CN104611364A - Transgenic element and application thereof, method for differentiating male sterility line and fertile maintainer line, and expanding propagation method of male sterile line of maize - Google Patents

Abstract

The invention relates to the technical field of agriculture and in particular relates to a transgenic element and an application thereof, a method for differentiating a male sterility line and a fertile maintainer line, and an expanding propagation method of the male sterile line of maize. A functional nucleotide sequence controlling the male fertility of the maize and a nucleotide sequence controlling starch synthesis are transferred into the maize together, and then backcross transformation is performed to obtain a hybrid maintainer line. As the nucleotide sequence controlling starch synthesis in the maintainer line inhibits the starch synthesis and increase the sugar content to lead to kernel shrinking, the sterility line and the maintainer line can be doubly differentiated from quality and appearance, and the accuracy is improved. The male sterility line and the fertile maintainer line of the hybrid female parent of the maize can be differentiated accurately and efficiently by use of the method, and then the male sterility line of the hybrid female parent can be applied to expanding propagation and applied to the production of hybrid seeds. Meanwhile, the difference in quality and appearance is more prone to mechanical identification, and therefore, the working efficiency can be greatly improved.

Description

Transgenic element and application, differentiation male sterile line and the method for maintenance line can be educated, expand the method for numerous male sterile line of maize

Technical field

The present invention relates to agricultural technology field, particularly a kind of transgenic element and application, the maternal male sterile line of differentiation corn hybrid seed and the method for maintenance line, a kind of method expanding the maternal male sterile line of numerous corn hybrid seed.

Background technology

Corn is the food crop that whole world ultimate production is the highest, and China is the second largest Maize Production state being only second to the U.S., and 2012, China's corn yield exceeded paddy rice, becomes the first food crop of China.Corn or important grain ration, feed grain, industrial raw material and energy source raw material, have very important status in national product.

Corn planting is mainly based on cross-fertilize seed, and the cross-fertilize seed heredity dominant beneficial gene of parents, the adaptives capacity to environment such as it is disease-resistant, pest-resistant, drought-resistant obviously increase, the corresponding raising of yield and quality.Along with the increase year by year of maize sown area, the demand of corn hybrid seed also increases gradually.But the production of hybrid seeds process of cross-fertilize seed is but a very heavy work at present, it needs maternal emasculation, gives maternal spontaneous pollination, once emasculation is not thorough, will affect the quality of cross-fertilize seed with the pollen of male parent.

At present, the emasculation of cross-fertilize seed female parent has mainly manually come.In isolated area, male parent and maternal interval are planted, and before loose powder, the tassel of female parent are manually pulled out, give maternal spontaneous pollination with the pollen of male parent, the seed of knot just on produce F used ₁for cross-fertilize seed.

In actual production process, owing to being subject to the impact of environment, the female parent after emasculation may regenerate tassel, or artificial emasculation is not thorough, capital causes the seed mixing maternal self-mating system in cross-fertilize seed, has influence on the purity of cross-fertilize seed, causes the massive losses in production.

When production of hybrid seeds amount is comparatively large, manual operations can not meet demand, also mechanical emasculation can be adopted.Machinery emasculation speed is fast, and cost is low, but the injury caused plant is large, and equally with manual detasseling there is the halfway defect of emasculation.Therefore, find new technology, both can reduce production cost, the object of thorough emasculation can be reached again, produce the corn hybrid seed of low-cost and high-quality, become the target that current breeding industry is urgently pursued.

Research shows, is controlled the fertility of corn by scientific and effective method, thus the object reaching breeding high efficiency seed is feasible.The realization being utilized as this target of male sterile line of maize provides guarantee.The introducing of cytoplasmic male sterile line can avoid emasculation process heavy in production of hybrid seeds process, reduces seed produces cost, ensures the purity of seed.Due to the impact of cytoplasmic factor, cytoplasmic male sterile line is male sterile, and it can utilize the pollen of restorer complete pollinating process and produce F ₁for cross-fertilize seed.But some cytoplasmic male sterile line is easily susceptible, this factor limits the widespread use of cytoplasmic male sterile line in corn hybrid seed production process.

US Patent No. 4654465 and US4727219 disclose the Sterility of inheritance of another kind of type, but multiple gene simultaneous mutations of different loci could be formed in this Sterility of inheritance sexual needs genome, and per in generation, also follows the trail of these genes with a large amount of molecule markers, and its complicacy limits the widespread use in corn seed producing process.Patterson proposes chromosome shift system, but operates also more complicated (see US Patent No. 3861709 and US3710511).In recent years, scientific research personnel attempts to optimize male sterility breeding system always.

A kind of more perfect male sterility system is described in US Patent No. 5478369, the key gene of the first reticent participation regulation and control male fertility ability of this system, import this gene and the inducible promoter starting this genetic expression simultaneously, thus reach the object of artificial adjustment plant male fertility ability.Such plant is that composing type is sterile under normal circumstances, only have when promotor be induced, plant just has Fertility after the male fertility genetic expression that regulates and controls.

In some cases, when controlling male sterile nuclear gene homozygous recessive, plant can show male sterile.But; male sterile plants self cannot raise up seed; only have by hybridize with heterozygous plant or could be solid after normal gene being imported sterile strain by genetically modified mode, but the seed obtained cannot be distinguished and isozygotys sterile or heterozygous state, directly utilizes so be not easy to us.This problem can be solved by the pollen not containing Restore gene, namely provides a maintenance line, and the pollen that it produces is not containing Restore gene, and when pollinating to sterile line with its pollen, the offspring produced still is homozygous recessive sterile line.A kind of method is just described in the United States Patent (USP) (US6743968) of the people such as Dellaporta, the pollen lethal gene that dominant Restore gene, pollen specific promoter start is structured on a carrier by the method, then male sterile plants is proceeded to together by transgenic technology, transgenic progeny recovers fertility, but produce pollen in only have not containing Restore gene have activity, so when it gives the pollination of homozygous recessive male sterile plants, their offspring is homozygous recessive sterile plant.

Increasingly mature along with corn gene technology and Protocols in Molecular Biology, artificial establishment has the male sterile line of morphological markers and maintenance line becomes possibility.Fertility restorer gene is imported corn with the RNA interference fragment controlling seed size gene by China Agricultural University (CN102960234A) together with transgenic technology, then male sterile line (the male-sterile mutation gene containing recessiveness is isozygotied) and the maintenance line (not only containing the recessive male sterility gene isozygotied but also the conversion elements comprising fertility restorer gene and control seed size gene RNA interference fragment containing heterozygosis) of same material is constructed respectively by backcross transformation, the method distinguishes sterile line and maintenance line by Seed shape, wherein the normal seed of shape is sterile line (not containing transgenic sequence), the seed of shape anomaly (seed diminishes) is maintenance line.But different along with corn seeding season and growing environment, also can produce the difference of Seed shape and size, be unfavorable for that large batch of mechanize is distinguished, and the accuracy also corresponding decline distinguished.Therefore, utilize this proterties to be marked in production application as seed to have some limitations.

Therefore, a kind of method utilizing transgenic element to expand the maternal male sterile line of numerous corn hybrid seed is provided to have important practical significance.

Summary of the invention

In view of this, the invention provides a kind of transgenic element and application, the maternal male sterile line of differentiation corn hybrid seed and the method for maintenance line, a kind of method expanding the maternal male sterile line of numerous corn hybrid seed.The method utilizes genic male sterile gene, the RNA interference fragment controlling grain endosperm Starch synthesis key gene, Molecular Marker Assisted Selection Technology and transgenic technology to produce for expanding the maternal male sterile line of numerous corn hybrid seed and being applied to cross-fertilize seed.

In order to realize foregoing invention object, the invention provides following technical scheme:

The invention provides a kind of transgenic element, comprising:

(I) first expression cassette, described first expression cassette contains the dominant allele of corn male sterility gene and the promotor of described dominant allele;

(II) second expression cassette, described second expression cassette contains the promotor of saccharoid gene, the forward RNAi fragment of described saccharoid gene, the reverse RNAi fragment of described saccharoid gene.

In specific embodiments more of the present invention, the dominant allele of the gene of corn male sterility described in transgenic element:

I () has the nucleotide sequence as shown in SEQ ID NO:1;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:1;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:1 obtains through lacking, replacing or add one or more Nucleotide.

In specific embodiments more of the present invention, the promotor of the dominant allele of the gene of corn male sterility described in transgenic element:

I () has the nucleotide sequence as shown in SEQ ID NO:2;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:2;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:2 obtains through lacking, replacing or add one or more Nucleotide.

In specific embodiments more of the present invention, the gene of saccharoid described in transgenic element is Bt2.

In specific embodiments more of the present invention, the promotor of the gene of saccharoid described in transgenic element:

I () has the nucleotide sequence as shown in SEQ ID NO:5;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:5;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:5 obtains through lacking, replacing or add one or more Nucleotide.

In specific embodiments more of the present invention, the forward RNAi fragment of the gene of saccharoid described in transgenic element:

I () has the nucleotide sequence as shown in SEQ ID NO:3;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:3;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:3 obtains through lacking, replacing or add one or more Nucleotide.

In specific embodiments more of the present invention, the reverse RNAi fragment of the gene of saccharoid described in transgenic element:

I () has the nucleotide sequence as shown in SEQ ID NO:4;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:4;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:4 obtains through lacking, replacing or add one or more Nucleotide.

In specific embodiments more of the present invention, the second expression cassette described in transgenic element also comprises the intron of described saccharoid gene.

Present invention also offers the application of above-mentioned transgenic element in maize hybrid seed production.

In specific embodiments more of the present invention, the application of above-mentioned transgenic element in maize hybrid seed production comprises distinguishes the maternal male sterile line of corn hybrid seed and maintenance line, the maternal homozygous recessive male sterile line of the numerous corn hybrid seed of expansion.

Present invention also offers a kind of method distinguishing the maternal male sterile line of corn hybrid seed and maintenance line, comprise the steps:

Step a, obtain the first milpa as male parent;

Described first milpa contains the homozygous recessive alleles ms8ms8 of a pair corn male sterility;

Step b, obtain the second milpa as female parent;

Described second milpa contains the homozygous recessive alleles ms8ms8 of corn male sterility and above-mentioned transgenic element;

In specific embodiments more of the present invention, the genotype of described second milpa is Ms8ms8ms8Bt2-RNAi.

Step c, get described first milpa and described second milpa hybridizes, after obtaining F1 generation, backcross with described first milpa many generations, distinguish sterile line and maintenance line by seed shrinkage proterties;

Seed shrinkage be maintenance line, full seed be sterile line.

Present invention also offers a kind of method expanding the maternal male sterile line of numerous corn hybrid seed, comprise the steps:

Step a, obtain the first milpa as male parent;

Described first milpa contains the homozygous recessive alleles ms8ms8 of a pair corn male sterility;

Step b, obtain the second milpa as female parent;

Described second milpa contains the homozygous recessive alleles ms8ms8 of corn male sterility and above-mentioned transgenic element;

In specific embodiments more of the present invention, the genotype of described second milpa is Ms8ms8ms8Bt2-RNAi.

Step c, get described first milpa and described second milpa hybridizes, after obtaining F1 generation, backcross with described first milpa many generations, distinguish male sterile line by seed shrinkage proterties and can maintenance line be educated; Seed shrinkage for maintenance line can be educated, full seed be male sterile line;

Steps d, get and can educate maintenance line described in step c and described male sterile line is hybridized, obtain the maternal male sterile line of cross-fertilize seed of full seed and the educated maintenance line of seed shrinkage;

The maternal male sterile line of cross-fertilize seed of described full seed and its paternal hybrid carry out the production of hybrid seeds of corn hybrid seed;

Educated maintenance line and the described male sterile line of described seed shrinkage are hybridized, and obtain male sterile line and can educate maintenance line.

In specific embodiments more of the present invention, in many generations, backcross and were at least for 5 generations and backcross.

The present invention utilizes the key gene of the control corn male fertility ability be cloned into, as Ms8, Ms22, Ms26, Ms32, Ms45 etc., and participate in the RNA interference fragment of grain endosperm Starch synthesis key gene, as Sh2, Bt1, the interference fragment of Bt2 gene, to be structured on same plant expression vector and maize transformation, then backcross with the male sterile line of the maternal background of corn hybrid seed and transfer-gen plant many generations, transformation site is imported in the homozygous recessive male sterile line of maternal background, namely maintenance line is obtained, because maintenance line contains dominant fertility restorer gene (as Ms8), so fertility restorer.Simultaneously; due to the RNAi fragment (the RNA interference fragment as Bt2 gene) also containing Starch synthesis key gene in grain endosperm; Starch synthesis can not normally carry out; when after ripe seed drying; due to starch decreased, sugar increases, and seed there will be serious shrinkage; when kernel weight after shrinkage only has full about 1/3, and volume significantly reduces.

When utilizing this transgenic element to carry out maize hybrid seed production, first using cross-fertilize seed female parent and homozygous recessive malesterile mutants (as ms8ms8) to hybridize also binding molecule marker assisted selection carries out many for backcrossing selfing again, the mutator gene (ms8) controlling fertility is imported in maternal self-mating system background, so just obtains the homozygous recessive male sterile line of cross-fertilize seed female parent.Then, homozygous recessive male sterile line (ms8ms8) with cross-fertilize seed female parent and the heterozygosis transformant (Ms8ms8ms8) containing conversion elements are hybridized and many generations backcross, and obtain the maintenance line (Ms8ms8ms8) of the Ms8 site heterozygosis of the maternal background of cross-fertilize seed.When sterile line and maintenance line are hybridized, the normal maternal homozygous recessive male sterile line of seed can be obtained on the one hand, cross-fertilize seed can be produced with paternal hybrid, obtain the educated maintenance line (Ms8ms8ms8) of the Ms8 transformation site heterozygosis of seed shrinkage simultaneously, be used for breeding sterile line of future generation and maintenance line.

The present invention discloses a kind of novel method expanding the maternal male sterile line of numerous corn hybrid seed, utilize the method not only can the homozygous recessive male sterile line of fast-propagation corn hybrid seed female parent, and by means of the sugar difference of seed and shr, utilize naked eyes or instrument to distinguish more accurately and efficiently sterile line and maintenance line.Because shrinkage seed and plump seed have substantial difference in appearance, just can be identified fast by naked eyes; Simultaneously, due to about 1/3 when weight after corn kernel shrinkage only has full, and volume significantly reduces, therefore, particle diameter can be utilized further to sieve the equipment such as kind of machine, gravity sieve kind machine, air sifting kind machine and to carry out mechanize seed selection at a high speed, thus greatly increase work efficiency; Moreover, because in sterile line seed and maintenance line seed, the ratio of starch, sucrose exists significant difference, can distinguish more accurately by means of instrument, and seed shrinkage proterties can not be subject to the impact of corn seeding season and growing environment, therefore in production, there is better using value, significantly save the breeding cost of cross-fertilize seed, improve purity of hybrid.

Accompanying drawing explanation

In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, be briefly described to the accompanying drawing used required in embodiment or description of the prior art below.

Fig. 1 shows the tassel phenotype of corn homozygous recessive malesterile mutants ms8 and normal self-mating system;

Fig. 2 shows shrinkage seed (bt2bt2) and normal seed (Bt2bt2 and Bt2Bt2) phenotype after super-sweet corn bt2 heterozygote (Bt2bt2) selfing;

Seed phenotype after Fig. 3 shows conversion male fertility ability Restore gene Ms8 expression cassette and regulates and controls the plant selfing of endosperm starch synthesis key gene Bt2 interference fragment expression cassette;

Fig. 4 shows amplification Ms8 promoter gene fragment electrophoresis detection figure;

Fig. 5 shows amplification Ms8cDNA fragment electrophoretic detection figure;

Fig. 6 shows amplification Bt2 promoter gene fragment electrophoresis detection figure;

Fig. 7 shows amplification Bt2RNAi fragment electrophoretic detection figure;

Fig. 8 shows PBI221 carrier schematic diagram;

Fig. 9 shows pJawoh18-RNAi carrier schematic diagram;

Figure 10 shows the pCAMBIA3301 plant expression vector schematic diagram containing male fertility ability gene M s8 expression cassette and regulation and control endosperm starch synthesis key gene Bt2 interference fragment expression cassette;

Figure 11 shows and utilizes nucleus homozygous recessive male sterility gene (ms8ms8), controls endosperm starch synthesis key gene (Bt2) and Molecular Marker Assisted Selection Technology and transgenic technology and carries out the maternal male sterile line of corn hybrid seed and expand numerous Technology Roadmap.

Embodiment

The invention discloses a kind of transgenic element and application, the maternal male sterile line of differentiation corn hybrid seed and the method for maintenance line, a kind of method expanding the maternal male sterile line of numerous corn hybrid seed, those skilled in the art can use for reference present disclosure, and suitable improving technique parameter realizes.Special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, they are all deemed to be included in the present invention.Method of the present invention and application are described by preferred embodiment, related personnel obviously can not depart from content of the present invention, spirit and scope methods and applications as herein described are changed or suitably change with combination, realize and apply the technology of the present invention.

The present invention's all technology used all have usual the understood identical implication of one skilled in the art of the present invention with scientific terminology, unless specifically indicated, technology that is used in the present invention or that mention is those of ordinary skill in the art's the recognized standard technology, material, method and example are only set forth, and are not limited.

Nuclear male sterility is that the gene playing key regulatory effect in Microsporogenesis process is undergone mutation, expressed suppressed or be subject to the impact of other factors, and can not normally functionating cause, these key genes are referred to as male sterility gene.Whole pollen development process is subject to very multipath regulation and control, has again several key genes to participate in every bar approach, so in corn, very polygenic sudden change all can cause male sterile generation, and new male sterile allelotrope is also constantly found.

The present invention for corn homozygous recessive malesterile mutants ms8, this mutant tassel stamen abortion (as shown in Figure 1).Just there is exception at reduction division pollen mother cell leptotene stage in the ms8 mutant that isozygotys, only has minority pollen mother cell to complete reduction division, but the sporule in later stage also can lose fertility by serious degradation.Some pollen mother cells can not carry out cytokinesis in reduction division I phase and II phase, form syncyte.Ms8 gene is positioned at No. 8 karyomit(e)s, and coding N-ethanoyl lactoside-3-α-galactotransferase, in corn inbred line B73, encoding sequence 1239bp, is shown in Sequence ID No:1.The promoter sequence of amplification gene upstream 2343bp, is shown in Sequence ID No:2, is structured in the upstream of Ms8 gene coded sequence, is used for driving the expression of Ms8 gene.After Ms8 promoter sequence and encoding sequence are imported corn ms8 malesterile mutants, plant recovers fertility.

The small subunit of the ADP-glucose pyrophosphorylase played a crucial role in Bt2 genes encoding corn embryosperm Starch synthesis process; after Bt2 gene function is lost; because starch in seed can not normally synthesize; when growing 31-35 days after pollination; in endosperm, starch small grain can obviously reduce; sucrose content increases, and afterwards dry and conventional corn seed has obvious difference (Fig. 2) in quality and form, but embryo and growing of plant are not affected.After normal Bt2 gene being disturbed by transgenic technology, transgenic corn plant seed sugar obviously increases, there will be serious shrinkage (Fig. 3) after drying, namely can carry out dual differentiation to transgenic seed and non-transgenic seed by sugar degree and shrinkage degree.In the present invention, the RNAi interference sequence of Bt2 gene derives from corn inbred line B73, but is not limited only to B73, can derive from other normal self-mating systems equally.

The RNA interference fragment of corn male sterility Restore gene Ms8 and Starch synthesis key gene Bt2 to be structured on same plant expression vector and maize transformation by the present invention, this carrier can recover the fertility of male sterile line of maize ms8, simultaneously, due in carrier with the interference fragment that can make Starch synthesis key gene Bt2 inactivation, endosperm starch grain is caused normally not synthesize, the corresponding increase of sugar content, can catastrophic collapse after seed drying.The invention provides a kind of novel method expanding the maternal male sterile line of numerous corn hybrid seed, can be used for the corn extensive high purity commercialization production of hybrid seeds.

The method of a kind of transgenic element provided by the invention and application thereof, the maternal male sterile line of differentiation corn hybrid seed and maintenance line, a kind ofly expand raw materials used in the method for the maternal male sterile line of numerous corn hybrid seed and reagent and all can be buied by market.

Below in conjunction with embodiment, set forth the present invention further:

The amplification of embodiment 1 Ms8 gene promoter sequence

The present invention, for corn male sterility mutant Ms8, elaborates embodiment.By finding Ms8 genomic sequence analysis, promoter region is positioned at 906bp place, transcription initiation site upstream.Arrange as reference with corn inbred line B73 genome sequence, the upstream and downstream primer of design amplification promoter sequence, upstream primer sequence Ms8-Pro-F1:5'-ctgcagACCCACCGGAACAAAATGTA-3'(is as shown in SEQ ID NO:6), downstream primer sequence Ms8-Pro-R1:5'-ggatccGCAGGCTATGCAGCTTCTCT-3'(is as shown in SEQ ID NO:7), and added Pst I restriction enzyme site at the 5' end of upstream amplification primer, the 5' of downstream amplification primer has added BamH I restriction enzyme site, expanding fragment length is 2343bp (Sequence ID No:2) (Fig. 4).PCR reaction system is (20 μ l): B73 genomic dna 1 μ l, primer Ms8-Pro-F10.5 μ l, primer Ms8-Pro-R1 0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 15.3 μ l.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 35S, 58 DEG C of 40S, 72 DEG C of 2.5min, 35 circulations, 72 DEG C of 7min.Amplification PCR primer connects T-carrier, and transformation of E. coli also detects, and extracts plasmid again, thus obtain the promoter sequence of Ms8 gene after selecting positive colony order-checking.

The amplification of embodiment 2 Ms8 gene coded sequence

In maizegdb database (www.maizegdb.org), the encoding sequence finding Ms8 gene is 1239bp (Sequence ID No:1), with corn inbred line B73 sequence for reference, the encoding sequence (Fig. 5) of design primer amplification Ms8 gene, upstream primer sequence Ms8-CDS-F1:5'-ggatccATGCTCCAGCTGCTGCGC-3'(is as shown in SEQ IDNO:8), downstream primer sequence Ms8-CDS-R1:5'-gagctcTCATGTGGCGGCGTTCCA-3'(is as shown in SEQID NO:9), and added BamH I restriction enzyme site at the 5' end of upstream primer, 5 ' of downstream primer has added Sst I restriction enzyme site.PCR reaction system is (20 μ l): B73 cDNA 1 μ l, primer Ms8-CDS-F1 0.5 μ l, primer Ms8-CDS-R10.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 15.3 μ l.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 35S, 58 DEG C of 40S, 72 DEG C of 1.5min, 35 circulations, 72 DEG C of 7min.Amplification PCR primer connects T-carrier, and transformation of E. coli also detects, and extracts plasmid again, thus obtain the encoding sequence of Ms8 gene after selecting positive colony order-checking.

The amplification of embodiment 3 Bt2 gene promoter sequence

In the present invention Bt2 interference fragment expression be the promotor of gene itself, the expression of Bt2 gene mainly concentrates in the endosperm of corn seed, therefore utilizes the mRNA of this promotor initiation transcription to be mainly present in seed endosperm.The genomic sequence analysis of Bt2 gene is found, promoter region is positioned at 1271bp place, transcription initiation site upstream, arrange as reference with corn inbred line B73 genome sequence, the promoter region of design primer amplification Bt2 gene, upstream primer sequence B t2-Pro-F1:5'-ctgcagTTTTCTCTCTCCCGCATGTT-3'(is as shown in SEQ ID NO:10), downstream primer sequence B t2-Pro-R1:5'-tctagaATGGGGAATTCGAGGAAAGT-3'(is as shown in SEQ ID NO:11), and added Pst I restriction enzyme site at 5 ' end of upstream primer, 5 ' end of downstream primer has added Xba I restriction enzyme site, expanding fragment length is 2334bp (Sequence ID No:5) (Fig. 6).PCR reaction system is (20 μ l): B73 genomic dna 1 μ l, primer Bt2-Pro-F1 0.5 μ l, primer Bt2-Pro-R1 0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o15.3 μ l.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 35S, 58 DEG C of 40S, 72 DEG C of 2.5min, 35 circulations, 72 DEG C of 7min.Amplification PCR primer connects T-carrier, and transformation of E. coli also detects, and extracts plasmid again, thus obtain the promoter sequence of Bt2 gene after selecting positive colony order-checking.

The amplification of embodiment 4 Bt2 gene RNAi sequence

Similarity analysis being carried out to the encoding sequence of Bt2 gene, finding out one section of specific sequence (SequenceID No:3) of 275bp length, for building RNAi carrier.With reference to the encoding sequence of corn inbred line B73, the interference fragment (Fig. 7) of design primer amplification 275bp, upstream primer Bt2-RNAi-F1:5'-cccgggAATCATTCTGGGAGGTGGTG-3'(is as shown in SEQ ID NO:12), downstream primer Bt2-RNAi-R1:5'-gagctcTTGGATTATCTGGGCTCTGC-3'(is as shown in SEQ ID NO:13), and having added Sma I restriction enzyme site at the 5' end of upstream primer, the 5' end of downstream primer has added Sst I restriction enzyme site.PCR reaction system is (20 μ l): B73cDNA 1 μ l, primer Bt2-RNAi-F1 0.5 μ l, primer Bt2-RNAi-R1 0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 15.3 μ l.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 35S, 58 DEG C of 40S, 72 DEG C of 30S, 35 circulations, 72 DEG C of 7min.Amplification PCR primer connects T-carrier PGWC, and transformation of E. coli also detects, and extracts plasmid again, thus obtain the RNAi sequence of Bt2 gene after selecting positive colony order-checking.

Embodiment 5 builds the plant expression vector comprising male fertility ability Restore gene Ms8 and Bt2 interference fragment Expression element

1, intermediate carrier PBI221 is utilized to build the expression cassette of Ms8 gene

First respectively double digestion is carried out to the T-carrier and intermediate carrier PBI221 that are connected with Ms8 promoter gene fragment with restriction enzyme Pst I and BamH I, enzyme cuts system (50 μ l): PBI221 plasmid 10 μ l, Buffer 5 μ l, Pst I 1 μ l, BamH I 1 μ l, ddH ₂o 33 μ l.Enzyme is cut and to be reclaimed object fragment afterwards, recycling step: 1, cut the sepharose containing target DNA under ultraviolet lamp, exhausts gel show liquid and shred with paper handkerchief.Calculated for gel weight (recording 1.5mL centrifuge tube weight in advance), this weight is as a gel volume (as 100mg=100 μ L).2, add the Buffer DE-A of 3 gel volumes, in 75 DEG C of heating in water bath after mixing, be interrupted mixing (every 2-3min), until gel piece melts (about 6-8min) completely.3, add the Buffer DE-B of 0.5 Buffer DE-A volume, mix.When the DNA fragmentation be separated is less than 400bp, the Virahol of 1 gel volume need be added again.4, the mixed solution in aspiration step 3, transfers to DNA preparation pipe (being placed in 2mL centrifuge tube), the centrifugal 1min of 12,000g.Abandon filtrate.5, put back 2mL centrifuge tube by preparing pipe, add 500 μ L Buffer W1, the centrifugal 1min of 12,000g, abandons filtrate.6, put back 2mL centrifuge tube by preparing pipe, add 700 μ L Buffer W2, the centrifugal 1min of 12,000g, abandons filtrate.12,000g centrifugal 1min are washed again in the same way with 700 μ L BufferW2.7,2mL centrifuge tube is put back by preparing pipe, the centrifugal 1min of 12,000g.8, be placed in clean 1.5mL centrifuge tube by preparing pipe, preparing the central deionized water adding 25-30 μ L sterilizing of film, room temperature leaves standstill 1min.The centrifugal 1min eluted dna of 2,000g.Then Ms8 promoter gene fragment is connected into PBI221 carrier (Fig. 8), linked system (10 μ l): Ms8 promoter gene fragment 2 μ l, PBI221 linearized vector 2 μ l, Solution I 5 μ l, ddH ₂o 1 μ l.Connect product conversion intestinal bacteria, step of converting: take out a frozen DH5 α competence at-70 DEG C and be placed on ice, the enzyme adding 5 μ L wherein connects product, mixes content, in ice, places 25min; 1.5mL centrifuge tube is placed on 30s in the water-bath being preheated to 42 DEG C; 1.5mL centrifuge tube is put cooled on ice 2min immediately; Add the LB liquid nutrient medium of the non-added with antibiotic of 400 μ L, put into 37 DEG C of shaking tables, 200rpm, 1h; After abandoning 320 μ L supernatants after the centrifugal 2min of 4000rpm, add 12 μ L IPTG (80mg/mL) and 10 μ L X-gal (80mg/mL), at the upper coated plate of the LB solid plate (Kana final concentration is 50mg/L) adding Kana (50mg/mL), be then inverted cultivation 14-16h to clone's appearance for 37 DEG C., bacterium shaken to positive colony and extract plasmid, extracting plasmid procedure: (1) gets the bacterium liquid of 4mL overnight incubation in the medium, and the centrifugal 1min of 12,000g, abandons most supernatant.(2) add 250 μ L Buffer S1 suspended bacterial precipitations, suspend and need evenly, should not leave little bacterium block.(3) add 250 μ L Buffer S2, gentleness also spins upside down fully to mix for 4-6 time and makes the abundant cracking of thalline, until form bright solution (this step is no more than 5min).(4) add 350 μ L Buffer S3, gentle also spinning upside down fully mixes 6-8 time, and 12, the centrifugal 10min of 000g draws the centrifugal supernatant in previous step and transfers to preparation pipe (being placed in 2mL centrifuge tube), the centrifugal 1min of 12,000g, abandons filtrate.(5) put back centrifuge tube by preparing pipe, add 500 μ L Buffer W1, the centrifugal 1min of 12,000g, abandons filtrate.(6) put back centrifuge tube by preparing pipe, add 700 μ L BufferW2, the centrifugal 1min of 12,000g, abandons filtrate; Wash once with 700 μ L Buffer W2 more in the same way, abandon filtrate.(7) be placed in clean 1.5mL centrifuge tube by preparing pipe, preparing the central deionized water adding 60-80 μ L sterilizing of film, room temperature leaves standstill 1min.The centrifugal 1min of 12,000g.Respectively with the PBI221 carrier being connected with Ms8 promoter gene fragment, double digestion is carried out to the T-carrier being connected with Ms8 gene coded sequence with restriction enzyme BamH I and Sst I again, enzyme cuts system for (50 μ l): plasmid 10 μ l, Buffer 5 μ l, Sst I 1 μ l, BamH I 1 μ l, ddH ₂o 33 μ l.After digestion products reclaims, Ms8 gene coded sequence is connected into the PBI221 carrier with Ms8 promoter gene fragment, linked system is again: Ms8 gene coded sequence fragment 2 μ l, with the PBI221 linearized vector 2 μ l of Ms8 promoter gene fragment, Solution I 5 μ l, ddH ₂o 1 μ l.So just the promoter fragment of Ms8 gene and encoding sequence are building up on PBI221 carrier.

2, intermediate carrier pJawoh18-RNAi and PBI221 is utilized to build the RNAi expression cassette of Bt2.

First the correct PGWC carrier with forward Bt2 RNAi fragment of order-checking and RNAi carrier pJawoh18-RNAi are LR to react, reaction system (5 μ l): with the PGWC carrier 1 μ l of forward Bt2 RNAi fragment, carrier pJawoh18-RNAi 1 μ l, LR enzyme 0.6 μ l, ddH ₂o 2.4 μ l, make the RNAi fragment of Bt2 be connected into pJawoh18-RNAi carrier (Fig. 9) with forward and reverse manner simultaneously, guarantee to form neck ring structure, respectively double digestion is carried out to this carrier and PBI221 carrier with restriction endonuclease sma I and Sst1 I again, enzyme cuts system for (50 μ l): plasmid 10 μ l, Buffer 5 μ l, Sma I 1 μ l, Sst1 I 1 μ l, ddH ₂o 33 μ l.Reclaim digestion products, recycling step is the same.And the fragment with the forward and reverse structure of RNAi is connected into PBI221 carrier, linked system (10 μ l): the fragment 2 μ l of the forward and reverse structure of RNAi, PBI221 linearized vector 2 μ l, Solution I 5 μ l, ddH ₂o 1 μ l.And then with restriction enzyme Pst I and Xba I respectively to the T-carrier with Bt2 promoter gene fragment with carry out double digestion with the PBI221 carrier of the forward and reverse structure of RNAi, enzyme cuts system (50 μ l): plasmid 10 μ l, Buffer 5 μ l, Sma I 1 μ l, Sst1 I 1 μ l, ddH ₂o 33 μ l.And reclaim, recycling step is the same.Bt2 promoter gene fragment is connected in the PBI221 carrier with the forward and reverse structure of RNAi, linked system (10 μ l): Bt2 promoter gene fragment 2 μ l, with the PBI221 linearized vector 2 μ l of the forward and reverse structure of RNAi, Solution I 5 μ l, ddH ₂o 1 μ l.So just the promoter fragment of Bt2 gene and RNAi interference fragment are building up in PBI221 carrier.

3, the plant expression vector comprising male fertility ability Restore gene Ms8 and Bt2 interference fragment Expression element is built

First with the PBI221 carrier with Ms8 promoter gene fragment and encoding sequence for template, the promoter fragment of overall amplification Ms8 gene, encoding sequence and NOS terminator sequence, and add Sac I restriction enzyme site at 5 ' end of upstream primer, 5 ' end of downstream primer adds BstE II restriction enzyme site, primer sequence: Ms8-3301-F:ATGAATACGAATTCGAGCTCACCCACCGGAACAAAATGTA'(is as shown in SEQ ID NO:14), Ms8-3301-R:GGGAAATTCGAGCTGGTCACCCCGATCTAGTAACATAGATGACAC AC'(is as shown in SEQ ID NO:15).PCR reaction system (20 μ l): template plasmid 0.2 μ l, primer Ms8-3301-F 0.5 μ l, primer Ms8-3301-R 0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 16.1 μ l.PCR reaction conditions: 95 DEG C of 5min, 95 DEG C of 35S, 65 DEG C of 40S, 72 DEG C of 4.5min, 35 circulations, 72 DEG C of 7min.And then carry out double digestion to PCR primer with the pCAMBIA3301 carrier of AM79 selection markers respectively with restriction enzyme Sac I and BstE II, enzyme cuts system (50 μ l): plasmid 10 μ l, Buffer 5 μ l, Sma I 1 μ l, BstE II 1 μ l, ddH ₂o 33 μ l.And the PCR primer after being cut by enzyme is connected into the pCAMBIA3301 carrier with AM79 selection markers, linked system (10 μ l): PCR primer 2 μ l, with the pCAMBIA3301 linearized vector 2 μ l of AM79 selection markers, 5 × In-Fusion Buffer Enzyme premix 2 μ l, ddH ₂o 4 μ l.Again with the PBI221 carrier with Bt2 promoter gene fragment and RNAi interference fragment for template, overall amplification Bt2 promoter gene fragment and RNAi interference fragment, and add BstE II restriction enzyme site at 5 ' of upstream and downstream primer simultaneously, primer sequence: BT2-3301-F:TGAATTACAGGTGACCTTTTCTCTCTCCCGCATGTT'(is as shown in SEQ ID NO:16), BT2-3301-R:GGGAAATTCGAGCTGGTCACCAATCATTCTGGGAGGTGGTG'(is as shown in SEQ IDNO:17), PCR reaction system (20 μ l): template plasmid 0.2 μ l, primer BT2-3301-F 0.5 μ l, primer BT2-3301-R 0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 16.1 μ l.PCR reaction conditions: 95 DEG C of 5min, 95 DEG C of 35S, 65 DEG C of 40S, 72 DEG C of 3min, 35 circulations, 72 DEG C of 7min.And then carrying out single endonuclease digestion with BstE II restriction endonuclease respectively to PCR primer with the pCAMBIA3301 carrier of Ms8 gene expression element, enzyme cuts system (50 μ l): plasmid 10 μ l, Buffer 5 μ l, BstE II 2 μ l, ddH ₂o 33 μ l.And the PCR primer after being cut by enzyme is connected into the pCAMBIA3301 carrier with Ms8 gene expression element, linked system (10 μ l): PCR primer 2 μ l, with the pCAMBIA3301 linearized vector 2 μ l of Ms8 gene expression element, 5 × In-Fusion Buffer Enzymepremix 2 μ l, ddH ₂o 4 μ l., so just construct the pCAMBIA3301 plant expression vector (Figure 10) comprising male fertility ability Restore gene Ms8 and Bt2 interference fragment expression cassette.

Embodiment 6 is by the plant conversion carrier maize transformation in case study on implementation 5

The method that the present invention infects maize immature embryos by Agrobacterium obtains corn gene plant.First by plant conversion carrier transformation Agrobacterium EHA105, then maize immature embryos is infected with the Agrobacterium containing goal gene, finally by marker gene screening positive transgenic plant.

Transforming acceptor used is corn self bred inbred line ZHLine, 9-11 days after pollination, get the Embryonic Ovule on pollination fruit ear seed, carry out Agrobacterium to infect in indoor, the rataria infected by Agrobacterium is placed on Selective agar medium and carries out multi-turns screen, obtain kanamycin-resistant callus tissue, kanamycin-resistant callus tissue is regenerated seedling, obtains transgenosis T ₀for plant.Obtain transgenosis T ₀after generation, use T ₀the ms8 mutant of pollen to the maternal background of corn hybrid seed for transfer-gen plant is hybridized and is carried out many generations in conjunction with seed phenotype and backcross, and obtaining background is isozygoty in the maternal and ms8 site of cross-fertilize seed, the maintenance line of transformation site heterozygosis.

Adopt Agrobacterium infestation method that Expression element is imported maize immature embryos, the detailed process obtaining transfer-gen plant after herbicide glyphosate screening is:

One, rataria is peeled off

1, material prepares.Get the pollination fruit ear of latter 9-11 days, remove front end and grow bad part, insert fruit ear with tweezers from top, then fruit ear is put in beaker.

2, in beaker, add the ethanol disinfection 20 minutes of 70%, amount of alcohol there preferably was not fruit ear, in sterilizing process otherwise time Mobile fruit cluster, allow fruit ear contact completely with ethanol, reach best sterilisation effect.After sterilization terminates, take out fruit ear and vertically place, allowing the ethanol on fruit ear surface flow out, preparing stripping embryo.

3, the fruit ear one end of sterilizing is placed on culture dish, the tweezers that the other end inserts are fixed, and ream the top of seed with scalpel, note not cutting rataria.

4, be inserted between Fetal liver cells with the point of a knife of scalpel, then upwards prize rataria gently, and hold up rataria with point of a knife, guarantee that rataria is not subject to any damage, rataria is dipped in be infected in the 2ml sterile centrifugation tube of liquid containing 100 μMs of high oozing of AS, and often pipe puts rataria about 100.

Two, Agrobacterium is infected

1, picking Agrobacterium positive colony puts into the 50ml centrifuge tube containing 5ml YEP (50mg/L Kan and 50mg/L Rif) substratum, and at 28 DEG C of temperature, 75rpm shakes bacterium 2-4 hour.

2, the rataria in centrifuge tube is oozed with the height of 100 μMs of AS infect liquid and wash 2 times, then add the Agrobacterium bacterium liquid of 1ml OD=0.3-0.4, put upside down gently and allow rataria and bacterium liquid uniform contact, dark culturing 10 minutes, and guarantee that rataria is all immersed in bacterium liquid.

Three, Dual culture

1, after infecting end, rataria is put on sterilized filter paper, blots the bacterium liquid of embryo surface, then rataria is transferred on Dual culture base, make the plane contact media surface of rataria.

2, ParafilmTM culture dish is used, light culture 3 days under 22 DEG C of conditions.

Four, screening is postponed

1, Dual culture is after 3 days, rataria is transferred to and postpones in screening culture medium, light culture 5 days.

Five, resistance screening

1, postpone screening after 5 days, on the Selective agar medium all ratarias being transferred to 1mM glyphosate, light culture two weeks, carries out first round screening, and on the substratum proceeding to 2mM glyphosate afterwards again, light culture two weeks, carries out second and take turns screening.

Six, the regeneration of transfer-gen plant

1, the maize calli through resistance screening is proceeded to recovery media, renewal cultivation 20 days under dark condition.

2, the resistant calli after renewal cultivation is proceeded to division culture medium, first cultivate 3 days under dark condition, then cultivate under illumination condition.

3, the resistant plant differentiated is proceeded to root media, individual plant is cultured to secondary root system and grows, and is then transplanted to greenhouse, carries out normal management until pollinate solid.

The analysis of embodiment 7 positive transformants

For plant fertility and seed shrinkage degree, transfer-gen plant is analyzed.By T ₀being transplanted to plantation in advance for regenerated transgenic seedling has in the isolated area of non-transgenic corn and ms8 malesterile mutants, non-transgenic corn and ms8 malesterile mutants shift to an earlier date sowing in 15 days, and carry out normal field management, comprise water, apply fertilizer, weeding, prevention and elimination of disease and pests etc., the proterties such as record growth potential, leaf look, leaf angle, loose powder time, the time of weaving silk, plant height, Ear height also compare, and do not have notable difference between transfer-gen plant and non-transgenic reference.Grow into weave silk, the loose powder phase time, T ₀t is obtained for transgenic corns selfing ₁for seed, ms8 malesterile mutants T ₀solid for transgenic corns pollen hybridization, after the drying of seed fully matured, add up T respectively ₀for the quantity of transgenic corn plant and the normal seed of ms8 malesterile mutants plant and shrinkage seed.T ₀ratio for transgenic corn plant shrinkage seed and normal seed is 1:3 (table 1), and the ratio that transfer-gen plant and male sterile plants mutant ms8 hybridize normal seed and the shrinkage seed produced is 1:1 (table 2).

Table 1 T0 is for transgenic corns seed phenotype statistic analysis result

Table 2 transgenic corns and ms8 heterozygote seed phenotype statistic analysis result

At field planting T ₀for the F of transgenic corns and ms8 malesterile mutants ₁for cross-fertilize seed, detection of GMOs is carried out to every strain, and observed and recorded fertility, Seed shape.Plant containing transgene component shows as and can educate, and the plant not containing transgene component shows as completely sterile.This shows the expression complementation of the Ms8 gene phenotype of the recessive ms8 malesterile mutants that isozygotys.Meanwhile, the more not genetically modified normal seed catastrophic collapse of the seed containing Bt2 interference fragment, phenotype is with bt2 mutant.This shows that Bt2 Gene interfere fragment can normal functionating in transfer-gen plant.

Results F ₂for seed, and normal seed and shrinkage seed are separately seeded in field, record germination.Shrinkage seed and normal seed all can normally germinate, and bud ratio and normal seed do not have significant difference (table 3).When plant grows to about 20cm, spray the glyphosate solution of 1 times of concentration, the plant of shrinkage seed all can normally survive, and growth is not suppressed.And the seedling that normal seed goes out is all dead.This shows Ms8 fertility restorer gene, Bt2 interference fragment and selectable marker gene AM79 all normal functionatings of energy, and these three gene linkage heredity.

Table 3 transgenic corns F2 adds up for normal seed and shrinkage seed seedling rate

Embodiment 8 changes maternal for corn hybrid seed self-mating system into ms8ms8 homozygous recessive male sterile line

In field, the same period sows ms8 homozygous recessive mutant and cross-fertilize seed female parent, carry out normal field management, comprise water, apply fertilizer, weeding, prevention and elimination of disease and pests etc., grow into ms8 homozygous recessive mutant to weave silk, during cross-fertilize seed female parent loose powder, with ms8 homozygous recessive mutant for female parent, maternal for paternal hybrid with cross-fertilize seed, the F of acquisition ₁backcross, from BC with cross-fertilize seed female parent for continuing after planting seed ₁f ₁in generation, starts to carry out gene type assay, primer is ms8-ID-F:5'-CCAGGACCTACTTCACCACC-3', ms8-ID-R:5'-ATCCGGTCCACCGACTTAC-3', PCR reaction system is (20 μ l): genomic dna 1 μ l, primer ms8-ID-F 0.5 μ l, primer ms8-ID-R0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 15.3 μ l.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 35S, 58 DEG C of 40S, 72 DEG C of 30S, 35 circulations, 72 DEG C of 7min.The plant of identification of M s8 site heterozygosis continues to backcross with cross-fertilize seed female parent, so backcross 5-6 generation, utilize molecule marker (see table 4) to screen backcross population, mark title used, position on chromosome and flag sequence are as shown in table 4, and PCR reaction system is (20 μ l): genomic dna 1 μ l, forward primer 0.5 μ l, reverse primer 0.5 μ l, dNTP 0.5 μ l, 10 × PCR Buffer 2 μ l, Taq enzyme 0.2 μ l, ddH ₂o 15.3 μ l.PCR reaction conditions: 94 DEG C of 5min, 94 DEG C of 30S, 56 DEG C of 30S, 72 DEG C of 30S, 35 circulations, 72 DEG C of 7min.Screening Ms8 site is heterozygosis, and the individual plant that other sites are the maternal background of cross-fertilize seed carries out selfing, thus isozygotys in acquisition ms8 site, and background is the male sterile line (Figure 11 A) of cross-fertilize seed female parent.

Table 4 marks title, position and sequence

Numbering	Mark title	Mark position	Forward sequence	Reverse sequence
					1	bnlg1014	bin1.01	CACGCTGTTTCAGACAGGAA	CGCCTGTGATTGCACTACAC
2	bnlg1484	bin1.03	GTAAAAGACGACGACATTCCG	GACGTGCACTCCGTTTAACA

3	umc1917	bin1.04	ACTTCCACTTCACCAGCCTTTTC	GGAAAGAAGAGCCGCTTGGT
					4	umc1689	bin1.05	GAGGCGGAGGAGGAACACAG	GAACGAGTAGGGCAGCGTCAG
5	bnlg1556	bin1.07	ACCGACCTAAGCTATGGGCT	CCGGTTATAAACACAGCCGT
					6	umc1383	bin1.08	CACACACATCGATCATGAGCATAC	GTGTACTACCATCAGACCCATCCA
7	umc2149	bin1.10	TACATGCAAAGCTAGCTAGTCGGA	AGCAGCACCATCGTAATAAGCAC
					8	bnlg1055	bin1.11	GCTGGATGGCAGGTACAGAG	TGCAATGGAGAAGCAACAAG
9	umc1552	bin2.01	CTCGATAGCTCTGCTGCTTCCTC	CAACACCAGCCCTACCCAGA
					10	bnlg1297	bin2.02	TCTCGATCGCTCCGATCTAT	GACTCAACTCCAAAAGGCGA
11	umc1185	bin2.03	AGTAAAAGAGGCAAGGACTACGGC	GCGGCGATATATACGAGGTTGT
					12	bnlg1018	bin2.04	CGAGGTTAGCACCGACAAAT	CGAGTAAATGCTCTGTGCCA
13	umc1635	bin2.05	GCTGAGCAGATCTTTCCTTGTTTC	AAGGAGCAGAACTCGGAGACG
					14	umc1065	bin2.06	ACAAGGCCATCATGAAGAGCAGTA	CACGGTCTGGCACACTAACCTTAT
15	umc1551	bin2.09	CACCGGAACACCTTCTTACAGTTT	CGAAACCTTCTCGTGATGAGC
					16	umc2101	bin3.00	CCCGGCTAGAGCTATAAAGCAAGT	CTAGCTAGTTTGGTGCGTGGTGAT
17	umc1394	bin3.01	CCCGAGTCAGAAAAACATTCACTT	CCTAACCTGAAGAAGGGAGGTCAT
					18	bnlg1447	bin3.03	GAGAGGAGAGGCTGAGCTGA	TCCTCCCACTGAATTTCCAC
19	umc1489	bin3.07	TTAATAGCTACCCGCAACCAAGAA	CTGAGCCACAGTACCTTGCTGTT
					20	umc1639	bin3.10	CTAGCCAGCCCCCATTCTTC	GCAAGGAGTAGGGAGGACGTG
21	umc1669	bin4.01	ACGAGGGCTTCTTCTCTGAGC	GTTTCCTTCTTCATGCGACGAC
					22	umc2039	bin4.03	CATCTCCTACCAGCTCACCCC	GCTCGGGGTAGTAGTGTTCTCCTT
23	umc1101	bin4.09	GCTGAAAAACGGAGTTCATATGGT	AAGCTTATCCACCTCGAGGAAAAC
					24	umc1050	bin4.11	CGATACACATCCATCTTCAGGTAGC	GCCTTTGTACCAATACAAGCCAAG
25	umc1260	bin5.00	CTTAAGCAGAGCTCAAAAACTGCC	TAAATTGTCAAGCGAGGTTTGGAT
					26	umc2036	bin5.01	TCAATCAAGCCTCTCGTAAGGAAC	CTCTTGATCTCAACCGAAATCCTG
27	umc1747	bin5.04	ATCCGCTATCGAATGGCAGC	GAAGAAGGAGATCGAGCGGCTA
					28	umc1155	bin5.05	TCTTTTATTGTGCCCGTTGAGATT	CCTGAGGGTGATTTGTCTGTCTCT
29	umc1019	bin5.06	CCAGCCATGTCTTCTCGTTCTT	AAACAAAGCACCATCAATTCGG
					30	bnlg1346	bin5.07	CATCATGAAGCAATGAAGCC	CCGCGCCATTATCTAGTTGT
31	umc1883	bin6.00	GAATAATCAATCCATCGATCTCGC	AACTGCTGTGGATGAAAGAGGAAG
					32	umc1006	bin6.02	AATCGCTTACTTGTAACCCACTTG	AGTTTCCGAGCTGCTTTCTCT
33	umc1014	bin6.04	GAAAGTCGATCGAGAGACCCTG	CCCTCTCTTCACCCCTTCCTT
					34	umc1859	bin6.06	ATATACATGTGAGCTGGTTGCCCT	GCATGCTATTACCAATCTCCAGGT
35	umc1127	bin6.08	GGTCCAGTGACATCTCAAAATGAA	ATATTCCCCCTCCCTAATTTTGCT
					36	umc1066	bin7.01	ATGGAGCACGTCATCTCAATGG	AGCAGCAGCAACGTCTATGACACT
37	umc1015	bin7.03	CAGACACAAGCAGCAAAGCAAG	TCCGACTCCAAGAAGAGGAGAA
					38	umc1154	bin7.05	CCACCACAAGACAAGACAAGAATG	CCTGATCGATCTCATCGTCGT
39	bnlg1863	bin8.03	GGCGTTCGTTTTGCACTAAT	CGACACAGTTGACATCAGGG

40	umc1858	bin8.04	GTTGTTCTCCTTGCTGACCAGTTT	ATCAGCAAATTAAAGCAAAGGCAG
					41	bnlg1350	bin8.07	TGCTTCAGCGCATTAAACTG	TGCTCGTGTGAGTTCCTACG
42	umc1069	bin8.08	AGAGAATCCCCAAGCAAACAAAC	CTTCATCGGAGCCATGGTGT
					43	umc1663	bin8.09	GCTTGCACTAGCTTTAGCTCCATC	CGGGATCAGTCGTTACAAACATAG
44	bnlg1810	bin9.01	ATGCTCCTCCTCTCCTCCAT	GCGATGATGAGCTGCAAGTA
					45	umc1037	bin9.02	GTGCGCGATTCCTTAGTTTGC	CTTCTTCGTAAAGGCATTTTGTGC
46	umc1271	bin9.03	CTCTCCTCGTCCGGTAATTAAGC	GCTTCTTCTTCTTGCGCTTCTCT
					47	umc1492	bin9.04	GAGACCCAACCAAAACTAATAATCTCTT	CTGCTGCAGACCATTTGAAATAAC
48	umc1505	bin9.08	TTACACAGAAGCCCATTTGAAGGT	GGATGGTTGTTGGTGGTGTAGAAT
					49	umc1152	bin10.01	CCGAAGATAACCAAACAATAATAGTAGG	ACTGTACGCCTCCCCTTCTC
50	umc1432	bin10.02	GGCCATGATACAGCAAGAAATGAT	TACTAGATGATGACTGACCCAGCG
					51	umc1053	bin10.04	CTTGTATCATCAGCTAGGGCATGT	TCAACTTATGTCAACTGCATGCTT
52	umc1506	bin10.05	AAAAGAAACATGTTCAGTCGAGCG	ATAAAGGTTGGCAAAACGTAGCCT
					53	umc1993	bin10.06	CTTTTCTGCTACTCCTGCCTGC	CTAGCTGATGGAGGCTGTAGCG

Embodiment 9 will transform the maternal male sterile line of fragment introductive crossing kind, and analyze offspring

By the T obtained in case study on implementation 7 ₁be seeded in large Tanaka the same period for the maternal male sterile line of the cross-fertilize seed in transgenic corn seed and case study on implementation 8, carry out normal field management, comprise water, apply fertilizer, weeding, prevention and elimination of disease and pests etc., T to be grown into ₁weave silk for transfer-gen plant, during the cross-fertilize seed female parent male sterile line loose powder phase, with T ₁being maternal for transfer-gen plant, is that paternal hybrid obtains F with the maternal male sterile of cross-fertilize seed ₁for cross-fertilize seed.The same period sows F ₁for cross-fertilize seed and the maternal male sterile line of cross-fertilize seed, carry out normal field management after emerging, F to be grown into ₁weave silk for individual plant, during maternal male sterile line loose powder, with F ₁on behalf of female parent, be that paternal hybrid obtains BC with the maternal male sterile of cross-fertilize seed ₁f ₁for seed, from BC ₁f ₁the glyphosate solution of 1 times of concentration is sprayed after being seeded into field for the seed starting to select phenotype shrinkage, continue to backcross with maternal male sterile line to the plant of survival, so backcross 5-6 generation after, molecule marker (see table 4) screening transgenic site is utilized to be heterozygosis, Ms8 site is that recessiveness is isozygotied, and other sites are the individual plant (mark and PCR reaction conditions in the same manner as in Example 8) of the maternal background of cross-fertilize seed.This individual plant and cross-fertilize seed hybridization of female parent, the offspring of generation not only has the maternal male sterile line of cross-fertilize seed, and also has the maintenance line of cross-fertilize seed female parent, and sterile line seed is normal, maintenance line seed shrinkage (Figure 11 B).

Embodiment 10 utilizes male sterility maintainer line to carry out vast propagation to male sterile line

Maintenance line in maternal for cross-fertilize seed in case study on implementation 8 male sterile line and case study on implementation 9 is seeded into field, two materials are separated by sowing, often sow 1 row maintenance line and sow 5 row sterile lines accordingly, guarantee in sowing 300 meters, periphery without other corn seedings, after planting carry out normal field management, comprise and watering, fertilising, weeding, prevention and elimination of disease and pests etc., wait to grow into and weave silk, during the loose powder phase, only weave silk due to sterile line and there is no pollen, maintenance line is not only weaved silk but also have pollen, so the pollen that sterile line can only accept maintenance line to complete pollination solid, the seed obtained or sterile line, thus realize the object of vast propagation.Maintenance line can only accept oneself pollen, all has shrinkage proterties containing homozygous transgenic composition and Heterozygous transgenic composition in the offspring of generation, and owing to distinguishing, these seeds are abandoned, and normal seed can as sterile line.Sterile line material receives the pollen of maintenance line, and in its offspring, normal seed is not containing the sterile line of transgene component, and shrinkage and the seed that sucrose content increases, starch content reduces are the maintenance line containing transgene component.Shrinkage proterties can with the naked eye accurately identify, the change of sucrose and starch proportion can detect by means of SupNIR-3300 grain quality Instrument for Nondestructive Testing, the starch content of normal corn kernel is between 62.4%-73.5%, mean value is 68.8% (Wei Liang bright 1, Yan Yanlu, Dai Jingrui. near-infrared spectral reflectance measures the research of corn entire kernel Protein and starch contents. Scientia Agricultura Sinica, 2004, 37 (5): 630-633), we set threshold value be the seed that starch content is less than 55% is maintenance line seed, the detected results of 50,000 are confirmed that its accuracy rate is 100%.Maintenance line all expands numerous sterile line and maintenance line for next year, and in sterile line, major part produces cross-fertilize seed, and remaining small portion is used for next year and expands numerous sterile line and maintenance line (Figure 11 C).

Embodiment 11 utilizes male sterile line scale operation cross-fertilize seed

Because the maternal male sterile of cross-fertilize seed is the homozygous recessive male sterile line that nucleus controls, this sterile line can be recovered fertility by cross-fertilize seed male parent.By maternal for the cross-fertilize seed in case study on implementation 10 male sterile line and normal male parent self-mating system alternate row seeding in field, usually the arrangement mode plantation of 1 row male parent self-mating system is planted by the maternal male sterile line of 5 row cross-fertilize seed, and guarantee in 300 meters, growing area periphery without other corn plantings, after planting carry out normal field management, comprise and watering, fertilising, weeding, prevention and elimination of disease and pests etc., wait to grow into and weave silk, during the loose powder phase, only weave silk due to maternal sterile line and there is no pollen, male parent self-mating system is not only weaved silk but also have pollen, so the fruit ear of maternal sterile line can only accept the pollen of male parent self-mating system, and male parent self-mating system can only selfing.The seed that so maternal sterile line fruit ear produces is the F1 generation cross-fertilize seed in production, and the production of hybrid seeds result display on a small scale through 2 years, purity of hybrid is 100%.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Claims (12)

1. a transgenic element, is characterized in that, comprising:

(I) first expression cassette, described first expression cassette contains the dominant allele of corn male sterility gene and the promotor of described dominant allele;

(II) second expression cassette, described second expression cassette contains the promotor of saccharoid gene, the forward RNAi fragment of described saccharoid gene, the reverse RNAi fragment of described saccharoid gene.

2. transgenic element according to claim 1, is characterized in that, the dominant allele of described corn male sterility gene:

I () has the nucleotide sequence as shown in SEQ ID NO:1;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:1;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:1 obtains through lacking, replacing or add one or more Nucleotide.

3. transgenic element according to claim 1 and 2, is characterized in that, the promotor of the dominant allele of described corn male sterility gene:

I () has the nucleotide sequence as shown in SEQ ID NO:2;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:2;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:2 obtains through lacking, replacing or add one or more Nucleotide.

4. the transgenic element according to any one of claims 1 to 3, is characterized in that, described saccharoid gene is Bt2.

5. the transgenic element according to any one of Claims 1-4, is characterized in that, the promotor of described saccharoid gene:

I () has the nucleotide sequence as shown in SEQ ID NO:5;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:5;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:5 obtains through lacking, replacing or add one or more Nucleotide.

6. the transgenic element according to any one of claim 1 to 5, is characterized in that, the forward RNAi fragment of described saccharoid gene:

I () has the nucleotide sequence as shown in SEQ ID NO:3;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:3;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:3 obtains through lacking, replacing or add one or more Nucleotide.

7. the transgenic element according to any one of claim 1 to 6, is characterized in that, the reverse RNAi fragment of described saccharoid gene:

I () has the nucleotide sequence as shown in SEQ ID NO:4;

(ii) there is the sequence of nucleotide sequence 75% homology as shown in SEQ ID NO:4;

(iii) there is the nucleotide sequence that the nucleotide sequence as shown in SEQ ID NO:4 obtains through lacking, replacing or add one or more Nucleotide.

8. the transgenic element according to any one of claim 1 to 7, is characterized in that, described second expression cassette also comprises the intron of described saccharoid gene.

9. the application of the transgenic element according to any one of claim 1 to 8 in maize hybrid seed production.

10. application according to claim 9, is characterized in that, described maize hybrid seed production comprises to be distinguished corn hybrid seed maternal male sterile line and maintenance line or expands the maternal homozygous recessive male sterile line of numerous corn hybrid seed.

11. 1 kinds of methods distinguishing the maternal male sterile line of corn hybrid seed and maintenance line, is characterized in that, comprise the steps:

Step a, obtain the first milpa as male parent;

Described first milpa contains the homozygous recessive alleles ms8ms8 of a pair corn male sterility;

Step b, obtain the second milpa as female parent;

Described second milpa contains the homozygous recessive alleles ms8ms8 of corn male sterility and the transgenic element as described in any one of claim 1 to 8;

Step c, get described first milpa and described second milpa hybridizes, after obtaining F1 generation, backcross with described first milpa many generations, distinguish sterile line and maintenance line by seed shrinkage proterties;

Seed shrinkage be maintenance line, full seed be sterile line.

The method of 12. 1 kinds of maternal male sterile lines of the numerous corn hybrid seed of expansion, is characterized in that, comprise the steps:

Step a, obtain the first milpa as male parent;

Described first milpa contains the homozygous recessive alleles ms8ms8 of a pair corn male sterility;

Step b, obtain the second milpa as female parent;

Described second milpa contains the homozygous recessive alleles ms8ms8 of corn male sterility and the transgenic element as described in any one of claim 1 to 8;

Step c, get described first milpa and described second milpa hybridizes, after obtaining F1 generation, backcross with described first milpa many generations, distinguish male sterile line by seed shrinkage proterties and can maintenance line be educated; Seed shrinkage for maintenance line can be educated, full seed be male sterile line;

Steps d, get and can educate maintenance line described in step c and described male sterile line is hybridized, obtain the maternal male sterile line of cross-fertilize seed of full seed and the educated maintenance line of seed shrinkage;

The maternal male sterile line of cross-fertilize seed of described full seed and its paternal hybrid carry out the production of hybrid seeds of corn hybrid seed;

Educated maintenance line and the described male sterile line of described seed shrinkage are hybridized, and obtain male sterile line and can educate maintenance line.