagg 7020

caaggcttgg acgatggaac aagacgaacg gttgaacaag catgtagtat gccatgtgag 7080

atgacacgag agctgccgaa cctgacgtag gcacctatga gctatgatta cggtggctat 7140

cgttgccaaa ccgcacatct cagggacaat gacttaaaac tgatttcttc ctctctctct 7200

ccctttttac taatctagag aaatagctca gatttggttt cgctcgattt cagtttcggt 7260

ttaaataatt tatggggctg gccaaataat tatacacagt gattgtaatt tattgggaaa 7320

acattctagg gctagtctgg caactctatt tttctaagtg ttttctattt tataaagaga 7380

aaataaacta attttttttg aaaaaatcaa aattctttga aagaaacagg gttgccaaac 7440

tagctcttaa aaaaatcaga aagatttttg aacgagaatc tacgacatgc gtgctcttat 7500

ataaaaatga ctttatagtc attttataaa atcggaagaa aatcactcta ttgtaagaga 7560

agaaaatgta tataaaaaca ataacaaaat aacaagaatg aaaaagaaaa atctgaacgt 7620

catagcttac ctttcgatat aatttgtcgc tcttagatgt ttgtaaactg taacataatt 7680

tgtctctttc gaaatatgct tgttttttaa gaggatcgtg gttttaatag atgtttcttt 7740

aaacattaca tgatagcttt cgagtggatt agttactttg gttatttttt taaatcttgt 7800

tctgggtagt gccaatagtg gacactagac atggctggtc ctcgcatttc tgggccctaa 7860

gcgaaaatct atgctgaggc cctacacaaa agtataagtt tgttattttt ccaaaaatta 7920

aataatatct aaagaataat aatataggtg acgattgtgg gggacatata tcccctggat 7980

caccacgacc cgatacgtct cgtgggccat ccgaaaggcc cttgatgggt gtcccgaaag 8040

gtgtctgatg ggcctcggtc agatgggaac caccgacatc caagaaatgt gcaacgcgag 8100

gtgggagaag tggaacatgg agatcatgca cccgtggaag tttttttgta accccgattc 8160

agtcagtaat aaggcagaag aagggaccct aagaaaacgg atatagacac attgtactca 8220

tctttttcat agagacacca tggataaccc aaggagaact cagcatcaca ggcccgatct 8280

agtaacatag atgacaccgc gcgcgataat ttatcctagt ttgcgcgcta tattttgttt 8340

tctatcgcgt attaaatgta taattgcggg actctaatca taaaaaccca tctcataaat 8400

aacgtcatgc attacatgtt aattattaca tgcttaacgt aattcaacag aaattatatg 8460

ataatcatcg caagaccggc aacaggattc aatcttaaga aactttattg ccaaatgttt 8520

gaacgatcgg ggaaattcga gctggtcacc tgtaattcac acgtgtcacc gcttccctat 8580

agctttgcga agagcctcgc tgatcatcca gggcacgacg gcaccggagc cagcaaactg 8640

agctcgtatc ttaagcccca tgaagccatc tggcgctgaa gcctgaaccg agaggacgtc 8700

caaatggagg ctcttgatgg cgtcgaacac tcgcgtcatc aggagctcct cccaccggca 8760

ctgcacctcc aggagcacgt ccttgtccga gacggtgacg gtgacgttgc tggtgccggc 8820

gtccatggtg aggaccgggg ggcgctccac gtcgtctctg ccgagctctg ggctcttcct 8880

cttggagccc gcgcagacct ccttcctcac actctcatta ttgccacggg agggccttgt 8940

tattagcctt gtcgtcgttt cggatgggcg cgacgcaggt tccctactgg actccagctc 9000

ttgcaccctt ctctgaagct ccttgaggta ggctatcgtt tcggcgagga tcgacgcttt 9060

gttcaccctg tgaatggacg gaagcagtga cttgaggacg aggaacatct cgttgagctt 9120

ctctcgtcgc tttcgctccg acatgacgtg gttcttggtg ccagtgccac tcatttcctg 9180

tgctgctccc gtcgcgccgc cacagctctc ccaagcaccg ccgccggcca ccactttctt 9240

cagcaatctc tgcggctcct cgatggccgg cactactgct gcgggcgccg cgtcgtcgga 9300

gcacgacgac tgctgcgagg acctcgtcca agccatgaaa ctcgtcgcgc gagagccgta 9360

gacgggtgcc cttgaggcgt cggcggcgac gttagcggta gccctgtcca ccggaggcgg 9420

cgctggctgc ggggaagagc aggggacctc gaaattggac gcgtccacgg tccagccgtc 9480

ctctagcggt agtggtagcg cctgcaggtc catttcgtcg cagaggctgt agaactcctc 9540

gatctccttg gtgatgtgct ccaggcttgc gtcgtctgac agggcctcgg cttctcttag 9600

tcttagctcc tcctcctgcc cgtgtccccc ggcggcggtc atcgcctcta tgtcgtccat 9660

gccattattg tggtcgagtt cctcgaacgc aaacgtgccg tcgtctgctg cggcctcgcc 9720

ggtctcgttt gctcgtcctg acgggctgga gctcgggcac tgcggctccc agaaagccgc 9780

ggttgctcgg ctgaccaagt ccggggcctc cggcaccgtg tcagttgtac caagctcaag 9840

cacgccgccc ataaccggga tgcagaggat tgactgaatg gacgcgctct tggccaggag 9900

cgcgcggggg aaggctttgc tgccggcgag gtgcgcgttg cacagccaga catgctcgtc 9960

gctcgcgaaa ctcctgccgg gcaacccttg gcctggccgg aaggcgtagg tcatggagac 10020

cacgtagtac cactcggtgt cgccgaggtc ctccggcgac agagagccgg ccggccgcgc 10080

aggcgcagcg cggcggtcgc cctcgcccga caggagggcc tcgtagagct cccggagctg 10140

gtcgctcctc tgcatgacga gctggtcgga tgtcagctcc acggagttgg agatcttccg 10200

cgtcttcacc tcgccgttgt agaacccgtc cgtccacgtc agcacccctg gttgagtgtc 10260

tgaaatggac cagaagaggg cgtagctcca gttgatgctc ctggcggctg cagcaagctg 10320

gctcctcatc agctgcctct cagcaggtcg ttgcagcagt tcttccgcct gctgaactcg 10380

ggaagctgaa agcgccatct cgatccgctc acccacgaac ccgaaccccg gagaacctca 10440

cgaacccgaa cccgaaccgg agggggagga gaagccaacc cacctctaag aaagcacgga 10500

gagggaatgc gtcccccgca gcgtctttat agccgagcgc ggggccgccg cggccgtcct 10560

gatcccatcc gacggcgcgg acgcccagtg gaatatgcgg ggcatcgggg tcgccaccgc 10620

gctacgagca cacgagcacc tcccggggac ggctttgttg ggacccggag caggacggga 10680

gcgtgaggcg gggcccagcg tgactgacct gacctcgttt tggccgctgc actgccggcc 10740

tgtgcaggcc accgaaaaat atctcgcgtg gcgaaatgcc atccttgccc tcgggagcac 10800

acggatcgga cggcaagcgg tcgtcgggtc gggtggtgga tatggacact tgctgatgac 10860

gtgggtccac gatggcagtg ggcgaagcca agtccacgcg tcacagtgac cgcacctagt 10920

gctcaaaaac gacggatcgg ataggaacga atacatgtca caattcacta ccttgtaatc 10980

tgcccgatct agtaacatag atgacaccgc gcgcgataat ttatcctagt ttgcgcgcta 11040

tattttgttt tctatcgcgt attaaatgta taattgcggg actctaatca taaaaaccca 11100

tctcataaat aacgtcatgc attacatgtt aattattaca tgcttaacgt aattcaacag 11160

aaattatatg ataatcatcg caagaccggc aacaggattc aatcttaaga aactttattg 11220

ccaaatgttt gaacgatcgg ggaaattcga gctggtcacc tgtaattcac acgtgtcaca 11280

gcgcaaggtg ggcgagggcg ggtacggccc cgtgtacaag ggcttcctcg accacacgca 11340

ggtggccatc aaggtgctcc ggcccgacgc ggcgcagggc cggtcgcagt tccagcagga 11400

ggtggaggtg ctgagctgca tccggcaccc caacatggtg ctcctcctcg gcgcgtgccc 11460

ggagtacggc tgcctcgtgt acgagtacat ggccagcggc agcctggacg actgcctgtt 11520

ccaatcctaa caattgatta cgaggttaaa tcattgtcta agaaaagtgg aataaaaagg 11580

tcaaaataat agtaaaatgt ttagttttgg ataagttttg cttaattacc ctctggaaca 11640

ggcagtcgtc caggctgccg ctggccatgt actcgtacac gaggcagccg tactccgggc 11700

acgcgccgag gaggagcacc atgttggggt gccggatgca gctcagcacc tccacctcct 11760

gctggaactg cgaccggccc tgcgccgcgt cgggccggag caccttgatg gccacctgcg 11820

tgtggtcgag gaagcccttg tacacggggc cgtacccgcc ctcgcccacc ttgcgcttcg 11880

cagctcctgc tccaagattg acgtctctta ttaaagcacg ccattttagg gatgtggtgg 11940

ccgtttgggc cgtacgcgcc ggccaaaaat agagctgttt atcgggggct tcaacctcgt 12000

tcaacgggtg gccactggac aacggattca tgttcctgtg gaacacgttt ggttactcga 12060

ctttttattt acactttgga aacaaacagt caaacaccat cacaaaacta ccatggctca 12120

cgagcgcaca cgattgtaac ctatatactt attcgctaag gggtgtttga gagtgaagtt 12180

ttttcacagt tttggaagaa taaaatacta cggtattata tacagaattg tgtttggcaa 12240

gttggctaaa atctctgttt ttaaaactga agtattgcaa atactatagt tgttttaagt 12300

tattctaaac ttaggtctgg acctcagttt tcaaaattgt ggtattgtaa actgcagtat 12360

tgtcataact aaagtatact gtagtatttc aaaaactgtg gttttcaaaa actttgttcc 12420

caaacagggc ctaaatgggt aggcactaag cacagtacga cccgcgatgc tttgacacga 12480

cacggacacg atttatataa tgtcatacgg cacaggttta gtcacatctt tggaccacga 12540

cctccgcaca atggactgac atgaacacga cagtttagac cagatcccgt gacaatccgg 12600

cacaatccag tgccccatcc cctggtccac agccttcaca gctctggccc ggccttgcca 12660

tatcgtgcac gggggtgtgt ccagaatgta cctactggag cgcgctgcac gctggcgagc 12720

gatccactca ccgttgatcc caacaaactc cggtccccaa actccacagc accaacagct 12780

aagcccgatg cgctgcgtgc gcggcgatcc aaccgccggc tcacctaaaa atttcggcac 12840

gtctaactgc gactggcagg tgcgcacgcg tggtcgcgcg gaataaagcg gacacgttgc 12900

gcccccagcg aagcccgcac gcatcgcatt cgcatcgcat cgcaggtcgc atccgacgct 12960

agcggctagc ctagccgaac agcctgagcg cgcgaagatg gcgcccgccg acggcgagtc 13020

ctccccgccg ccgcacgtgg ccgtggtcgc cttcccgttc agctcccacg cggcggtgct 13080

gctctccatc gcgcgcgccc tggctgccgc cgcggcgccg tccggggcca cgctctcgtt 13140

cctctccacc gcgtcctccc tcgcgcagct ccgcaaggcc agcagcgcct ccgccgggca 13200

cgggctcccg gggaacctgc gcttcgtcga ggtaccggac ggcgcgcccg cggccgagga 13260

gaccgtgccg gtgccgcggc agatgcagct gttcatggag gccgcggagg ccggaggggt 13320

gaaggcctgg ctggaggcgg cccgcgccgc ggcgggcggc gccagggtga cctgcgtggt 13380

gggcgacgcg ttcgtgtggc ctgcggcgga cgcggccgcc tccgcggggg cgccgtgggt 13440

gccggtgtgg acggccgcgt cgtgcgcgct cctggcgcac gtccgcaccg acgcgctccg 13500

ggaggacgtc ggcgaccagg gtgcgttgga ttctactact acagtactac ttctctccct 13560

tccttgtccc ttcattgcga attcgtaatc atggtcatag ctgtttcctg tgtgaaattg 13620

ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg 13680

tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 13740

gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 13800

gcgtattggc tagagcagct tgccaacatg gtggagcacg acactctcgt ctactccaag 13860

aatatcaaag atacagtctc agaagaccaa agggctattg agacttttca acaaagggta 13920

atatcgggaa acctcctcgg attccattgc ccagctatct gtcacttcat caaaaggaca 13980

gtagaaaagg aaggtggcac ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt 14040

caagatgcct ctgccgacag tggtcccaaa gatggacccc cacccacgag gagcatcgtg 14100

gaaaaagaag acgttccaac cacgtcttca aagcaagtgg attgatgtga taacatggtg 14160

gagcacgaca ctctcgtcta ctccaagaat atcaaagata cagtctcaga agaccaaagg 14220

gctattgaga cttttcaaca aagggtaata tcgggaaacc tcctcggatt ccattgccca 14280

gctatctgtc acttcatcaa aaggacagta gaaaaggaag gtggcaccta caaatgccat 14340

cattgcgata aaggaaaggc tatcgttcaa gatgcctctg ccgacagtgg tcccaaagat 14400

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 14460

caagtggatt gatgtgatat ctccactgac gtaagggatg acgcacaatc ccactatcct 14520

tcgcaagacc ttcctctata taaggaagtt catttcattt ggagaggaca cgctgaaatc 14580

accagtctct ctctacaaat ctatctctct cgagtctacc atgagcccag aacgacgccc 14640

ggccgacatc cgccgtgcca ccgaggcgga catgccggcg gtctgcacca tcgtcaacca 14700

ctacatcgag acaagcacgg tcaacttccg taccgagccg caggaaccgc aggagtggac 14760

ggacgacctc gtccgtctgc gggagcgcta tccctggctc gtcgccgagg tggacggcga 14820

ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc aacgcctacg actggacggc 14880

cgagtcgacc gtgtacgtct ccccccgcca ccagcggacg ggactgggct ccacgctcta 14940

cacccacctg ctgaagtccc tggaggcaca gggcttcaag agcgtggtcg ctgtcatcgg 15000

gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc ggatatgccc cccgcggcat 15060

gctgcgggcg gccggcttca agcacgggaa ctggcatgac gtgggtttct ggcagctgga 15120

cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc accgagattt gactcgagtt 15180

tctccataat aatgtgtgag tagttcccag ataagggaat tagggttcct atagggtttc 15240

gctcatgtgt tgagcatata agaaaccctt agtatgtatt tgtatttgta aaatacttct 15300

atcaataaaa tttctaattc ctaaaaccaa aatccagtac taaaatccag atcccccgaa 15360

ttaattcggc gttaattcag tacattaaaa acgtccgcaa tgtgttatta agttgtctaa 15420

gcgtcaattt gtttacacca caatatatcc tgccaccagc cagccaacag ctccccgacc 15480

ggcagctcgg cacaaaatca ccactcgata caggcagccc atcagtccgg gacggcgtca 15540

gcgggagagc cgttgtaagg cggcagactt tgctcatgtt accgatgcta ttcggaagaa 15600

cggcaactaa gctgccgggt ttgaaacacg gatgatctcg cggagggtag catgttgatt 15660

gtaacgatga cagagcgttg ctgcctgtga tcaccgcggt ttcaaaatcg gctccgtcga 15720

tactatgtta tacgccaact ttgaaaacaa ctttgaaaaa gctgttttct ggtatttaag 15780

gttttagaat gcaaggaaca gtgaattgga gttcgtcttg ttataattag cttcttgggg 15840

tatctttaaa tactgtagaa aagaggaagg aaataataaa tggctaaaat gagaatatca 15900

ccggaattga aaaaactgat cgaaaaatac cgctgcgtaa aagatacgga aggaatgtct 15960

cctgctaagg tatataagct ggtgggagaa aatgaaaacc tatatttaaa aatgacggac 16020

agccggtata aagggaccac ctatgatgtg gaacgggaaa aggacatgat gctatggctg 16080

gaaggaaagc tgcctgttcc aaaggtcctg cactttgaac ggcatgatgg ctggagcaat 16140

ctgctcatga gtgaggccga tggcgtcctt tgctcggaag agtatgaaga tgaacaaagc 16200

cctgaaaaga ttatcgagct gtatgcggag tgcatcaggc tctttcactc catcgacata 16260

tcggattgtc cctatacgaa tagcttagac agccgcttag ccgaattgga ttacttactg 16320

aataacgatc tggccgatgt ggattgcgaa aactgggaag aagacactcc atttaaagat 16380

ccgcgcgagc tgtatgattt tttaaagacg gaaaagcccg aagaggaact tgtcttttcc 16440

cacggcgacc tgggagacag caacatcttt gtgaaagatg gcaaagtaag tggctttatt 16500

gatcttggga gaagcggcag ggcggacaag tggtatgaca ttgccttctg cgtccggtcg 16560

atcagggagg atatcgggga agaacagtat gtcgagctat tttttgactt actggggatc 16620

aagcctgatt gggagaaaat aaaatattat attttactgg atgaattgtt ttagtaccta 16680

gaatgcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 16740

gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 16800

acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 16860

tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag 16920

ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 16980

atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 17040

agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 17100

cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 17160

agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 17220

acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 17280

gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 17340

ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 17400

gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt 17460

gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag 17520

gaagcggaag agcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac 17580

cgcatatggt gcactctcag tacaatctgc tctgatgccg catagttaag ccagtataca 17640

ctccgctatc gctacgtgac tgggtcatgg ctgcgccccg acacccgcca acacccgctg 17700

acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct 17760

ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg aggcagggtg 17820

ccttgatgtg ggcgccggcg gtcgagtggc gacggcgcgg cttgtccgcg ccctggtaga 17880

ttgcctggcc gtaggccagc catttttgag cggccagcgg ccgcgatagg ccgacgcgaa 17940

gcggcggggc gtagggagcg cagcgaccga agggtaggcg ctttttgcag ctcttcggct 18000

gtgcgctggc cagacagtta tgcacaggcc aggcgggttt taagagtttt aataagtttt 18060

aaagagtttt aggcggaaaa atcgcctttt ttctctttta tatcagtcac ttacatgtgt 18120

gaccggttcc caatgtacgg ctttgggttc ccaatgtacg ggttccggtt cccaatgtac 18180

ggctttgggt tcccaatgta cgtgctatcc acaggaaaga gaccttttcg acctttttcc 18240

cctgctaggg caatttgccc tagcatctgc tccgtacatt aggaaccggc ggatgcttcg 18300

ccctcgatca ggttgcggta gcgcatgact aggatcgggc cagcctgccc cgcctcctcc 18360

ttcaaatcgt actccggcag gtcatttgac ccgatcagct tgcgcacggt gaaacagaac 18420

ttcttgaact ctccggcgct gccactgcgt tcgtagatcg tcttgaacaa ccatctggct 18480

tctgccttgc ctgcggcgcg gcgtgccagg cggtagagaa aacggccgat gccgggatcg 18540

atcaaaaagt aatcggggtg aaccgtcagc acgtccgggt tcttgccttc tgtgatctcg 18600

cggtacatcc aatcagctag ctcgatctcg atgtactccg gccgcccggt ttcgctcttt 18660

acgatcttgt agcggctaat caaggcttca ccctcggata ccgtcaccag gcggccgttc 18720

ttggccttct tcgtacgctg catggcaacg tgcgtggtgt ttaaccgaat gcaggtttct 18780

accaggtcgt ctttctgctt tccgccatcg gctcgccggc agaacttgag tacgtccgca 18840

acgtgtggac ggaacacgcg gccgggcttg tctcccttcc cttcccggta tcggttcatg 18900

gattcggtta gatgggaaac cgccatcagt accaggtcgt aatcccacac actggccatg 18960

ccggccggcc ctgcggaaac ctctacgtgc ccgtctggaa gctcgtagcg gatcacctcg 19020

ccagctcgtc ggtcacgctt cgacagacgg aaaacggcca cgtccatgat gctgcgacta 19080

tcgcgggtgc ccacgtcata gagcatcgga acgaaaaaat ctggttgctc gtcgcccttg 19140

ggcggcttcc taatcgacgg cgcaccggct gccggcggtt gccgggattc tttgcggatt 19200

cgatcagcgg ccgcttgcca cgattcaccg gggcgtgctt ctgcctcgat gcgttgccgc 19260

tgggcggcct gcgcggcctt caacttctcc accaggtcat cacccagcgc cgcgccgatt 19320

tgtaccgggc cggatggttt gcgaccgtca cgccgattcc tcgggcttgg gggttccagt 19380

gccattgcag ggccggcaga caacccagcc gcttacgcct ggccaaccgc ccgttcctcc 19440

acacatgggg cattccacgg cgtcggtgcc tggttgttct tgattttcca tgccgcctcc 19500

tttagccgct aaaattcatc tactcattta ttcatttgct catttactct ggtagctgcg 19560

cgatgtattc agatagcagc tcggtaatgg tcttgccttg gcgtaccgcg tacatcttca 19620

gcttggtgtg atcctccgcc ggcaactgaa agttgacccg cttcatggct ggcgtgtctg 19680

ccaggctggc caacgttgca gccttgctgc tgcgtgcgct cggacggccg gcacttagcg 19740

tgtttgtgct tttgctcatt ttctctttac ctcattaact caaatgagtt ttgatttaat 19800

ttcagcggcc agcgcctgga cctcgcgggc agcgtcgccc tcgggttctg attcaagaac 19860

ggttgtgccg gcggcggcag tgcctgggta gctcacgcgc tgcgtgatac gggactcaag 19920

aatgggcagc tcgtacccgg ccagcgcctc ggcaacctca ccgccgatgc gcgtgccttt 19980

gatcgcccgc gacacgacaa aggccgcttg tagccttcca tccgtgacct caatgcgctg 20040

cttaaccagc tccaccaggt cggcggtggc ccatatgtcg taagggcttg gctgcaccgg 20100

aatcagcacg aagtcggctg ccttgatcgc ggacacagcc aagtccgccg cctggggcgc 20160

tccgtcgatc actacgaagt cgcgccggcc gatggccttc acgtcgcggt caatcgtcgg 20220

gcggtcgatg ccgacaacgg ttagcggttg atcttcccgc acggccgccc aatcgcgggc 20280

actgccctgg ggatcggaat cgactaacag aacatcggcc ccggcgagtt gcagggcgcg 20340

ggctagatgg gttgcgatgg tcgtcttgcc tgacccgcct ttctggttaa gtacagcgat 20400

aaccttcatg cgttcccctt gcgtatttgt ttatttactc atcgcatcat atacgcagcg 20460

accgcatgac gcaagctgtt ttactcaaat acacatcacc tttttagacg gcggcgctcg 20520

gtttcttcag cggccaagct ggccggccag gccgccagct tggcatcaga caaaccggcc 20580

aggatttcat gcagccgcac ggttgagacg tgcgcgggcg gctcgaacac gtacccggcc 20640

gcgatcatct ccgcctcgat ctcttcggta atgaaaaacg gttcgtcctg gccgtcctgg 20700

tgcggtttca tgcttgttcc tcttggcgtt cattctcggc ggccgccagg gcgtcggcct 20760

cggtcaatgc gtcctcacgg aaggcaccgc gccgcctggc ctcggtgggc gtcacttcct 20820

cgctgcgctc aagtgcgcgg tacagggtcg agcgatgcac gccaagcagt gcagccgcct 20880

ctttcacggt gcggccttcc tggtcgatca gctcgcgggc gtgcgcgatc tgtgccgggg 20940

tgagggtagg gcgggggcca aacttcacgc ctcgggcctt ggcggcctcg cgcccgctcc 21000

gggtgcggtc gatgattagg gaacgctcga actcggcaat gccggcgaac acggtcaaca 21060

ccatgcggcc ggccggcgtg gtggtgtcgg cccacggctc tgccaggcta cgcaggcccg 21120

cgccggcctc ctggatgcgc tcggcaatgt ccagtaggtc gcgggtgctg cgggccaggc 21180

ggtctagcct ggtcactgtc acaacgtcgc cagggcgtag gtggtcaagc atcctggcca 21240

gctccgggcg gtcgcgcctg gtgccggtga tcttctcgga aaacagcttg gtgcagccgg 21300

ccgcgtgcag ttcggcccgt tggttggtca agtcctggtc gtcggtgctg acgcgggcat 21360

agcccagcag gccagcggcg gcgctcttgt tcatggcgta atgtctccgg ttctagtcgc 21420

aagtattcta ctttatgcga ctaaaacacg cgacaagaaa acgccaggaa aagggcaggg 21480

cggcagcctg tcgcgtaact taggacttgt gcgacatgtc gttttcagaa gacggctgca 21540

ctgaacgtca gaagccgact gcactatagc agcggagggg ttggatcaaa gtactttgat 21600

cccgagggga accctgtggt tggcatgcac atacaaatgg acgaacggat aaaccttttc 21660

acgccctttt aaatatccgt tattctaata aacgctcttt tctcttag 21708

Claims (5)

1. A method of maintaining homozygous recessive conditions in a male sterile maize plant, said method comprising:

(a) Providing a first plant comprising a homozygous recessive allele that renders the plant male sterile;

(b) Providing a second plant comprising the same homozygous recessive allele that renders the plant male sterile as said first plant and containing a construct present in said second plant in heterozygous state, said construct comprising:

i. a first nucleotide sequence that when expressed in said first plant will restore said first plant male fertility;

a second nucleotide sequence which, when present in a heterozygous state, affects pollen fertilisation competitiveness;

the first nucleotide sequence is in close linkage with the second nucleotide sequence, both nucleotide sequences being present in a second plant;

the second nucleotide sequence comprises an interfering fragment of a particular gene; the specific gene is a gene capable of regulating and controlling the pollen fertilization competitiveness; the reduction of the expression level of the specific gene can reduce the pollen fertilization competitiveness, but does not influence the pollen fertility;

the second nucleotide sequence comprises interfering fragments of the STK1 and STK2 genes;

the reverse complementary sequence of the interference fragment is shown as 11282-11875 bits from the 5' end in the sequence 3 of the sequence table;

(c) Fertilizing the male gamete of the second plant with the female gamete of the first plant to produce progeny that maintain the homozygous recessive condition of the first plant.

2. The method of claim 1, wherein: the method is a method for expanding propagation of a plant male sterile line.

3. The method according to claim 1 or 2, characterized in that: the first plant is a corn male sterile mutant ms45;

and/or, the first nucleotide sequence comprises a gene that controls male fertility.

4. The method of claim 3, wherein:

the gene for controlling male fertility is an Ms45 gene expression element, and the Ms45 gene expression element expresses protein Ms45 in the first plant;

the protein Ms45 is a protein consisting of amino acid residues shown in a sequence 2.

5. Use of the method of claim 1 for producing a hybrid.

Images