WO2016139657A1 - Markers for high yield in maize - Google Patents

Markers for high yield in maize Download PDF

Info

Publication number
WO2016139657A1
WO2016139657A1 PCT/IL2016/050215 IL2016050215W WO2016139657A1 WO 2016139657 A1 WO2016139657 A1 WO 2016139657A1 IL 2016050215 W IL2016050215 W IL 2016050215W WO 2016139657 A1 WO2016139657 A1 WO 2016139657A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
maize
maize plant
seq
nucleotide sequence
Prior art date
Application number
PCT/IL2016/050215
Other languages
French (fr)
Inventor
Yoel EFRON
Original Assignee
Y. E. Vigor. Corn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Y. E. Vigor. Corn filed Critical Y. E. Vigor. Corn
Priority to EP16758551.2A priority Critical patent/EP3264885A4/en
Publication of WO2016139657A1 publication Critical patent/WO2016139657A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10—Seeds
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4684—Zea mays [maize]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • This invention relates generally to the production of maize, commonly known in the United States as corn and more specifically concerns the development markers for high yield in maize.
  • Maize is the most widely grown grain crop in the America. Commercial hybrid maize normally grows with 5-7 leaves above the ear placement (see Figure 1 A). The ear that produces the grains normally grows about one-third the way up the plant. The tassel that produces the pollen is found at the top of the plant. The pollen is carried by the wind to the female silk produced on the ear of nearby plants. Hence, maize is naturally cross-pollinated plant which provides a continuing source of variation in genetic constitution.
  • Maize yield is largely depends on the availability of metabolites produced by the photosynthetic activity of the leaves during grain filling.
  • the photosynthesis during grain filling progressing at the most rapid rate in the leaves is found in the area above the ear.
  • U.S. Pat. No. 4,368,592 relates to the reduction of height of the maize plant by a genetic dominant semi-dwarf allele.
  • U.S. Pat. No. 4,513,532 issued to the Lfy gene relates to a single, dominant genetic factor capable of altering leaf number and distribution in maize. However this dominant Lfy allele causes to the addition of up to 18 leaves above the ear (LAE), and thus rendering the plant unstable and easily tending to fold and droop.
  • LAE additional leaves above the ear
  • It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has a molecular marker profile defined by the equation N H i EfLj iJi j Q " ), where M is the total number of molecular markers, the molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, ? «;( ) is the presence of molecular marker / in maize plant j, and 3 ⁇ 4 t is the number of molecular markers in the plant j.
  • LAE additional leaves above the ear
  • LAE additional leaves above the ear
  • improved stress tolerance particularly with improved characteristic selected from the group consisting of: nicking between pollen shed and silk emergence, "Stay Green” characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, increased dry weight yield, adaptation to higher density planting, and any combination thereof.
  • pant exhibits an improved stress tolerance, particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green” characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • an improved stress tolerance particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green” characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • LAE additional leaves above the ear
  • tissue culture as defined above, comprising cells or protoplasts from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruit and seeds.
  • tissue culture of regenerable cells as defined in any of the above, wherein the tissue regenerates plants exhibiting an additional leaves above the ear (LAE) architecture, the architecture is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
  • It is a further object of the present invention to a method for screening for a maize plant exhibiting additional LAE architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9 comprising the steps of: screening the genome of a maize plant for the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; the at least one molecular marker co-segregates with additional LAE architecture.
  • the isolated nucleotide sequence as defined in any of the above wherein the increased yield properties are selected from the group consisting of: increased plant height without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, increased dry weight yield, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant. It is a further object of the present invention to provide isolated oligonucleotide sequences annealing with the nucleotide sequence as defined in any of the above, wherein the sequences are suitable for the detection and production of maize plants having additional leaves above the ear (LAE) architecture.
  • LAE additional leaves above the ear
  • weather-related environments e.g. tropical, sub-tropic, temperate, etc.
  • FIG. 1A and IB present schematic illustration of exemplified physical effects of ELEi components compared to normal maize
  • Fig. 2 photographically presents improved stress tolerance of maize plants comprising the ELEi genetic factor as compared to normal control maize plants.
  • the present invention provides a maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein said architecture co-segregates with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
  • the maize plant as defined above exhibits an architecture that co-segregates with a molecular marker profile selected from the group consisting of:
  • the plants comprising one of the molecular marker combinations described above exhibit higher yield relative to plants with similar genetic constitution and having either a lower number of molecular markers (SEQ ID NO: l to SEQ ID NO: 9) co-segregating with the additional LAE phenotype or lacking those molecular markers.
  • the yield is positively correlated with the number of markers in the maize plant. In other words, according to certain aspects of the invention, the more molecular markers identified in the maize plant, the more yield it produces.
  • the present invention provides the maize plant as defined in any of the above, wherein the architecture is associated with the ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729.
  • This novel ELE QTL encompass the molecular markers selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9 and any combination thereof.
  • 'ELE' refers to a genetic determinant or factor or region that is found to affect or to be associated with number of leaves above the ear (LAE).
  • the term 'ELEj' refers to an allele which is linked to the unique DNA markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, wherein the markers are co-segregating with additional LAE architecture or phenotype. It is shown by the present invention that the ELEi is characterized by a non-dominant inheritance.
  • the additional LAE architecture identified by the unique molecular markers is associated with desirable increased yield characteristics such as increased plant height with or without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
  • the term 'molecular marker profile' refers hereinafter to a DNA marker set comprising DNA tag sequences representing the uniqueness of a donor line allele, particularly the ELE QTL donor line characterized by the ELEi a u e i e ⁇ co-segregating with the additional LAE phenotype.
  • the DNA marker set comprises at least one molecular marker or DNA tag having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO: 9 and any combination thereof.
  • the molecular marker profile of the maize plant with additional LAE architecture of the present invention may be described by the following equation: 3 ⁇ 4 f .
  • v . is the number of molecular markers in plant j.
  • yield rank of maize plant j characterized by a unique molecular profile, as defined above, relative to a second or reference maize plant may be defined by the following equation: , where
  • S is the total number of plants compared to each other.
  • R(j) is the yield rank of maize plant j (defined by molecular marker profile 3 ⁇ 4 f ) relative to a second or reference maize plant i (defined by molecular marker profile
  • the present invention provides a non-dominant non- transgenic genetic factor (ELEi ) which is capable of significantly increasing maize yield by adding usually two or three leaves above the ear (LAE).
  • the present invention provides a non-dominant non-transgenic genetic factor (ELEi ) which is capable of significantly increasing maize yield by adding usually two or three leaves above the ear (LAE) in homozygous ELE1 /ELE1 configuration as compared with a homozygous ELE2/ELE2 genotype (normal maize).
  • the heterozygote ELE1 /ELE2 plant has an intermediate number of
  • the term 'about' refers to a value being ⁇ 25% of the defined measure.
  • the term 'genetic determinant' is defined herein as a nucleotide sequence, preferably a DNA sequence that may comprise sequences with various genomic functions such as genes and regulatory elements regions. Genetic determinant may also refer to a nucleotide construct and may be comprised in a vector. Alternatively, a genetic determinant may be transferred from one plant to another by chromosomal recombination after crossing said plants. A genetic determinant may in principle comprise genetic material originating from one or more species.
  • genetic determinant as used herein refers to a single non dominant gene or multiple genes, a QTL or a haplotype, that determines or controls additional leaves above the ear (LAE) architecture or phenotype in a maize plant. More particularly genetic determinant as used herein refers to ELE non-dominant genetic factor disclosed by the present invention for the first time.
  • a 'gene' is defined herein as a hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristic or trait in an organism.
  • a 'locus' is defined herein as the position on a genetic map that a given gene or any other genetic element or factor contributing to a trait occupies on a chromosome of a given species.
  • heterozygous' refers to a genetic configuration existing when different alleles reside at corresponding loci on homologous chromosomes.
  • homozygous' refers to a genetic configuration existing when identical alleles reside at corresponding loci on homologous chromosomes. Homozygosity is defined as absence of segregation after selfing of an individual plant or, if crossed, absence of segregation in Fl.
  • the terms 'hybrid', 'hybrid plant' and 'hybrid progeny' refers to an individual produced from genetically different or unlike parents (e.g., parental lines having substantially different genetic constitution).
  • a hybrid plant refers to a genetically heterozygous or mostly heterozygous individual.
  • Fl hybrid refers to an Fl hybrid produced from a cross between two inbred lines.
  • the phrase 'inbred line' refers to a genetically homozygous or nearly homozygous population.
  • An inbred line for example, can be derived through several cycles of breeding or of selfing. In some embodiments, inbred lines breed true for one or more phenotypic traits of interest.
  • An 'inbred', 'inbred individual', or 'inbred progeny' is an individual sampled from an inbred line.
  • the term 'trait' refers to a characteristic or phenotype, e.g., additional leaves above the ear architecture, kernel's yield, stress tolerance and parasite tolerance such as tolerance to striga.
  • a trait may be inherited in a dominant or recessive manner, or in a partial or incomplete-dominant manner.
  • a trait may be monogenic (i.e. determined by a single locus) or polygenic (i.e. determined by more than one locus) or may also result from the mutual interaction among genes or interaction of one or more genes with the environment.
  • a dominant trait results in a complete phenotypic manifestation at heterozygous or homozygous state; a recessive trait manifests itself only when present at homozygous state.
  • the ELE genetic determinant shows a non dominant inheritance, and more particularly, a co dominant inheritance pattern.
  • 'dominant' and 'recessive' refer to the interaction of alleles in producing the phenotype of the heterozygote.
  • Dominance is a genotypic relationship between alleles, as manifested in the phenotype. It is unrelated to the nature of the phenotype itself, e.g., whether it is regarded as normal or abnormal, standard or nonstandard, healthy or diseased, stronger or weaker, or more or less extreme.
  • a dominant trait or allele or dominant genetic factor results in a situation where the phenotype of the heterozygote is completely indistinguishable from that of the dominant homozygote.
  • the term 'non dominant' relates to a genetic configuration inheritance where the phenotype of the heterozygous genotype is an intermediate of the phenotypes of the homozygous genotypes.
  • 'co-dominant' or 'co-dominance' used herein refers to a genetic configuration inheritance where allelic products co-exist in the phenotype.
  • the term also include incomplete or semi-dominance configuration, where the quantitative interaction of allele products produces an intermediate phenotype.
  • the heterozygote ELE1 /ELE2 plant has an intermediate number of leaves above the ear
  • LAE LAE relative to the homozygous ELEi /ELEi or ELE2/ELE2 plant.
  • the term 'allele(s)' means any of one or more alternative forms or variant forms of various genetic units determinants or factors identical or associated with different forms of a gene or of any kind of identifiable genetic element, all of which alleles relate to at least one trait or characteristic.
  • the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes and are, therefore, alternative in inheritance.
  • Such alternative or variant forms may be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or the consequence of gene regulation caused by, for example, by chemical or structural modification, transcription regulation or post-translational modification/regulation.
  • An allele associated with a quantitative trait may comprise alternative or variant forms of various genetic units including those that are identical or associated with a single gene or multiple genes or their products or even a gene disrupting or controlled by a genetic factor contributing to the phenotype represented by said QTL.
  • progeny' refers to the descendant(s) of a particular cross. Typically, progeny result from breeding of two individuals, although some species can be selfed (i.e., the same plant acts as the donor of both male and female gametes).
  • the descendant(s) can be, for example, of the Fl, the F2, or any subsequent generation.
  • the terms 'introgression', 'introgressed' and 'introgressing' refer to the process whereby genetic determinants or elements or factors such as genes, a QTL or haplotype of one species, variety or cultivar are transferred into the genome of another species, variety or cultivar, by crossing those species.
  • the crossing may be natural or artificial.
  • the process may optionally be completed by backcrossing to the recurrent parent, in which case introgression refers to infiltration of the genes of one species into the gene pool of another through repeated backcrossing of an interspecific hybrid with one of its parents.
  • An introgression may also be described as a heterologous genetic material stably integrated in the genome of a recipient plant.
  • 'polymorphism' is understood within the scope of the invention to refer to the presence in a population of two or more different forms of a gene, genetic marker, or inherited trait or a gene product obtainable, for example, through alternative splicing, DNA methylation, etc.
  • the term 'second plant' or 'reference plant' or 'normal maize plant' or 'normal plant' used herein refers to a plant or more specifically to a corn plant i.e. of the species Z. mays having the phenotypic characteristic of about 5 to about 6.6 leaves above the ear, preferably, about 6 leaves above the ear.
  • Such a normal maize plant is genotypically characterized by a homozygous ELE2/ELE2 genotype configuration.
  • a normal maize plant lacks the ELE1 genetic factor conferring additional leaves above the ear.
  • the genome of such a second or reference plant lacks at least one of the molecular markers of the maize plant of the present invention. Thus it comprises less molecular markers or it is absent of the unique molecular markers, which co-segregate with additional LAE architecture associated with high yield properties phenotype.
  • a normal maize plant may be used as a recurrent parental line in a breeding scheme.
  • the plant to be tested is crossed with a 'normal' plant of similar genetic constitution and the segregation ratio of the trait in the progeny of the cross is scored.
  • phenotypic characteristics such as number of leaves above the ear (LAE), yield, plant height, ear height, ear weight and stress tolerance are compared between the maize plants having the novel ELE1 genetic factor and normal maize plants having similar genetic constitution and lacking the ELE1 genetic determinant.
  • the terms 'increased yield' or 'high yield' or ' yield components' used herein refer to genetically enhanced lines or cultivars of crops such as maize that have an increased crop production or increased percentage of usable plant parts, preferably maize kernels or grains. It is within the scope of the invention that the yield produced by a maize plant may include components or parameters such as kernel weight, number of kernels per ear, number of ears per plant, ear weight, ear height, plant height, ear height to plant height ratio, dry weight yield or biomass, relative silking, grain yield, earliness and any combination thereof.
  • the plants provided by the present invention are characterized by increased yield, increased dry weight yield, and yield components which is herein surprisingly shown to be correlated with the additional two or three leaves above the ear phenotype conferred by the novel ELE1 genetic determinant.
  • dry weight yield refers hereinafter to the plant's measured dry weight or biomass. It is herein acknowledged that since plants have a high composition of water and the level of water in a plant depends on the amount of water in its environment (which is variable and might be difficult to control), using dry weight as a measure of plant growth and yield is important and reliable.
  • the maize plants comprising the ELE1 genetic determinant conferring additional leaves above the ear can produce an increased yield of up to 40% as compared to the yield of a normal maize plant of similar genetic constitution, lacking said genetic determinant.
  • the maize plants comprising the ELE1 genetic determinant conferring additional leaves above the ear are possibly characterized by an improved root system, particularly having an extensive and early developed root system, as compared to a normal maize plant, lacking said genetic determinant.
  • the unique ELE genetic system is possibly correlated with the production of a more efficient and extended root system in the ELE1 maize than in the normal maize lacking the ELE1 factor.
  • Such an extended developed root system brings water and nutrients more easily to the stalk and the leaves and as a result the maize plant barring such a root system is more resistant to stress.
  • the term 'nicking' as used herein generally refers to floral synchronization. More specifically, it refers to the synchronization between pollen shed (anthesis) and silk emergence. Under Favorable conditions, silks emerge 1-3 days after anthesis and remain fertile for about 1 week before senescing. Stress conditions such as water stress, often result in a loss of nick; thus when silks emerged, there is no pollen source, thus barren plants or ears with fewer kernels per ear are produced. Poor 'nicking' (lack of synchrony of anthesis and silk emergence) is largely a result of delayed silk emergence. According to some embodiments the maize plants of the present invention, exhibiting additional LAE architecture co-segregating with unique molecular markers exhibit improved yield and tolerance to stress characteristics such as nicking between pollen shed and silk emergence.
  • normal plant density refers to maize planting density of about 50,000 plants per hectare (ha). It is herein acknowledged that the optimum density at harvest for a variety is that which yields the most grain when the crop is grown under non-limiting conditions.
  • 'low plant density' refers to maize planting density of about 25,000 plants per hectare.
  • the term 'population' means a genetically homogeneous or heterogeneous collection of plants sharing a common genetic derivation.
  • the term 'variety' or 'cultivar' means a group of similar plants that by structural features and performance can be identified from other varieties within the same species.
  • the term 'variety' as used herein has identical meaning to the corresponding definition in the International Convention for the Protection of New Varieties of Plants (UPOV treaty), of Dec. 2, 1961, as Revised at Geneva on Nov. 10, 1972, on Oct. 23, 1978, and on Mar. 19, 1991.
  • a 'cultivated maize' plant is understood within the scope of the invention to refer to a plant that is no longer in the natural state but has been developed by human care and for human use and/or consumption.
  • breeding refers to any process that generates a progeny individual. Breeding can be sexual or asexual, or any combination thereof. Exemplary non-limiting types of breeding include crossing, selfing, doubled haploid derivative generation, and combinations thereof.
  • 'Backcrossing' is understood within the scope of the invention to refer to a process in which a hybrid progeny is repeatedly crossed back to one of the parents. Different recurrent parents may be used in subsequent backcrosses.
  • 'Processed maize plant' or product is understood within the scope of the invention to refer to maize kernels that are processed into for example (1) canning, and/or (2) concentrated products such as puree, sauce and paste or any other grain-based foods or beverages or processed corn/maize product. Furthermore, the maize plants of the present invention may be used for preparation of animal feed and/or silage.
  • sequence identity or 'sequence homology' used herein refers to corresponding two or more nucleic acid or protein sequences, that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the available sequence comparison algorithms or by visual inspection. If two sequences, which are to be compared with each other, differ in length, sequence identity preferably relates to the percentage of the nucleotide residues of the shorter sequence, which are identical with the nucleotide residues of the longer sequence.
  • the percent of identity or homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of identity percent between two sequences can be accomplished using a mathematical algorithm as known in the relevant art.
  • the aforementioned terms refer to variants, homologues and fragments of the indicated nucleotide sequence which possess or perform the same biological function or correlates with the same phenotypic characteristic of the indicated nucleotide sequence.
  • such substantially identical sequences refer to polynucleotide or amino acid sequences that share at least about 80% similarity, preferably at least about 90% similarity, alternatively, about 95%, 96%, 97%, 98% or 99%) similarity to the indicated polynucleotide or amino acid sequences.
  • 'homology' refers to a DNA or amino acid sequence having a degree of sequence similarity in terms of shared amino acid or nucleotide sequences. There may be partial similarity or complete similarity (i.e., identity).
  • amino acid similarity matrices may be used as are known in different bioinformatics programs (e.g. BLAST, FASTA, Bestfit program- Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711, Smith Waterman). Different results may be obtained when performing a particular search with a different matrix.
  • the phrase 'genetic marker' or 'molecular marker' or 'DNA marker' or 'biomarker' refers to a feature in an individual's genome e.g., a nucleotide or a polynucleotide sequence that is associated with one or more loci or trait or QTL of interest.
  • a genetic marker is polymorphic in a population of interest, or the locus occupied by the polymorphism, depending on context.
  • Genetic markers or molecular markers include, for example, single nucleotide polymorphisms (SNPs), DNA tags, indels (i.e., insertions/deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs) or combinations thereof, among many other examples such as the DNA sequence per se. Genetic markers can, for example, be used to locate genetic loci containing alleles on a chromosome or a QTL that contribute to variability of phenotypic traits.
  • the phrase 'genetic marker' or 'molecular marker' or 'biomarker' can also refer to a polynucleotide sequence complementary or corresponding to a genomic sequence, such as a sequence of a nucleic acid or a polynucleotide used as a probe or primer.
  • the present invention provides a set of novel and unique molecular markers co- segregating with additional LAE phenotype, wherein the molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9 and any combination thereof
  • a genetic marker can be physically located in a position on a chromosome that is within or outside of the genetic locus with which it is associated (i.e. is intragenic or extragenic, respectively).
  • the one or more genetic markers comprise a combination of two or more genetic markers. It is also within the scope of the present invention that different combinations of genetic markers are used to identify different traits or phenotypic characteristics as disclosed inter alia.
  • the term 'co-segregating' or 'co-segregates' is understood within the scope of the invention as referring to the tendency of genes, traits and/ or genetic markers to segregate or to be inherited together. Two or more genes, gene alleles or genetic markers that are linked on the same chromosome are transmitted to the same daughter cell leading to the inheritance by the offspring of these genes or alleles together.
  • the term “co-segregation” refers to the fact that the present invention discloses for the first time molecular markers (i.e. at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9) linked to the additional LAE trait that is shown to be associated with high yield in maize.
  • molecular markers i.e. at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9
  • additional LAE trait that is shown to be associated with high yield in maize.
  • Co-segregation also refers to the presence of two or more traits, genetic markers or combinations thereof, within a single plant of which at least one is known to be genetic and which cannot be readily explained by chance.
  • novel genetic markers are herein identified to co segregate with the additional leaves above the ear trait.
  • 'genetic determinant introgression' refers to the incorporation of new genetic determinants or elements such as genes, alleles, QTLs or traits, into a line wherein essentially all of the desired morphological and physiological characteristics of the line are recovered, in addition to the genetically introgressed determinant.
  • Such a process is often used in cultivar development, in which one or a few genetic determinants are transferred to a desired genetic background, preferably by using backcrossing.
  • plant cell culture' or 'tissue culture' as used herein means cultures of plant units such as, for example, protoplasts, regenerable cells, cell culture, cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development, leaves, roots, root tips, anthers, meristematic cells, microspores, flowers, cotyledons, pistil, fruit, seeds, seed coat or any combination thereof.
  • plant material' or 'plant part' used herein refers to leaves, stems, roots, root tips, flowers or flower parts, kernels, stalk, cob, grain, ear, pollen, egg cells, zygotes, seeds, seed coat, cuttings, cell or tissue cultures, or any other part or product of a plant or a combination thereof.
  • an increased number of leaves above the ear is a desirable trait in maize breeding as it increases leaf area at the period just before flowering until physiological maturity, to enable better adjustment of sink size to source activity and better realization of the potential yield by increasing the proportion of the spiklets filled.
  • the increased leaf area in the region where photosynthesis is progressing in the most rapid rate, during grain filling improves metabolites availability to the grains being filled and therefore may increase grain weight.
  • the present invention provides a novel and unique genetic system (ELE) capable of adding leaves above the ear, preferably 2-3 leaves above the ear in maize.
  • the donor or source of this genetic system may be of tropical background.
  • the ELE genetic system is preferably controlled by a single major gene without dominance, with an additional effect of minor or modifier genes.
  • a breeding scheme performed in the tropics, with several F2 populations segregating for the number of leaves above the ear has shown an increase in yield and yield components, particularly kernel weight, which was correlated with the increased number of leaves above the ear from about 6 to about 8.
  • a breeding program was initiated in Israel aimed to transfer the genetic system into maize adapted to temperate climate.
  • Publicly available inbred lines developed in the U.S with particular emphasis on the two well known inbred lines B73 and Mo 17 were used as a source of germplasm adapted to the temperate climate.
  • the U.S lines were crossed with the ELE genetic material and the Fl plants were advanced to F2.
  • ELE lines were developed by direct self pollination of the F2 plants or by one or two cycles of back crossing followed by self pollination.
  • GCA and SCA General and specific combining ability
  • Experimental hybrids were produced by crossing selected ELE lines from the two heterotic groups or by test crossing the ELE lines with normal maize plants, i.e. B73 and Mol7.
  • the experimental hybrids were tested with and compared with B73xMol7 hybrids and two commercial recommended hybrids as controls.
  • Several experimental hybrids with significantly higher yields than the controls were surprisingly identified in several trials (see examples below).
  • more than 1000 hybrid lines comprising the ELE1 genetic factor are produced having improved agricultural characteristics such as increased yiels, lodging resistance, adaptation to higher density of planting, enhanced earliness, improved root system, improved stress tolerance, for example to stress types including parasites, pests and draught, and combinations thereof.
  • LAE yield potential of maize
  • An increased number of LAE controlled by the ELE gene is herein shown to significantly improve yield potential in maize by increasing the photosynthetic active leaf area during the period from just before flowering to physiological maturity.
  • both the average kernel weight and the number of kernels per ear are being increased at normal planting density of the plants of the present invention. At a lower planting density, also the average number of ears per plant is increased.
  • LAE can also improve stress tolerance in maize
  • examples of stress types may include tolerance to parasites such as striga, pests, draught and combinations thereof.
  • the ELE j genetic factor can be transmitted by conventional breeding techniques and by different types of genetic engineering methods, to all types of maize in all possible environments.
  • the present invention provides a method to increase the number of leaves and leaf area above the ear, in the region where photosynthesis is progressing in the most rapid rate during grain filling. Such a method is further adapted to improve metabolities availability to the grains being filled and consequently to increase yield potential.
  • one of the objects of this invention is to significantly increase the yield per hectare of maize through a change in plant architecture by adding more leaves above the ear.
  • FIG. 1 A illustrates normal maize preferably characterized by ELE2/ELE2 genetic configuration.
  • Fig. IB illustrates a maize plant comprising the ELEI genetic determinant, preferably having ELE1 /ELE1 genetic configuration.
  • the maize plant of Fig. IB comprising the ELEI genetic determinant exhibits additional 2 to 3 leaves above the ear (Fig. IB, 1) as compared to the normal maize plant (Fig. 1A).
  • the plant with the additional LAE exhibits more cobs (Fig. IB, 2) and/or larger cobs (Fig. IB, 3), preferably having more kernels per cob and/or larger kernel weight (Fig. IB, 2 and 3), as compared to the normal maize plant (Fig. 1 A).
  • Fig. 2 presenting a photographic illustration of stress tolerance of maize plants comprising the ELEI genetic factor as compared to normal control maize plants.
  • the maize plants comprising the ELEl genetic determinant 10 exhibit improved tolerance to striga hermonthica parasite stress, as compared to normal maize plants 20 lacking the ELEl factor.
  • the maize plants comprising the ELEl genetic determinant 10 are more viable than the normal plants 20; they produce additional leaves and thus are higher than the normal plants 20.
  • the present invention provides a maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein the architecture is controlled by a genetic determinant which shows a non dominant inheritance.
  • LAE additional leaves above the ear
  • a molecular marker profile selected from the group consisting of: (a) at least one molecular marker as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (b) at least two molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (c) at least three molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (d) at least four molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; (e) at least five molecular markers selected from:
  • the plant has a higher yield relative to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has a molecular marker profile defined by the equation 3 ⁇ 4 ; Zft- ⁇ ), where M is the total number of molecular markers, the molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, is the presence of molecular marker / in maize plant j, and . is the number of molecular markers in the plant j.
  • LAE additional leaves above the ear
  • LAE additional leaves above the ear
  • the genome of the plant comprises at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, the at least one molecular marker is associated with increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • the at least one molecular marker is co-segregating with improved stress tolerance, particularly with improved characteristic selected from the group consisting of: nicking between pollen shed and silk emergence, "Stay Green” characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, increased dry weight yield, adaptation to higher density planting, and any combination thereof.
  • pant exhibits an improved stress tolerance, particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green” characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • an improved stress tolerance particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green” characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • pant exhibits an increased tolerance to striga, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant. It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the tolerance to striga is calculated as the ratio of yield under striga infested and non infested conditions ⁇ striga tolerance Index).
  • LAE additional leaves above the ear
  • kernels as defined above which are processed kernels.
  • tissue culture of regenerable cells of a maize plant as defined in any of the above.
  • tissue culture comprising cells or protoplasts from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruit and seeds.
  • tissue culture of regenerable cells as defined in any of the above, wherein the tissue regenerates plants exhibiting an additional leaves above the ear (LAE) architecture, the architecture is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
  • a hybrid maize plant comprising a co- dominant genetic allele ELE1, wherein the allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE).
  • a hybrid maize plant characterized by an ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729, the QTL confers additional leaves above the ear (LAE) phenotype, the genetic determinant is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, and is being capable of transmission to progeny plants substantially as a single non-dominant gene.
  • a method for producing seed maize with additional leaves above the ear (LAE) architecture comprising the steps of: pollinating a first maize plant with pollen of a second maize plant, wherein at least one of the maize plants possess within its genome at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 co-segregating with additional leaves above the ear (LAE) architecture, and harvesting seeds produced by the pollinated maize plant.
  • LAE additional leaves above the ear
  • a method of producing a maize plant exhibiting an additional leaves above the ear (LAE) architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, comprising the steps of (a) selecting a donor maize plant with additional LAE architecture, and a recipient maize plant with a normal LAE architecture; (b) crossing the donor plant with the recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype; (c) screening for and selecting from the progeny plants at least one plant exhibiting an additional leaves above the ear architecture, which is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; and (d) optionally, harvesting the resultant
  • the method as defined in any of the above comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant, the increased yield characteristic is associated with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 9.
  • a method for producing hybrid maize seed exhibiting an additional leaves above the ear (LAE) architecture comprising steps of crossing first and second maize plants, wherein at least one of the maize plants is characterized by the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 which is co-segregating with additional leaves above the ear (LAE) phenotype, the at least one molecular marker shows co dominant inheritance.
  • nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, wherein the isolated nucleotide sequence is co-segregating with additional leaves above the ear (LAE) architecture.
  • the increased yield properties are selected from the group consisting of: increased plant height without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, increased dry weight yield, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
  • inbred maize seed characterized by additional LAE architecture which is co-segregating with a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, the method comprising inbreeding a maize plant which is characterized by the at least one molecular marker, until the genetic composition of the progeny of such inbreeding becomes substantially stable.
  • first maize plant that is a hybrid maize plant comprising a co-dominant genetic allele ELE1, wherein the allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE) with a second maize plant used as a recurrent parent to yield first progeny seeds; (b) growing the first progeny seed under suitable plant growth conditions to yield an Fl maize plant of the first hybrid plant, the Fl maize plant comprises the co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of
  • the present invention further provides a method for producing seed maize with additional leaves above the ear (LAE) architecture.
  • the aforementioned method comprising the steps of: pollinating a first maize plant with pollen of a second maize plant, wherein at least one of the maize plants possess a non dominant genetic determinant controlling additional LAE architecture, and harvesting seeds produced by the pollinated maize plant. More particularly, a cross between maize plant of Tropical origin and a normal maize plant from the U.S Corn Belt origin produced a progeny segregant plant with additional leaves above the ear. The additional leaves above the ear were found to be correlated with a genetic factor designated as ELEi .
  • the ELEi genetic factor act substantially as a non-dominant allele that can add not more than five leaves, preferably two to four leaves and more preferably two to three leaves above the ear (LAE) in homozygous ELEi /ELEi or heterozygous ELE1 /ELE2 state as compared with a normal ELE2/ELE2 homozygous genotype of otherwise similar genetic constitution.
  • the ELEi allele can be transferred between strains of maize by conventional breeding techniques or other (e.g genetic engineering).
  • the resulting derived inbred and/or hybrid strains are characterized by additional leaves above the ear without a noticeable effect on the number of leaves below the ear (see Fig. IB).
  • incorporation of the ELEi genetic factor into existing hybrids of maize is herein shown to improve the yield significantly by up to about 40 percent when compared to the yield of genetically similar normal ELE2 hybrids.
  • the ELEi allele is not allelic to the ELEi allele
  • the ELEi allele is non-dominant while the Lfy allele is dominant over the lfy of the normal maize. It behaves also differently by being a non-dominant allele compared to the dominant nature of the Lfy gene, its effect is limited to the addition of not more than 5 leaves above the ear and more preferably 2-3 leaves above the ear as compared to the addition of higher number of leaves by the Lfy gene (up to 18 LAE by the Lfy). Similarly its effect on the increased number of days required to reach first silk and pollen (anthesis) is also smaller compared with the effect of the Lfy gene.
  • the ELEi allele is superior over the Lfy gene by the ability to confer increased tolerance to stress such as striga infestation and drought, improved lodging resistance, adaptation to higher density planting and earliness as inter alia demonstrated. It is further within the scope of the present invention that the number of leaves above the ear in an ELE1 /ELE1 genotype depends on the genetic background of the normal inbred line used at the cross. For example, the number of leaves above the ear may be affected by modifier (minor) genes.
  • the number of leaves above the ear may also depends on the environmental conditions, wherein it is being reduced under stress caused, for example, by Striga hermonthica (a parasitic plant) or it is being increased when the same inbred line is growing under cooler conditions with a longer period from planting to silking.
  • Striga hermonthica a parasitic plant
  • the ELE j genetic factor of the present invention can be introduced to new elite maize lines by crossing them with the homozygous ELEJ/ELET genotype.
  • the resulting F.sub. l progeny plants have a phenotype with an intermediate number of leaves above the ear relative to the two parents.
  • the F.sub. l progeny may be selfed through a number of generations, i.e. 5 generations, or whatever number of generations is necessary or desirable or achieve stable homozygosity.
  • the F.sub. l plants may be selfed to develop F.sub.2 segregating population. Segregated plants with the higher number of leaves above the ear and other desirable characteristics are being backcrossed with a normal elite ELE2/ELE2 line to produce the BC.sub. l generation.
  • plants of the BC.sub. l may be selfed and selected desirable progeny plants are backcrossed again to the same elite normal line.
  • the same procedure may optionally, continue several times, i.e. 5 cycles, which subsequently may convert the known elite inbred to have the ELE1 /ELE1 genotype.
  • a combination of both approaches is also possible wherein backcrossing for several generations is followed by several generations of selfing, until homozygosity is being achieved.
  • backcrossing for several generations is followed by several generations of selfing, until homozygosity is being achieved.
  • the advantage of the combined approach is that it takes shorter time to develop ELEJ/ELET inbred lines however the genome of the elite normal lines is not fully recovered.
  • the method of the present invention can be used to add leaves above the ear of all subspecies of maize, specifically including the dent or semi-dent maize, the flint or semi-flint maize, the soft or flower maize, the sweet corns and the pop corns.
  • the method of the present invention may be used to produce elite hybrid maize (seeds and plants) for commercial maize production.
  • Such hybrid is typically a result of a single cross that is a first generation hybrid between two inbred lines.
  • it is also applicable to other types of hybrids such as modified single cross, three-way hybrids, four-way hybrids, top-cross hybrids (a cross between a variety and a line) and varietal cross hybrids.
  • open pollinated varieties homozygous for the ELEi allele can also be developed by the teachings of the present invention.
  • the present invention provides two types of hybrids, wherein the ELE gene is either homozygous ELEi /ELEi or heterozygous ELE1 /ELE2.
  • the first type may be obtained by crossing two homozygous ELE1 /ELE1 parents.
  • the second type may be obtained by crossing ELE1 /ELE1 parent with another parent which is ELE2/ELE2.
  • the first type may usually have higher number of leaves above the ear than the second type.
  • the incorporation of the ELEi genetic factor into existing strains of maize increases the number of leaves above the ear. Consequently it may improve yield by up to 40 percent as compared with the yield of normal maize of similar genetic constitution, but with lower number of leaves above the ear.
  • the yield increase is mainly due to higher kernel's weight and to a lesser extant by higher number of kernels per ear.
  • the average number of ears per plant is also increased.
  • the present invention provides a maize field comprising maize plants as described above.
  • the aforementioned genomes can be obtained from said deposited material but can also be obtained from other material.
  • the sequence of the genes obtained from other material may vary from the sequence of the gene in the deposited material ("variant").
  • Deposit Number NCIMB 42074 or a genetic variant thereof, which refers essentially to the same phenotype are available. It is submitted that the seeds deposited under the Budapest treaty and having Deposit Number NCIMB 42074 are a representative example of seeds comprising within its genome at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, which co-segregates with additional LAE phenotype. Seeds of maize plants similar to the above, further comprising at least one additional trait selected from the group consisting of high germination rate, herbicide resistance and insect resistance, are obtainable with regard to a deposit made under the Budapest treaty regulations.
  • Seed samples were deposited on 22 October 2012 with NCFMB, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21, 9YA, Scotland, UK under the provisions of the Budapest Treaty.
  • the seed samples include accession number 42074 as designated above.
  • Table 1 The effect of planting season on the mean number of days to silking and the mean number of leaves above the ear (LAE)
  • Example 2 The effect of Striga hermonthica stress on the average number of leaves above the ear (LAE)
  • Striga hermonthica is a parasitic plant causing leaf dryness in maize plants.
  • the effect of stress caused by the parasite was studied in F.sub.2 segregating population of a cross between ELE1 /ELE1 line (i.e. lines 11-111 and VIGOR B) and normal ELE2/ELE2 lines planted at the same time under Striga infested and non-infested field conditions. It was found that as a result of the stress, the average number of LAE was reduced from 7.63 to 6.86 and the frequency distribution was shifted towards the lower number of leaves above the ear (Table 2).
  • LAE Number of leaves above the ear.
  • Example 3 The effect of ELEl genetic factor on the number of leaves below and above the ear
  • ELEi /ELEi line i.e. lines 11-111 and VIGOR B
  • five normal ELE2/ELE2 lines i.e. lines 11-111 and VIGOR B
  • the five heterozygous ELE1/ELE2 hybrids were compared with five hybrids of crosses between the normal ELE2/ELE2 lines. It was shown that the mean numbers of leaves below the ear were similar in the two groups, indicating that the ELEi genetic factor does not affect the number of leaves below the ear. However it was surprisingly shown that the mean number of leaves above the ear (LAE) was increased in the heterozygous ELE1/ELE2 hybrids relative to the ELE2/ELE2 normal hybrid lines i.e. from 6.4 to 7.6
  • ELE1 /ELE1 line i.e. lines 11-111 and VIGOR B was crossed with five normal ELE2/ELE2 lines having different number of leaves above the ear ranging from 5.0 to 6.6.
  • the results obtained demonstrate that in all progeny lines carrying the ELEi allele (i.e. ELE1/ELE2 and ELEJ/ELET ), the number of leaves above the ear was increased by one to three leaves.
  • the average number of leaves above the ear in the F.sub. l, F.sub.2 and the two backcrosses populations was shown to be associated with the number of leaves above the ear of the normal parental lines (Table 4). This indicates that the differences between the normal lines are affected by modifiers (minor) genes.
  • Table 4 Average number of leaves above the ear in progeny of crosses between ELEJ ELEJ line and five normal ELE2/ELE2 lines
  • BC-N backcross of Fl plants to the normal line (4-11, 1-105, 6-133, 8-21 and 3-57)
  • BC-11-111 backcross of Fl plants to ELEl/ELEl line 11-111
  • Table 5 Segregation of leaves number above the ear and fitness of the adjusted data to a 1:2:1 ratio
  • LAE Leaves above the ear
  • Example 6 The ELE gene is not allelic to the Lfy gene
  • Example 7 The effect of increased number of leaves above the ear on plant and ear heights and number of days from planting to pollen shed and silking
  • LAE Leaves above the ear
  • Example 8 The effect of number of leaves above the ear on yield components
  • Table 8 The effect of number of leaves above the ear (LAE) on yield and yield component in F.sub.2 segregating populations
  • Example 8 A similar approach as described in Example 8 herein above was taken to test the effect of additional leaves above the ear under stress caused by Striga hermonthica.
  • the same F.sub.2 populations as described above were planted in striga infested and non-infested fields. It was revealed that the stress caused by striga reduced the average yield per plant (Table 9). However, the relative yield increase of plants having 6 LAE to plants having 9 LAE was higher under the stress caused by striga. As a result, it is herein clearly shown that the striga tolerance index calculated as the ratio of yield under striga infested and non-infested conditions was increased with the increased number of leaves above the ears. This result indicates that the addition of leaves above the ear, herein shown to be associated with the ELE1 genetic allele, significantly improves stress tolerance of maize plants.
  • Str. Tol. Index Yield under striga infested divided by the yield under striga
  • T/ha Grain yield (T/ha), number of leaves above the ear (LAE) and relative silking of 12 experimental ELE hybrids and 3 control hybrids
  • LAE The leaves No. above the ear (LAE) is ranging between 5-6 LAE in diverse maize line sources. In VIGOR B line crosses the LAE is ranging from 7-9 leaves.
  • Example 11 Genetic markers This example describes the genetic analysis performed in order to discover novel genetic markers associated with the extra leaves above the ear (LAE) phenotype.
  • the project was designed to meet that challenges by using NRGENE's GenoMAGICTM algorithm package.
  • Genotype by sequencing (GBS) data of 100 F2 segregating population derived from a cross between B73 and ELE line was produced and analyzed using GenoMAGICTM platform.
  • Genotype x phenotype (LAE) association analysis was done and the analysis results are reported herein.
  • QTLs Quantitative trait loci
  • DNA tag is herein defined as a short DNA sequence (up to about 100 bp), such as a sequence surrounding a single base-pair change.
  • DNA marker set herein refers to a set of DNA tag information that all together represents the uniqueness of the favorable donor line allele vs. other alleles in the evaluated population.
  • Phenotypic data of leaves No. above the ear (LAE) was recorded for each analyzed plant.
  • GBS analysis The F2 individuals and the parental line (ELE line) were genotyped by sequencing (GBS) in average coverage of 0.2x and lx, respectively.
  • the phenotype data and GBS analysis results were processed and analyzed using NRGENE's GenoMAGICTM platform for QTL analysis.
  • QTL1 One major QTL (QTL1) was found on the end of chromosome 6:
  • chromosome-6 between 163,304,486 to 169, 147,729.
  • Table 11 Location and sequence of the 9 segregating tags Tag Location
  • the present invention provides novel and unique molecular markers co-segregating with extra LAE trait.
  • These genetic biomarkers include DNA tag markers identifying extra LAE phenotype surprisingly associated with high yield properties in maize such as increased grain yield, increased kernel weight, increased ear weight, enhanced plant height, improved relative silking time, and striga tolerance as compared to control normal maize line lacking the genetic markers co-segregating with extra LAE trait associated with the ELE1 QTL. Therefore, the markers of Table 11 are useful in detecting high yield maize plants, which exhibit extra LEA phenotype, and screening out low yield plants.
  • Example 12 Grain and silage maize trials
  • Crop Maize for grain and silage
  • Rows 4 rows
  • Grain trial Average grain yield of ELE hybrid: between about 10 ton/hectare and about 20 ton/hectare. More specifically,
  • Average silage yield of ELE hybrid between about 15 ton/hectare and about 30 ton/hectare. More specifically,
  • the tested ELE hybrid comprising within it's genome the genetic markers associated with additional LAE phenotype, has significantly increased grain and/or silage yield by about 5% to about 20%, relative to a reference commercial hybrid lacking the ELE trait.

Abstract

The present invention discloses a maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein the architecture co-segregates with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO:1 to SEQ ID NO:9. The present invention further discloses means and methods for producing the aforementioned maize plant.

Description

MARKERS FOR HIGH YIELD IN MAIZE
BACKGROUND OF THE INVENTION
1) Field of the Invention
This invention relates generally to the production of maize, commonly known in the United States as corn and more specifically concerns the development markers for high yield in maize.
2) Description of Prior Art
There is a real concern on how to feed the world's growing population on constantly decreasing areas of cultivated land.
The 'Green Revolution' in wheat and rice is a classical example of significant and dramatic yield increase achieved through a change in plant architecture. In contrast, the trend line for U.S. maize yield has increased only gradually and continually.
Maize is the most widely grown grain crop in the America. Commercial hybrid maize normally grows with 5-7 leaves above the ear placement (see Figure 1 A). The ear that produces the grains normally grows about one-third the way up the plant. The tassel that produces the pollen is found at the top of the plant. The pollen is carried by the wind to the female silk produced on the ear of nearby plants. Hence, maize is naturally cross-pollinated plant which provides a continuing source of variation in genetic constitution.
The focus of maize developments in the last decade was concentrated on producing transgenic genetically modified species with chemical herbicide Glyphosate (round-up) readiness and pest tolerance (e.g. Bt maize gene). However, it has performed nothing in terms of increasing yield.
The growing concern to environmental affects and food safety, recently highlighted by the opposition to the recently developed transgenic corn species, stresses the importance for achieving the higher yield target in a non-transgenic manner.
Maize yield is largely depends on the availability of metabolites produced by the photosynthetic activity of the leaves during grain filling. The photosynthesis during grain filling progressing at the most rapid rate in the leaves is found in the area above the ear.
A number of patents relate to the application of genetic principles to the improvement of maize plants. For example, U.S. Pat. Nos. 2,753,663; 3,594,152 and 3,710,511; each of which concerns the manipulation of genetic male sterility, in the production of hybrid maize seeds. U.S. Pat. No. 4,368,592 relates to the reduction of height of the maize plant by a genetic dominant semi-dwarf allele. U.S. Pat. No. 4,513,532 issued to the Lfy gene relates to a single, dominant genetic factor capable of altering leaf number and distribution in maize. However this dominant Lfy allele causes to the addition of up to 18 leaves above the ear (LAE), and thus rendering the plant unstable and easily tending to fold and droop.
Accordingly, there is an unmet and a long felt need to provide means and methods for producing maize with an increased yield potential.
SUMMARY OF THE INVENTION
It is therefore one object of the present invention to provide a maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein the architecture co- segregates with a molecular marker having a nucleotide sequence corresponding to a nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO: 9 and any combination thereof.
It is a further object of the present invention to provide the maize plant as defined above, wherein the architecture co-segregates with a molecular marker profile selected from the group consisting of: (a) at least one molecular marker as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (b) at least two molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (c) at least three molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (d) at least four molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (e) at least five molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (f) at least six molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; (g) at least seven molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (h) at least eight molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; and (i) nine molecular markers having a nucleotide sequence corresponding to the nucleotide sequences consisting of SEQ ID NO: l to SEQ ID NO:9; and any combination thereof; further wherein the plant has a higher yield relative to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has a molecular marker profile defined by the equation NH i = EfLj iJijQ"), where M is the total number of molecular markers, the molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, ?«;( ) is the presence of molecular marker / in maize plant j, and ¾t is the number of molecular markers in the plant j.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the yield rank of the plant j relative to a second reference maize plant i is defined by the equation
J?Cj) =∑!=.< (¾;, > where S is the total number of maize plants compared, and R(j) is the yield rank of the plant j relative to the second reference maize plant i.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the architecture is associated with the ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant architecture is characterized by additional two or three or four leaves above the ear.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant architecture is characterized by up to four additional leaves above the ear. It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant architecture is characterized by less than five additional leaves above the ear.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant is a hybrid.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genome of the plant comprises a homozygous configuration of the at least one molecular marker.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genome of the plant comprises a heterozygous configuration of the at least one molecular marker.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the at least one molecular marker is independently segregated from Lfy genetic factor.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the additional LAE architecture is controlled by a genetic determinant which shows a non-recessive inheritance and is co-segregating with the at least one of the molecular marker.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genetic determinant is in a heterozygous configuration.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the heterozygous configuration of the genetic determinant confers at least one heterotic phenotypic effect with respect to high yield in maize.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genetic determinant shows incomplete dominant inheritance with respect to the additional LAE phenotype.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genetic determinant is characterized by the presence of at least one ELE1 allele, co-segregating with the at least one molecular marker.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant is heterozygous for the ELE1 allele. It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant is homozygous for the ELE1 allele.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genome of the plant is characterized by the presence of at least one ELE1 allele is co-segregating with the at least one molecular marker and at least one ELE2 allele lacking the at least one molecular marker.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by additional leaves above the ear (LAE) architecture in homozygous ELE1/ELE1 genotype configuration as compared with a homozygous ELE2/ELE2 genotype configuration of a normal maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by additional leaves above the ear (LAE) architecture in heterozygous ELE1/ELE2 genotype configuration as compared with a homozygous ELE2/ELE2 genotype of normal maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the genome of the plant comprises at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, the at least one molecular marker is associated with increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased yield of up to 40% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased yield of between about 5% and about 20% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased yield of about 30% and more, greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has grain yield of at least 10 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has grain yield of about 15 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has grain yield of between about 10 ton/hectare and about 20 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has grain yield of about 20 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has silage yield of at least 15 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has silage yield of about 20 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has silage yield of between about 15 ton/hectare and about 30 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has silage yield of about 30 ton/hectare.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased plant height without significant effect on ear height.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased average kernel weight and an increased number of kernels per ear at normal planting density, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has an increased average kernel weight at a normal planting density, as compared to the average kernel weight of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant has an increased number of kernels per ear at a normal planting density, as compared to the number of kernels per ear of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein at a low planting density the plant further exhibits an increased average number of ears per plant as compared to the number of ears per plant of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the at least one molecular marker is co-segregating with improved stress tolerance, particularly with improved characteristic selected from the group consisting of: nicking between pollen shed and silk emergence, "Stay Green" characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, increased dry weight yield, adaptation to higher density planting, and any combination thereof.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the pant exhibits an improved stress tolerance, particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green" characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the pant exhibits an increased tolerance to striga, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant. It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the tolerance to striga is calculated as the ratio of yield under striga infested and non infested conditions {striga tolerance Index).
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the additional LAE architecture is obtainable from maize line VIGOR B, deposited with NCEVIB under accession number 42074, the LAE architecture is co-segregating with the at least one molecular marker.
It is a further object of the present invention to provide the maize plant as defined in any of the above, which can be obtained from a donor plant comprising the ELE QTL conferring a phenotype with additional leaves above the ear (LAE), particularly maize line VIGOR B, deposited with NCEVIB under accession number 42074, through introgression of the ELE QTL or part thereof into a recipient plant lacking the QTL or part thereof such that the introgressed plant exhibits additional LAE architecture phenotype.
It is a further object of the present invention to provide seed of a plant as defined in any of the above.
It is a further object of the present invention to provide plant material obtainable from a plant as defined in any of the above.
It is a further object of the present invention to provide plant parts of a plant as defined in any of the above.
It is a further object of the present invention to provide maize kernels of a plant as defined in any of the above.
It is a further object of the present invention to provide maize kernels as defined above which are processed kernels.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant is an inbred, a dihaploid or a hybrid.
It is a further object of the present invention to provide pollen of the maize plant as defined in any of the above.
It is a further object of the present invention to provide an ovule of the plant as defined in any of the above. It is a further object of the present invention to provide the maize plant as defined in any of the above further comprising an additional trait selected from the group consisting of at least one type of disease resistance and at least one type of stress resistance and any combination thereof.
It is a further object of the present invention to provide the maize plant as defined in any of the above further comprising an additional trait introduced by genetic transformation.
It is a further object of the present invention to provide the maize plant or part thereof as defined in any of the above, wherein the plant or parts thereof have been transformed so that its genomic material contains one or more transgenes operably linked to one or more regulatory elements.
It is a further object of the present invention to provide a tissue culture of regenerable cells of a maize plant as defined in any of the above.
It is a further object of the present invention to provide a tissue culture as defined above, comprising cells or protoplasts from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruit and seeds.
It is a further object of the present invention to provide the tissue culture of regenerable cells as defined in any of the above, wherein the tissue regenerates plants exhibiting an additional leaves above the ear (LAE) architecture, the architecture is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
It is a further object of the present invention to provide a maize plant regenerated from the tissue culture as defined in any of the above, wherein the plant exhibits an additional leaves above the ear (LAE) architecture, the architecture is controlled by a genetic determinant which shows a co-dominant inheritance and co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9.
It is a further object of the present invention to provide a hybrid maize plant comprising a co-dominant genetic allele ELE1, wherein the allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE). It is a further object of the present invention to provide a hybrid maize plant characterized by an ELE QTL located on chromosome 6 between position 163,304,486 and position 169, 147,729, the QTL confers additional leaves above the ear (LAE) phenotype, the genetic determinant is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9, and is being capable of transmission to progeny plants substantially as a single non-dominant gene.
It is a further object of the present invention to provide maize seed derived from the hybrid maize plant as defined above.
It is a further object of the present invention to provide the maize seed as defined above, wherein the maize plant is a female parent plant.
It is a further object of the present invention to provide the maize seed as defined in any of the above, wherein the maize plant is a male parent plant.
It is a further object of the present invention to provide the maize plant as defined in any of the above, wherein the plant exhibits an improved and more efficient root system as compared to the root system of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide a method for producing seed maize with additional leaves above the ear (LAE) architecture, the method comprising the steps of: pollinating a first maize plant with pollen of a second maize plant, wherein at least one of the maize plants possess within its genome at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 co-segregating with additional leaves above the ear (LAE) architecture, and harvesting seeds produced by the pollinated maize plant.
It is a further object of the present invention to provide the method as defined above, wherein at least one of the first or second maize plants possesses a homozygous configuration of the at least one molecular marker.
It is a further object of the present invention to provide the method as defined in any of the above, wherein at least one of the first or second maize plants possesses a heterozygous configuration of the at least one molecular marker. It is a further object of the present invention to provide a method of producing a maize plant exhibiting an additional leaves above the ear (LAE) architecture which is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, comprising the steps of (a) selecting a donor maize plant with additional LAE architecture, and a recipient maize plant with a normal LAE architecture; (b) crossing the donor plant with the recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype; (c) screening for and selecting from the progeny plants at least one plant exhibiting an additional leaves above the ear architecture, which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; and (d) optionally, harvesting the resultant progeny seed.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of up to 40% as compared to the yield of a maize plant of similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant, the increased yield characteristic is associated with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of up to 40% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of about 5% to about 20% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of about 30% and more, greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of at least 10 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of about 15 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of between about 10 ton/hectare and about 20 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of about 20 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting silage yield of at least 15 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting silage yield of about 20 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting silage yield of between about 15 ton/hectare and about 30 ton/hectare. It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting silage yield of about 30 ton/hectare.
It is a further object of the present invention to provide the method as defined in any of the above, comprising steps of crossing a donor plant, particularly maize line VIGOR B, deposited with NCEVIB under accession number 42074, with a recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype, and screening for and selecting from the progeny plants at least one plant exhibiting an additional leaves above the ear phenotype which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, and, optionally, harvesting the resultant progeny seed.
It is a further object of the present invention to provide a method for producing hybrid maize seed exhibiting an additional leaves above the ear (LAE) architecture, the method comprising steps of crossing first and second maize plants, wherein at least one of the maize plants is characterized by the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 which is co-segregating with additional leaves above the ear (LAE) phenotype, the at least one molecular marker shows co dominant inheritance.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of self-pollinating a maize plant possessing the at least one molecular marker through at least one generation until the at least one molecular marker is in a homozygous configuration, the at least one molecular marker is co-segregating with a phenotype with additional LAE which is transmittable to progeny as a co-dominant allele.
It is a further object of the present invention to provide the method as defined in any of the above, comprising additional steps of backcrossing a maize plant used as a recurrent parent with a second maize plant possessing the at least one molecular marker co- segregating with a phenotype with additional leaves above the ear which is transmissible to progeny as co-dominant allele. It is a further object of the present invention to provide the method as defined in any of the above, obtained by other means then conventional crossing, particularly different types of genetic engineering methods or any other technique.
It is a further object of the present invention to a method for screening for a maize plant exhibiting additional LAE architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9 comprising the steps of: screening the genome of a maize plant for the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; the at least one molecular marker co-segregates with additional LAE architecture.
It is a further object of the present invention to provide seed maize produced by the method as defined in any of the above.
It is a further object of the present invention to provide a maize plant produced by the method as defined in any of the above.
It is a further object of the present invention to provide an isolated nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, wherein the isolated nucleotide sequence is co-segregating with additional leaves above the ear (LAE) architecture.
It is a further object of the present invention to provide the isolated nucleotide sequence as defined above, wherein the additional LAE architecture is associated with increased yield properties as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further object of the present invention to the isolated nucleotide sequence as defined in any of the above, wherein the increased yield properties are selected from the group consisting of: increased plant height without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, increased dry weight yield, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant. It is a further object of the present invention to provide isolated oligonucleotide sequences annealing with the nucleotide sequence as defined in any of the above, wherein the sequences are suitable for the detection and production of maize plants having additional leaves above the ear (LAE) architecture.
It is a further object of the present invention to provide maize genetic markers, sequences or elements, plants, seeds and plant products as defined in any of the above, for the use in multiple geographical and/or weather-related environments (e.g. tropical, sub-tropic, temperate, etc).
It is a further object of the present invention to provide use of an isolated nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, for detection and production of maize plants having additional leaves above the ear (LAE) architecture.
It is a further object of the present invention to provide a method for producing inbred maize seed characterized by additional LAE architecture which is co-segregating with a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO: 9, the method comprising inbreeding a maize plant which is characterized by the at least one molecular marker, until the genetic composition of the progeny of such inbreeding becomes substantially stable.
It is a further object of the present invention to provide the method as defined in any of the above comprising additional steps of: (a) crossing a first maize plant that is a hybrid maize plant comprising a co-dominant genetic allele ELE1, wherein the allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE) with a second maize plant used as a recurrent parent to yield first progeny seeds; (b) growing the first progeny seed under suitable plant growth conditions to yield an Fl maize plant of the first hybrid plant, the Fl maize plant comprises the co- dominant ELE1 genetic allele conferring additional leaves above the ear and co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; and optionally, (c) crossing the plant obtained in step (b) with itself or with a third maize plant to yield second progeny seeds derived from the first hybrid plant; (d) growing the second progeny seed under suitable plant growth conditions to yield additional maize plant derived of the first hybrid plant, the additional maize plant comprises the co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; and further optionally, (e) repeating the steps of crossing and growing from (a) to (d) one or more times to generate further maize plants derived from the first hybrid plant, the further maize plants are characterized by the presence of the co- dominant ELE1 genetic allele conferring additional leaves above the ear and co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9.
It is a further object of the present invention to provide maize seed produced by the method as defined in any of the above.
It is a further object of the present invention to provide a maize plant grown from the seed as defined in any of the above.
It is a further object of the present invention to provide a method for increasing maize yield production to a commercially relevant extent in multiple geographical and/or weather-related environments or areas comprising growing in the geographical area maize plant as defined in any of the above.
It is a further object of the present invention to provide a method of producing maize kernels or processed maize kernels as a food product, comprising the steps of: (a) providing a maize plant as defined in any of the above; (b) mutilating or propagating the maize plant; (c) allowing the plant to grow corn ears; and, (d) harvesting the kernels of the corn ears.
It is a further object of the present invention to provide use of the seed deposited under accession number NCEVIB 42074 for the production of maize kernels.
It is a further object of the present invention to provide use of the maize plant as defined in any of the above or maize kernels grown from a maize plant as defined in any of the above as fresh produce, as fresh cut produce, or for processing such as canning and animal feed and silage preparation. It is a further object of the present invention to provide a maize field or maize greenhouse comprising plants as defined in any of the above.
BRIEF DESCRIPTION OF THE FIGURES
In order to better understand the invention and its implementation in practice, a plurality of embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, wherein
Fig. 1A and IB present schematic illustration of exemplified physical effects of ELEi components compared to normal maize; and
Fig. 2 photographically presents improved stress tolerance of maize plants comprising the ELEi genetic factor as compared to normal control maize plants.
DETAILED DESCRIPTION OF THE INVENTION
The following description is provided, alongside all chapters of the present invention, so as to enable any person skilled in the art to make use of said invention and sets forth the best modes contemplated by the inventor of carrying out this invention. Various modifications, however, will remain apparent to those skilled in the art, since the generic principles of the present invention have been defined specifically to provide a means and method for providing maize plants exhibiting additional leaves above the ear (LAE) architecture.
The present invention provides a maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein said architecture co-segregates with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
According to a further embodiment, the maize plant as defined above exhibits an architecture that co-segregates with a molecular marker profile selected from the group consisting of:
(a) at least one molecular marker as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; (b) at least two molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9;
(c) at least three molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9;
(d) at least four molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9;
(e) at least five molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9;
(f) at least six molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9;
(g) at least seven molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9;
(h) at least eight molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; and
(i) nine molecular markers having a nucleotide sequence corresponding to the nucleotide sequences consisting of SEQ ID NO: 1 to SEQ ID NO:9.
It is further within the scope that the plants comprising one of the molecular marker combinations described above exhibit higher yield relative to plants with similar genetic constitution and having either a lower number of molecular markers (SEQ ID NO: l to SEQ ID NO: 9) co-segregating with the additional LAE phenotype or lacking those molecular markers. According to this embodiment, it is herein submitted that the yield is positively correlated with the number of markers in the maize plant. In other words, according to certain aspects of the invention, the more molecular markers identified in the maize plant, the more yield it produces.
According to further aspects of the invention, the present invention provides the maize plant as defined in any of the above, wherein the architecture is associated with the ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729. This novel ELE QTL encompass the molecular markers selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9 and any combination thereof.
It is herein defined that the term 'ELE' refers to a genetic determinant or factor or region that is found to affect or to be associated with number of leaves above the ear (LAE).
As used herein the term 'ELEj' refers to an allele which is linked to the unique DNA markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, wherein the markers are co-segregating with additional LAE architecture or phenotype. It is shown by the present invention that the ELEi is characterized by a non-dominant inheritance.
According to a further main aspect it is shown by the present disclosure that the additional LAE architecture identified by the unique molecular markers is associated with desirable increased yield characteristics such as increased plant height with or without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
The term 'molecular marker profile' refers hereinafter to a DNA marker set comprising DNA tag sequences representing the uniqueness of a donor line allele, particularly the ELE QTL donor line characterized by the ELEi aueie^ co-segregating with the additional LAE phenotype. The DNA marker set comprises at least one molecular marker or DNA tag having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO: 9 and any combination thereof. According to specific embodiments, the molecular marker profile of the maize plant with additional LAE architecture of the present invention may be described by the following equation: ¾f .
Figure imgf000022_0001
where
Mis the total number of molecular markers (i.e. 9 molecular markers);
??¾ ) is the presence of molecular marker i for maize plant j; and
, v . is the number of molecular markers in plant j.
It is further within the scope that the yield rank of maize plant j, characterized by a unique molecular profile, as defined above, relative to a second or reference maize plant may be defined by the following equation:
Figure imgf000022_0002
, where
S is the total number of plants compared to each other; and
R(j) is the yield rank of maize plant j (defined by molecular marker profile ¾f) relative to a second or reference maize plant i (defined by molecular marker profile
It is further within the scope that the present invention provides a non-dominant non- transgenic genetic factor (ELEi ) which is capable of significantly increasing maize yield by adding usually two or three leaves above the ear (LAE). In a specific embodiment, the present invention provides a non-dominant non-transgenic genetic factor (ELEi ) which is capable of significantly increasing maize yield by adding usually two or three leaves above the ear (LAE) in homozygous ELE1 /ELE1 configuration as compared with a homozygous ELE2/ELE2 genotype (normal maize). According to a further embodiment, the heterozygote ELE1 /ELE2 plant has an intermediate number of
LAE.
As used herein, the term 'about' refers to a value being ± 25% of the defined measure.
The term 'genetic determinant' is defined herein as a nucleotide sequence, preferably a DNA sequence that may comprise sequences with various genomic functions such as genes and regulatory elements regions. Genetic determinant may also refer to a nucleotide construct and may be comprised in a vector. Alternatively, a genetic determinant may be transferred from one plant to another by chromosomal recombination after crossing said plants. A genetic determinant may in principle comprise genetic material originating from one or more species. In particular, genetic determinant as used herein refers to a single non dominant gene or multiple genes, a QTL or a haplotype, that determines or controls additional leaves above the ear (LAE) architecture or phenotype in a maize plant. More particularly genetic determinant as used herein refers to ELE non-dominant genetic factor disclosed by the present invention for the first time.
A 'gene' is defined herein as a hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristic or trait in an organism.
A 'locus' is defined herein as the position on a genetic map that a given gene or any other genetic element or factor contributing to a trait occupies on a chromosome of a given species.
As used herein, the term 'heterozygous' refers to a genetic configuration existing when different alleles reside at corresponding loci on homologous chromosomes.
As used herein, the term 'homozygous' refers to a genetic configuration existing when identical alleles reside at corresponding loci on homologous chromosomes. Homozygosity is defined as absence of segregation after selfing of an individual plant or, if crossed, absence of segregation in Fl.
As used herein, the terms 'hybrid', 'hybrid plant' and 'hybrid progeny' refers to an individual produced from genetically different or unlike parents (e.g., parental lines having substantially different genetic constitution). In particular, a hybrid plant refers to a genetically heterozygous or mostly heterozygous individual. More specifically, the phrase Fl hybrid refers to an Fl hybrid produced from a cross between two inbred lines.
As used herein, the phrase 'inbred line' refers to a genetically homozygous or nearly homozygous population. An inbred line, for example, can be derived through several cycles of breeding or of selfing. In some embodiments, inbred lines breed true for one or more phenotypic traits of interest. An 'inbred', 'inbred individual', or 'inbred progeny' is an individual sampled from an inbred line.
As used herein, the term 'trait' refers to a characteristic or phenotype, e.g., additional leaves above the ear architecture, kernel's yield, stress tolerance and parasite tolerance such as tolerance to striga. A trait may be inherited in a dominant or recessive manner, or in a partial or incomplete-dominant manner. A trait may be monogenic (i.e. determined by a single locus) or polygenic (i.e. determined by more than one locus) or may also result from the mutual interaction among genes or interaction of one or more genes with the environment. A dominant trait results in a complete phenotypic manifestation at heterozygous or homozygous state; a recessive trait manifests itself only when present at homozygous state. According to certain embodiments of present invention, the ELE genetic determinant shows a non dominant inheritance, and more particularly, a co dominant inheritance pattern.
The terms 'dominant' and 'recessive' refer to the interaction of alleles in producing the phenotype of the heterozygote. Dominance is a genotypic relationship between alleles, as manifested in the phenotype. It is unrelated to the nature of the phenotype itself, e.g., whether it is regarded as normal or abnormal, standard or nonstandard, healthy or diseased, stronger or weaker, or more or less extreme. A dominant trait or allele or dominant genetic factor results in a situation where the phenotype of the heterozygote is completely indistinguishable from that of the dominant homozygote.
The term 'non dominant' relates to a genetic configuration inheritance where the phenotype of the heterozygous genotype is an intermediate of the phenotypes of the homozygous genotypes.
The term 'co-dominant' or 'co-dominance' used herein refers to a genetic configuration inheritance where allelic products co-exist in the phenotype. The term also include incomplete or semi-dominance configuration, where the quantitative interaction of allele products produces an intermediate phenotype. For example the heterozygote ELE1 /ELE2 plant has an intermediate number of leaves above the ear
(LAE) relative to the homozygous ELEi /ELEi or ELE2/ELE2 plant.
As used herein, the term 'allele(s)' means any of one or more alternative forms or variant forms of various genetic units determinants or factors identical or associated with different forms of a gene or of any kind of identifiable genetic element, all of which alleles relate to at least one trait or characteristic. In a diploid cell, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes and are, therefore, alternative in inheritance. Such alternative or variant forms may be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or the consequence of gene regulation caused by, for example, by chemical or structural modification, transcription regulation or post-translational modification/regulation. An allele associated with a quantitative trait may comprise alternative or variant forms of various genetic units including those that are identical or associated with a single gene or multiple genes or their products or even a gene disrupting or controlled by a genetic factor contributing to the phenotype represented by said QTL.
As used herein, the term 'progeny' refers to the descendant(s) of a particular cross. Typically, progeny result from breeding of two individuals, although some species can be selfed (i.e., the same plant acts as the donor of both male and female gametes). The descendant(s) can be, for example, of the Fl, the F2, or any subsequent generation.
As used herein, the terms 'introgression', 'introgressed' and 'introgressing' refer to the process whereby genetic determinants or elements or factors such as genes, a QTL or haplotype of one species, variety or cultivar are transferred into the genome of another species, variety or cultivar, by crossing those species. The crossing may be natural or artificial. The process may optionally be completed by backcrossing to the recurrent parent, in which case introgression refers to infiltration of the genes of one species into the gene pool of another through repeated backcrossing of an interspecific hybrid with one of its parents. An introgression may also be described as a heterologous genetic material stably integrated in the genome of a recipient plant.
The term 'polymorphism' is understood within the scope of the invention to refer to the presence in a population of two or more different forms of a gene, genetic marker, or inherited trait or a gene product obtainable, for example, through alternative splicing, DNA methylation, etc.
The term 'selective breeding' is understood within the scope of the invention to refer to a program of breeding that uses plants that possess or display desirable traits as parents.
The term 'second plant' or 'reference plant' or 'normal maize plant' or 'normal plant' used herein refers to a plant or more specifically to a corn plant i.e. of the species Z. mays having the phenotypic characteristic of about 5 to about 6.6 leaves above the ear, preferably, about 6 leaves above the ear. Such a normal maize plant is genotypically characterized by a homozygous ELE2/ELE2 genotype configuration. Thus it is within the scope of the present invention that a normal maize plant lacks the ELE1 genetic factor conferring additional leaves above the ear. It is further within the scope that the genome of such a second or reference plant lacks at least one of the molecular markers of the maize plant of the present invention. Thus it comprises less molecular markers or it is absent of the unique molecular markers, which co-segregate with additional LAE architecture associated with high yield properties phenotype.
In a specific embodiment, a normal maize plant may be used as a recurrent parental line in a breeding scheme. Typically, the plant to be tested is crossed with a 'normal' plant of similar genetic constitution and the segregation ratio of the trait in the progeny of the cross is scored. According to main embodiments, phenotypic characteristics such as number of leaves above the ear (LAE), yield, plant height, ear height, ear weight and stress tolerance are compared between the maize plants having the novel ELE1 genetic factor and normal maize plants having similar genetic constitution and lacking the ELE1 genetic determinant.
The terms 'increased yield' or 'high yield' or ' yield components' used herein refer to genetically enhanced lines or cultivars of crops such as maize that have an increased crop production or increased percentage of usable plant parts, preferably maize kernels or grains. It is within the scope of the invention that the yield produced by a maize plant may include components or parameters such as kernel weight, number of kernels per ear, number of ears per plant, ear weight, ear height, plant height, ear height to plant height ratio, dry weight yield or biomass, relative silking, grain yield, earliness and any combination thereof. According to a main aspect of the invention, the plants provided by the present invention are characterized by increased yield, increased dry weight yield, and yield components which is herein surprisingly shown to be correlated with the additional two or three leaves above the ear phenotype conferred by the novel ELE1 genetic determinant.
The term 'dry weight yield' refers hereinafter to the plant's measured dry weight or biomass. It is herein acknowledged that since plants have a high composition of water and the level of water in a plant depends on the amount of water in its environment (which is variable and might be difficult to control), using dry weight as a measure of plant growth and yield is important and reliable.
In further aspects of the invention, the maize plants comprising the ELE1 genetic determinant conferring additional leaves above the ear can produce an increased yield of up to 40% as compared to the yield of a normal maize plant of similar genetic constitution, lacking said genetic determinant.
In other aspects, the maize plants comprising the ELE1 genetic determinant conferring additional leaves above the ear are possibly characterized by an improved root system, particularly having an extensive and early developed root system, as compared to a normal maize plant, lacking said genetic determinant.
It is within the scope of the present invention that the unique ELE genetic system is possibly correlated with the production of a more efficient and extended root system in the ELE1 maize than in the normal maize lacking the ELE1 factor. Such an extended developed root system brings water and nutrients more easily to the stalk and the leaves and as a result the maize plant barring such a root system is more resistant to stress.
The term 'nicking' as used herein generally refers to floral synchronization. More specifically, it refers to the synchronization between pollen shed (anthesis) and silk emergence. Under Favorable conditions, silks emerge 1-3 days after anthesis and remain fertile for about 1 week before senescing. Stress conditions such as water stress, often result in a loss of nick; thus when silks emerged, there is no pollen source, thus barren plants or ears with fewer kernels per ear are produced. Poor 'nicking' (lack of synchrony of anthesis and silk emergence) is largely a result of delayed silk emergence. According to some embodiments the maize plants of the present invention, exhibiting additional LAE architecture co-segregating with unique molecular markers exhibit improved yield and tolerance to stress characteristics such as nicking between pollen shed and silk emergence.
The term 'normal plant density' as used herein refers to maize planting density of about 50,000 plants per hectare (ha). It is herein acknowledged that the optimum density at harvest for a variety is that which yields the most grain when the crop is grown under non-limiting conditions.
The term 'low plant density' as used herein refers to maize planting density of about 25,000 plants per hectare.
As used herein, the term 'population' means a genetically homogeneous or heterogeneous collection of plants sharing a common genetic derivation.
As used herein, the term 'variety' or 'cultivar' means a group of similar plants that by structural features and performance can be identified from other varieties within the same species. The term 'variety' as used herein has identical meaning to the corresponding definition in the International Convention for the Protection of New Varieties of Plants (UPOV treaty), of Dec. 2, 1961, as Revised at Geneva on Nov. 10, 1972, on Oct. 23, 1978, and on Mar. 19, 1991.
A 'cultivated maize' plant is understood within the scope of the invention to refer to a plant that is no longer in the natural state but has been developed by human care and for human use and/or consumption.
As used herein, the term 'breeding', and grammatical variants thereof, refer to any process that generates a progeny individual. Breeding can be sexual or asexual, or any combination thereof. Exemplary non-limiting types of breeding include crossing, selfing, doubled haploid derivative generation, and combinations thereof.
'Backcrossing' is understood within the scope of the invention to refer to a process in which a hybrid progeny is repeatedly crossed back to one of the parents. Different recurrent parents may be used in subsequent backcrosses.
'Processed maize plant' or product is understood within the scope of the invention to refer to maize kernels that are processed into for example (1) canning, and/or (2) concentrated products such as puree, sauce and paste or any other grain-based foods or beverages or processed corn/maize product. Furthermore, the maize plants of the present invention may be used for preparation of animal feed and/or silage.
The term 'sequence identity' or 'sequence homology' used herein refers to corresponding two or more nucleic acid or protein sequences, that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the available sequence comparison algorithms or by visual inspection. If two sequences, which are to be compared with each other, differ in length, sequence identity preferably relates to the percentage of the nucleotide residues of the shorter sequence, which are identical with the nucleotide residues of the longer sequence. As used herein, the percent of identity or homology between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of identity percent between two sequences can be accomplished using a mathematical algorithm as known in the relevant art. According to further aspects of the invention, the aforementioned terms refer to variants, homologues and fragments of the indicated nucleotide sequence which possess or perform the same biological function or correlates with the same phenotypic characteristic of the indicated nucleotide sequence.
In other embodiments of the invention, such substantially identical sequences refer to polynucleotide or amino acid sequences that share at least about 80% similarity, preferably at least about 90% similarity, alternatively, about 95%, 96%, 97%, 98% or 99%) similarity to the indicated polynucleotide or amino acid sequences.
The term 'homology', as used herein, refers to a DNA or amino acid sequence having a degree of sequence similarity in terms of shared amino acid or nucleotide sequences. There may be partial similarity or complete similarity (i.e., identity). For protein sequences, amino acid similarity matrices may be used as are known in different bioinformatics programs (e.g. BLAST, FASTA, Bestfit program- Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711, Smith Waterman). Different results may be obtained when performing a particular search with a different matrix. Degrees of similarity for nucleotide sequences are based upon identity matches with penalties made for gaps or insertions required to optimize the alignment, as is well known in the art (e.g. Altschul S. F. et al., 1990, J Mol Biol 215(3):403-10; Altschul S. F. et al., 1997, Nucleic Acids Res. 25:3389-3402). Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological or activity may be found using computer programs well known in the art, for example, DNASTAR software.
As used herein, the phrase 'genetic marker' or 'molecular marker' or 'DNA marker' or 'biomarker' refers to a feature in an individual's genome e.g., a nucleotide or a polynucleotide sequence that is associated with one or more loci or trait or QTL of interest. In some embodiments, a genetic marker is polymorphic in a population of interest, or the locus occupied by the polymorphism, depending on context. Genetic markers or molecular markers include, for example, single nucleotide polymorphisms (SNPs), DNA tags, indels (i.e., insertions/deletions), simple sequence repeats (SSRs), restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs), cleaved amplified polymorphic sequence (CAPS) markers, Diversity Arrays Technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs) or combinations thereof, among many other examples such as the DNA sequence per se. Genetic markers can, for example, be used to locate genetic loci containing alleles on a chromosome or a QTL that contribute to variability of phenotypic traits. The phrase 'genetic marker' or 'molecular marker' or 'biomarker' can also refer to a polynucleotide sequence complementary or corresponding to a genomic sequence, such as a sequence of a nucleic acid or a polynucleotide used as a probe or primer. The present invention provides a set of novel and unique molecular markers co- segregating with additional LAE phenotype, wherein the molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9 and any combination thereof
A genetic marker can be physically located in a position on a chromosome that is within or outside of the genetic locus with which it is associated (i.e. is intragenic or extragenic, respectively). In some embodiments of the presently disclosed subject matter, the one or more genetic markers comprise a combination of two or more genetic markers. It is also within the scope of the present invention that different combinations of genetic markers are used to identify different traits or phenotypic characteristics as disclosed inter alia.
As used herein, the term 'co-segregating' or 'co-segregates' is understood within the scope of the invention as referring to the tendency of genes, traits and/ or genetic markers to segregate or to be inherited together. Two or more genes, gene alleles or genetic markers that are linked on the same chromosome are transmitted to the same daughter cell leading to the inheritance by the offspring of these genes or alleles together.
More specifically, in the context of the present invention, the term "co-segregation" refers to the fact that the present invention discloses for the first time molecular markers (i.e. at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9) linked to the additional LAE trait that is shown to be associated with high yield in maize. These molecular markers tend to be transmitted together with the allele conferring additional LAE because they are on the same chromosome. Without wishing to be bound by theory it is submitted that reduced recombination between them results in a non-random association of their alleles on the same chromosome. "Co-segregation" also refers to the presence of two or more traits, genetic markers or combinations thereof, within a single plant of which at least one is known to be genetic and which cannot be readily explained by chance. In some embodiments, novel genetic markers are herein identified to co segregate with the additional leaves above the ear trait.
The term 'co segregating' used in the present invention is analogous to coupling or co- inheriting in some of the embodiments of the invention.
The term 'genetic determinant introgression' as used herein refers to the incorporation of new genetic determinants or elements such as genes, alleles, QTLs or traits, into a line wherein essentially all of the desired morphological and physiological characteristics of the line are recovered, in addition to the genetically introgressed determinant. Such a process is often used in cultivar development, in which one or a few genetic determinants are transferred to a desired genetic background, preferably by using backcrossing.
The term 'plant cell culture' or 'tissue culture' as used herein means cultures of plant units such as, for example, protoplasts, regenerable cells, cell culture, cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at various stages of development, leaves, roots, root tips, anthers, meristematic cells, microspores, flowers, cotyledons, pistil, fruit, seeds, seed coat or any combination thereof.
The term 'plant material' or 'plant part' used herein refers to leaves, stems, roots, root tips, flowers or flower parts, kernels, stalk, cob, grain, ear, pollen, egg cells, zygotes, seeds, seed coat, cuttings, cell or tissue cultures, or any other part or product of a plant or a combination thereof.
It is herein acknowledged that an increased number of leaves above the ear is a desirable trait in maize breeding as it increases leaf area at the period just before flowering until physiological maturity, to enable better adjustment of sink size to source activity and better realization of the potential yield by increasing the proportion of the spiklets filled. In addition, the increased leaf area in the region where photosynthesis is progressing in the most rapid rate, during grain filling, improves metabolites availability to the grains being filled and therefore may increase grain weight.
The present invention provides a novel and unique genetic system (ELE) capable of adding leaves above the ear, preferably 2-3 leaves above the ear in maize. According to a specific embodiment the donor or source of this genetic system may be of tropical background. The ELE genetic system is preferably controlled by a single major gene without dominance, with an additional effect of minor or modifier genes.
A breeding scheme performed in the tropics, with several F2 populations segregating for the number of leaves above the ear has shown an increase in yield and yield components, particularly kernel weight, which was correlated with the increased number of leaves above the ear from about 6 to about 8.
According to a further aspect of the invention, a breeding program was initiated in Israel aimed to transfer the genetic system into maize adapted to temperate climate. Publicly available inbred lines developed in the U.S with particular emphasis on the two well known inbred lines B73 and Mo 17 were used as a source of germplasm adapted to the temperate climate.
According to yet another aspect of the invention, the U.S lines were crossed with the ELE genetic material and the Fl plants were advanced to F2. ELE lines were developed by direct self pollination of the F2 plants or by one or two cycles of back crossing followed by self pollination.
General and specific combining ability (GCA and SCA) of the developed lines were tested by test-crosses with normal maize plants i.e. B73 and Mo 17 and the newly developed lines were divided to two heterotic groups accordingly.
Experimental hybrids were produced by crossing selected ELE lines from the two heterotic groups or by test crossing the ELE lines with normal maize plants, i.e. B73 and Mol7. The experimental hybrids were tested with and compared with B73xMol7 hybrids and two commercial recommended hybrids as controls. Several experimental hybrids with significantly higher yields than the controls were surprisingly identified in several trials (see examples below).
According to yet another embodiment of the present invention, more than 1000 hybrid lines comprising the ELE1 genetic factor are produced having improved agricultural characteristics such as increased yiels, lodging resistance, adaptation to higher density of planting, enhanced earliness, improved root system, improved stress tolerance, for example to stress types including parasites, pests and draught, and combinations thereof.
It is thus a core aspect of the invention to clearly demonstrate that yield potential of maize can be significantly increased by adding few leaves above the ear (LAE). An increased number of LAE controlled by the ELE gene is herein shown to significantly improve yield potential in maize by increasing the photosynthetic active leaf area during the period from just before flowering to physiological maturity. According to certain embodiments of the present invention, both the average kernel weight and the number of kernels per ear are being increased at normal planting density of the plants of the present invention. At a lower planting density, also the average number of ears per plant is increased.
It is herein further disclosed that the addition of LAE can also improve stress tolerance in maize, examples of stress types may include tolerance to parasites such as striga, pests, draught and combinations thereof.
In a further embodiment of the invention, the ELEj genetic factor can be transmitted by conventional breeding techniques and by different types of genetic engineering methods, to all types of maize in all possible environments.
Accordingly, the present invention provides a method to increase the number of leaves and leaf area above the ear, in the region where photosynthesis is progressing in the most rapid rate during grain filling. Such a method is further adapted to improve metabolities availability to the grains being filled and consequently to increase yield potential. Hence, one of the objects of this invention is to significantly increase the yield per hectare of maize through a change in plant architecture by adding more leaves above the ear.
Reference is now made to Fig. 1 schematically presenting exemplified physical effects of ELEI components as compared to normal maize. Fig. 1 A illustrates normal maize preferably characterized by ELE2/ELE2 genetic configuration. Fig. IB illustrates a maize plant comprising the ELEI genetic determinant, preferably having ELE1 /ELE1 genetic configuration. As can be seen, the maize plant of Fig. IB, comprising the ELEI genetic determinant exhibits additional 2 to 3 leaves above the ear (Fig. IB, 1) as compared to the normal maize plant (Fig. 1A). Furthermore, the plant with the additional LAE exhibits more cobs (Fig. IB, 2) and/or larger cobs (Fig. IB, 3), preferably having more kernels per cob and/or larger kernel weight (Fig. IB, 2 and 3), as compared to the normal maize plant (Fig. 1 A).
Reference is now made to Fig. 2, presenting a photographic illustration of stress tolerance of maize plants comprising the ELEI genetic factor as compared to normal control maize plants. As can be seen, the maize plants comprising the ELEl genetic determinant 10, exhibit improved tolerance to striga hermonthica parasite stress, as compared to normal maize plants 20 lacking the ELEl factor. In the presence of striga hermonthica infestation, the maize plants comprising the ELEl genetic determinant 10 are more viable than the normal plants 20; they produce additional leaves and thus are higher than the normal plants 20. These results demonstrate the improved tolerance to parasitic stress such as striga of the maize plants comprising the ELEl non dominant genetic factor provided by the present invention.
Thus, according to one embodiment, the present invention provides a maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein the architecture is controlled by a genetic determinant which shows a non dominant inheritance.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the architecture co-segregates with a molecular marker having a nucleotide sequence corresponding to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9 and any combination thereof.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the architecture co-segregates with a molecular marker profile selected from the group consisting of: (a) at least one molecular marker as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (b) at least two molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (c) at least three molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (d) at least four molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; (e) at least five molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (f) at least six molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; (g) at least seven molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; (h) at least eight molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; and (i) nine molecular markers having a nucleotide sequence corresponding to the nucleotide sequences consisting of SEQ ID NO: 1 to SEQ ID NO: 9; and any combination thereof.
It is further within the scope that the plant has a higher yield relative to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has a molecular marker profile defined by the equation ¾ ; = Zft- ^ ), where M is the total number of molecular markers, the molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, is the presence of molecular marker / in maize plant j, and . is the number of molecular markers in the plant j.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the yield rank of the plant j relative to a second reference maize plant i is defined by the equation s( ) =∑f= iC¾;, > where S is the total number of maize plants compared, and R(j) is the yield rank of the plant j relative to the second reference maize plant i.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the architecture is associated with the ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant architecture is characterized by additional two or three or four leaves above the ear.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant architecture is characterized by up to four additional leaves above the ear.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant architecture is characterized by less than five additional leaves above the ear. It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant is a hybrid.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genome of the plant comprises a homozygous configuration of the at least one molecular marker.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genome of the plant comprises a heterozygous configuration of the at least one molecular marker.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the at least one molecular marker is independently segregated from Lfy genetic factor.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the additional LAE architecture is controlled by a genetic determinant which shows a non-recessive inheritance and is co-segregating with the at least one of the molecular marker.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genetic determinant is in a heterozygous configuration.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the heterozygous configuration of the genetic determinant confers at least one heterotic phenotypic effect with respect to high yield in maize.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genetic determinant shows incomplete dominant inheritance with respect to the additional LAE phenotype.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genetic determinant is characterized by the presence of at least one ELE1 allele, co-segregating with the at least one molecular marker.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant is heterozygous for the ELE1 allele.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant is homozygous for the ELE1 allele. It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genome of the plant is characterized by the presence of at least one ELE1 allele is co-segregating with the at least one molecular marker and at least one ELE2 allele lacking the at least one molecular marker.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by additional leaves above the ear (LAE) architecture in homozygous ELE1/ELE1 genotype configuration as compared with a homozygous ELE2/ELE2 genotype configuration of a normal maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by additional leaves above the ear (LAE) architecture in heterozygous ELE1/ELE2 genotype configuration as compared with a homozygous ELE2/ELE2 genotype of normal maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the genome of the plant comprises at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, the at least one molecular marker is associated with increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased yield of up to 40% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased yield of between about 5% and about 20% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased yield of about 30% and more, greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has grain yield of at least 10 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has grain yield of about 15 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has grain yield of between about 10 ton/hectare and about 20 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has grain yield of about 20 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has silage yield of at least 15 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has silage yield of about 20 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has silage yield of between about 15 ton/hectare and about 30 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has silage yield of about 30 ton/hectare.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased plant height without significant effect on ear height.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the maize plant is characterized by an increased average kernel weight and an increased number of kernels per ear at normal planting density, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has an increased average kernel weight at a normal planting density, as compared to the average kernel weight of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the plant has an increased number of kernels per ear at a normal planting density, as compared to the number of kernels per ear of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein at a low planting density the plant further exhibits an increased average number of ears per plant as compared to the number of ears per plant of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the at least one molecular marker is co-segregating with improved stress tolerance, particularly with improved characteristic selected from the group consisting of: nicking between pollen shed and silk emergence, "Stay Green" characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, increased dry weight yield, adaptation to higher density planting, and any combination thereof.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the pant exhibits an improved stress tolerance, particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green" characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the pant exhibits an increased tolerance to striga, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant. It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the tolerance to striga is calculated as the ratio of yield under striga infested and non infested conditions {striga tolerance Index).
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, wherein the additional LAE architecture is obtainable from maize line VIGOR B, deposited with NCEVIB under accession number 42074, the LAE architecture is co-segregating with the at least one molecular marker.
It is a further embodiment of the present invention to disclose the maize plant as defined in any of the above, which can be obtained from a donor plant comprising the ELE QTL conferring a phenotype with additional leaves above the ear (LAE), particularly maize line VIGOR B, deposited with NCEVIB under accession number 42074, through introgression of the ELE QTL or part thereof into a recipient plant lacking the QTL or part thereof such that the introgressed plant exhibits additional LAE architecture phenotype.
It is a further within the scope to disclose seed of a plant as defined in any of the above.
It is a further within the scope to disclose plant material obtainable from a plant as defined in any of the above.
It is a further within the scope to disclose plant parts of a plant as defined in any of the above.
It is a further within the scope to disclose maize kernels of a plant as defined in any of the above.
It is a further within the scope to disclose maize kernels as defined above which are processed kernels.
It is a further within the scope to disclose the maize plant as defined in any of the above, wherein the plant is an inbred, a dihaploid or a hybrid.
It is a further within the scope to disclose pollen of the maize plant as defined in any of the above.
It is a further within the scope to disclose an ovule of the plant as defined in any of the above.
It is a further within the scope to disclose the maize plant as defined in any of the above, further comprising an additional trait selected from the group consisting of at least one type of disease resistance and at least one type of stress resistance and any combination thereof.
It is a further within the scope to disclose the maize plant as defined in any of the above further comprising an additional trait introduced by genetic transformation.
It is a further within the scope to disclose the maize plant, or part thereof, as defined in any of the above, wherein the plant or parts thereof have been transformed so that its genomic material contains one or more transgenes operably linked to one or more regulatory elements.
It is a further within the scope to disclose a tissue culture of regenerable cells of a maize plant as defined in any of the above.
It is a further within the scope to disclose a tissue culture as defined above, comprising cells or protoplasts from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruit and seeds.
It is a further within the scope to disclose the tissue culture of regenerable cells as defined in any of the above, wherein the tissue regenerates plants exhibiting an additional leaves above the ear (LAE) architecture, the architecture is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
It is a further within the scope to disclose a maize plant regenerated from the tissue culture as defined in any of the above, wherein the plant exhibits an additional leaves above the ear (LAE) architecture, the architecture is controlled by a genetic determinant which shows a co-dominant inheritance and co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
It is a further within the scope to disclose a hybrid maize plant comprising a co- dominant genetic allele ELE1, wherein the allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE).
It is a further within the scope to disclose a hybrid maize plant characterized by an ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729, the QTL confers additional leaves above the ear (LAE) phenotype, the genetic determinant is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, and is being capable of transmission to progeny plants substantially as a single non-dominant gene.
It is a further within the scope to disclose maize seed derived from the hybrid maize plant as defined in any of the above.
It is a further within the scope to disclose the maize seed as defined above, wherein the maize plant is a female parent plant.
It is a further within the scope to disclose the maize seed as defined in any of the above, wherein the maize plant is a male parent plant.
It is a further within the scope to disclose the maize plant as defined in any of the above, wherein the plant exhibits an improved and more efficient root system as compared to the root system of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further within the scope to disclose a method for producing seed maize with additional leaves above the ear (LAE) architecture, the method comprising the steps of: pollinating a first maize plant with pollen of a second maize plant, wherein at least one of the maize plants possess within its genome at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 co-segregating with additional leaves above the ear (LAE) architecture, and harvesting seeds produced by the pollinated maize plant.
It is a further within the scope to disclose the method as defined above, wherein at least one of the first or second maize plants possesses a homozygous configuration of the at least one molecular marker.
It is a further within the scope to disclose the method as defined in any of the above, wherein at least one of the first or second maize plants possesses a heterozygous configuration of the at least one molecular marker.
It is a further within the scope to disclose a method of producing a maize plant exhibiting an additional leaves above the ear (LAE) architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, comprising the steps of (a) selecting a donor maize plant with additional LAE architecture, and a recipient maize plant with a normal LAE architecture; (b) crossing the donor plant with the recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype; (c) screening for and selecting from the progeny plants at least one plant exhibiting an additional leaves above the ear architecture, which is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; and (d) optionally, harvesting the resultant progeny seed.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of up to 40% as compared to the yield of a maize plant of similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant, the increased yield characteristic is associated with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 9.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of up to 40% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of about 5% to about 20% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant. It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting an increased yield of about 30% and more, greater than the yield of a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of at least 10 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of about 15 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of between about 10 ton/hectare and about 20 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of screening for and selecting from the progeny plants at least one plant exhibiting grain yield of about 20 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, wherein the plant has silage yield of at least 15 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, wherein the plant has silage yield of about 20 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, wherein the plant has silage yield of between about 15 ton/hectare and about 30 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, wherein the plant has silage yield of about 30 ton/hectare.
It is a further within the scope to disclose the method as defined in any of the above, comprising steps of crossing a donor plant, particularly maize line VIGOR B, deposited with NCEVIB under accession number 42074, with a recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype, and screening for and selecting from the progeny plants at least one plant exhibiting an additional leaves above the ear phenotype which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, and, optionally, harvesting the resultant progeny seed.
It is a further within the scope to disclose a method for producing hybrid maize seed exhibiting an additional leaves above the ear (LAE) architecture, the method comprising steps of crossing first and second maize plants, wherein at least one of the maize plants is characterized by the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 which is co-segregating with additional leaves above the ear (LAE) phenotype, the at least one molecular marker shows co dominant inheritance.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of self-pollinating a maize plant possessing the at least one molecular marker through at least one generation until the at least one molecular marker is in a homozygous configuration, the at least one molecular marker is co-segregating with a phenotype with additional LAE which is transmittable to progeny as a co- dominant allele.
It is a further within the scope to disclose the method as defined in any of the above, comprising additional steps of backcrossing a maize plant used as a recurrent parent with a second maize plant possessing the at least one molecular marker co-segregating with a phenotype with additional leaves above the ear which is transmissible to progeny as co-dominant allele.
It is a further within the scope to disclose the method as defined in any of the above, obtained by other means then conventional crossing, particularly different types of genetic engineering methods or any other technique.
It is a further within the scope to disclose a method for screening for a maize plant exhibiting additional LAE architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9 comprising the steps of: screening the genome of a maize plant for the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; the at least one molecular marker co-segregates with additional LAE architecture.
It is a further within the scope to disclose seed maize produced by the method as defined in any of the above.
It is a further within the scope to disclose a maize plant produced by the method as defined in any of the above.
It is a further within the scope to disclose an isolated nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, wherein the isolated nucleotide sequence is co-segregating with additional leaves above the ear (LAE) architecture.
It is a further within the scope to disclose the isolated nucleotide sequence as defined above, wherein the additional LAE architecture is associated with increased yield properties as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further within the scope to disclose the isolated nucleotide sequence as defined in any of the above, wherein the increased yield properties are selected from the group consisting of: increased plant height without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, increased dry weight yield, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of the molecular markers of the maize plant.
It is a further within the scope to disclose isolated oligonucleotide sequences annealing with the nucleotide sequence as defined in any of the above, wherein the sequences are suitable for the detection and production of maize plants having additional leaves above the ear (LAE) architecture.
It is a further within the scope to disclose maize genetic markers, sequences or elements, plants, seeds and plant products as described in any of the above, for the use in multiple geographical and/or weather-related environments (e.g. tropical, sub-tropic, temperate, etc). It is a further within the scope to disclose use of an isolated nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO: 9, for detection and production of maize plants having additional leaves above the ear (LAE) architecture.
It is a further within the scope to disclose a method for producing inbred maize seed characterized by additional LAE architecture which is co-segregating with a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, the method comprising inbreeding a maize plant which is characterized by the at least one molecular marker, until the genetic composition of the progeny of such inbreeding becomes substantially stable.
It is a further within the scope to disclose the method as defined above comprising additional steps of: (a) crossing a first maize plant that is a hybrid maize plant comprising a co-dominant genetic allele ELE1, wherein the allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE) with a second maize plant used as a recurrent parent to yield first progeny seeds; (b) growing the first progeny seed under suitable plant growth conditions to yield an Fl maize plant of the first hybrid plant, the Fl maize plant comprises the co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; and optionally, (c) crossing the plant obtained in step (b) with itself or with a third maize plant to yield second progeny seeds derived from the first hybrid plant; (d) growing the second progeny seed under suitable plant growth conditions to yield additional maize plant derived of the first hybrid plant, the additional maize plant comprises the co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; and further optionally, (e) repeating the steps of crossing and growing from (a) to (d) one or more times to generate further maize plants derived from the first hybrid plant, the further maize plants are characterized by the presence of the co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9.
It is a further within the scope to disclose maize seed produced by the method as defined in any of the above.
It is a further within the scope to disclose a maize plant grown from the seed as defined in any of the above.
It is a further within the scope to disclose a method for increasing maize yield production to a commercially relevant extent in multiple geographical and/or weather- related environments or areas comprising growing in the geographical area maize plant as defined in any of the above.
It is a further within the scope to disclose a method of producing maize kernels or processed maize kernels as a food product, comprising the steps of: (a) providing a maize plant as defined in any of the above; (b) mutilating or propagating the maize plant; (c) allowing the plant to grow corn ears; and, (d) harvesting the kernels of the corn ears.
It is a further within the scope to disclose use of the seed deposited under accession number NCIMB 42074 for the production of maize kernels.
It is a further within the scope to disclose use of the maize plant as defined in any of the above or maize kernels grown from a maize plant as defined in any of the above, as fresh produce, as fresh cut produce, or for processing such as canning and animal feed and silage preparation.
It is a further within the scope to disclose a maize field or maize greenhouse comprising plants as defined in any of the above.
The present invention further provides a method for producing seed maize with additional leaves above the ear (LAE) architecture. The aforementioned method comprising the steps of: pollinating a first maize plant with pollen of a second maize plant, wherein at least one of the maize plants possess a non dominant genetic determinant controlling additional LAE architecture, and harvesting seeds produced by the pollinated maize plant. More particularly, a cross between maize plant of Tropical origin and a normal maize plant from the U.S Corn Belt origin produced a progeny segregant plant with additional leaves above the ear. The additional leaves above the ear were found to be correlated with a genetic factor designated as ELEi . The ELEi genetic factor act substantially as a non-dominant allele that can add not more than five leaves, preferably two to four leaves and more preferably two to three leaves above the ear (LAE) in homozygous ELEi /ELEi or heterozygous ELE1 /ELE2 state as compared with a normal ELE2/ELE2 homozygous genotype of otherwise similar genetic constitution.
In a further embodiment of the invention, the ELEi allele can be transferred between strains of maize by conventional breeding techniques or other (e.g genetic engineering). The resulting derived inbred and/or hybrid strains are characterized by additional leaves above the ear without a noticeable effect on the number of leaves below the ear (see Fig. IB). As a result, one of the main advantages of the novel genetic system of the present invention is that plant height is being increased, but ear height placement is not affected.
According to a further aspect of the invention, incorporation of the ELEi genetic factor into existing hybrids of maize (of multi-environments) is herein shown to improve the yield significantly by up to about 40 percent when compared to the yield of genetically similar normal ELE2 hybrids.
It is further discloses by the present invention that the ELEi allele is not allelic to the
Lfy gene described in U.S. Pat. No. 4,513,532 as illustrated in the Examples below. The ELEi allele is non-dominant while the Lfy allele is dominant over the lfy of the normal maize. It behaves also differently by being a non-dominant allele compared to the dominant nature of the Lfy gene, its effect is limited to the addition of not more than 5 leaves above the ear and more preferably 2-3 leaves above the ear as compared to the addition of higher number of leaves by the Lfy gene (up to 18 LAE by the Lfy). Similarly its effect on the increased number of days required to reach first silk and pollen (anthesis) is also smaller compared with the effect of the Lfy gene. Furthermore, the ELEi allele is superior over the Lfy gene by the ability to confer increased tolerance to stress such as striga infestation and drought, improved lodging resistance, adaptation to higher density planting and earliness as inter alia demonstrated. It is further within the scope of the present invention that the number of leaves above the ear in an ELE1 /ELE1 genotype depends on the genetic background of the normal inbred line used at the cross. For example, the number of leaves above the ear may be affected by modifier (minor) genes. Furthermore, the number of leaves above the ear may also depends on the environmental conditions, wherein it is being reduced under stress caused, for example, by Striga hermonthica (a parasitic plant) or it is being increased when the same inbred line is growing under cooler conditions with a longer period from planting to silking.
According to further aspects, the ELEj genetic factor of the present invention can be introduced to new elite maize lines by crossing them with the homozygous ELEJ/ELET genotype. The resulting F.sub. l progeny plants have a phenotype with an intermediate number of leaves above the ear relative to the two parents.
According to one embodiment, the F.sub. l progeny may be selfed through a number of generations, i.e. 5 generations, or whatever number of generations is necessary or desirable or achieve stable homozygosity.
According to an alternative embodiment, the F.sub. l plants may be selfed to develop F.sub.2 segregating population. Segregated plants with the higher number of leaves above the ear and other desirable characteristics are being backcrossed with a normal elite ELE2/ELE2 line to produce the BC.sub. l generation.
According to a further embodiment, plants of the BC.sub. l may be selfed and selected desirable progeny plants are backcrossed again to the same elite normal line. The same procedure may optionally, continue several times, i.e. 5 cycles, which subsequently may convert the known elite inbred to have the ELE1 /ELE1 genotype.
According to a further embodiment, a combination of both approaches is also possible wherein backcrossing for several generations is followed by several generations of selfing, until homozygosity is being achieved. The advantage of the combined approach is that it takes shorter time to develop ELEJ/ELET inbred lines however the genome of the elite normal lines is not fully recovered.
In a further embodiment, the method of the present invention can be used to add leaves above the ear of all subspecies of maize, specifically including the dent or semi-dent maize, the flint or semi-flint maize, the soft or flower maize, the sweet corns and the pop corns.
In general, the method of the present invention may be used to produce elite hybrid maize (seeds and plants) for commercial maize production. Such hybrid is typically a result of a single cross that is a first generation hybrid between two inbred lines. However, it is also applicable to other types of hybrids such as modified single cross, three-way hybrids, four-way hybrids, top-cross hybrids (a cross between a variety and a line) and varietal cross hybrids. Similarly, open pollinated varieties homozygous for the ELEi allele can also be developed by the teachings of the present invention.
According to a further embodiment, the present invention provides two types of hybrids, wherein the ELE gene is either homozygous ELEi /ELEi or heterozygous ELE1 /ELE2.
The first type may be obtained by crossing two homozygous ELE1 /ELE1 parents. The second type may be obtained by crossing ELE1 /ELE1 parent with another parent which is ELE2/ELE2. The first type may usually have higher number of leaves above the ear than the second type.
According to a further embodiment of the present invention, the incorporation of the ELEi genetic factor into existing strains of maize increases the number of leaves above the ear. Consequently it may improve yield by up to 40 percent as compared with the yield of normal maize of similar genetic constitution, but with lower number of leaves above the ear. At normal planting density, i.e. about 50,000 plants per hectare, the yield increase is mainly due to higher kernel's weight and to a lesser extant by higher number of kernels per ear. At a low density, i.e. about 25,000 plants per hectare, the average number of ears per plant is also increased. This may provide better compensation for low stand of maize plants in the field due to poor germination, as a result of diseases or insect pests attack or due to moisture stress during germination. It is herein further emphesised that the addition of leaves above the ear enables the maize plant to withstand better any stress that reduces the effective photosynthesizing leaf area and thus provides better stress tolerance.
According to a further embodiment, the present invention provides a maize field comprising maize plants as described above.
Deposits: The following seed samples of Zea mays were deposited on 22 October 2012 with NCEVIB, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland, UK under the provisions of the Budapest Treaty in the name of Y.E. Vigor Corn:
Figure imgf000052_0001
The aforementioned genomes can be obtained from said deposited material but can also be obtained from other material. The sequence of the genes obtained from other material may vary from the sequence of the gene in the deposited material ("variant"). Deposit Number NCIMB 42074 or a genetic variant thereof, which refers essentially to the same phenotype are available. It is submitted that the seeds deposited under the Budapest treaty and having Deposit Number NCIMB 42074 are a representative example of seeds comprising within its genome at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, which co-segregates with additional LAE phenotype. Seeds of maize plants similar to the above, further comprising at least one additional trait selected from the group consisting of high germination rate, herbicide resistance and insect resistance, are obtainable with regard to a deposit made under the Budapest treaty regulations.
Seed samples were deposited on 22 October 2012 with NCFMB, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21, 9YA, Scotland, UK under the provisions of the Budapest Treaty. The seed samples include accession number 42074 as designated above.
The following examples are presented in order to more fully illustrate certain embodiments of the invention. They should in no way, however, be construed as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the spirit and scope of the invention.
EXAMPLES Example 1: The effect of planting season on the number of leaves above the ear (LAE) in ELE1 ELE1 line
The effect of the planting season was studied in Northern Nigeria which is characterized by two seasons. The normal wet maize planting season that starts in June and a dry cool season that starts in December. It has been shown for the ELE1/ELE1 lines (i.e. lines 11-111 and VIGOR B) that the number of days for silking was higher in the dry season (Table 1). Under these conditions the number of leaves above the ear was increased by about two, i.e. from 8.5 in June planting season to 10.7 in December planting season. This indicates that the number of leaves above the ear is affected by the length of the growing season.
Table 1: The effect of planting season on the mean number of days to silking and the mean number of leaves above the ear (LAE)
Planting season
June July December o. of days to silk 53.3 + 2.1 57.1 + 2.6 95.8 + 4.6 o. of LAE 8.5 + 0.94 8.9 + 1.07 10.7 + 1.42
Example 2: The effect of Striga hermonthica stress on the average number of leaves above the ear (LAE)
Striga hermonthica is a parasitic plant causing leaf dryness in maize plants. The effect of stress caused by the parasite was studied in F.sub.2 segregating population of a cross between ELE1 /ELE1 line (i.e. lines 11-111 and VIGOR B) and normal ELE2/ELE2 lines planted at the same time under Striga infested and non-infested field conditions. It was found that as a result of the stress, the average number of LAE was reduced from 7.63 to 6.86 and the frequency distribution was shifted towards the lower number of leaves above the ear (Table 2).
Frequency distribution (%) of plants with different number of leaves above the ear in F.sub.2 segregating populations grown under Striga infested and non-infested field conditions
Figure imgf000053_0001
Figure imgf000054_0001
LAE = Number of leaves above the ear.
Example 3: The effect of ELEl genetic factor on the number of leaves below and above the ear
The effect of the ELEi genetic factor was studied in progeny hybrids of a cross between
ELEi /ELEi line (i.e. lines 11-111 and VIGOR B) and five normal ELE2/ELE2 lines.
The five heterozygous ELE1/ELE2 hybrids were compared with five hybrids of crosses between the normal ELE2/ELE2 lines. It was shown that the mean numbers of leaves below the ear were similar in the two groups, indicating that the ELEi genetic factor does not affect the number of leaves below the ear. However it was surprisingly shown that the mean number of leaves above the ear (LAE) was increased in the heterozygous ELE1/ELE2 hybrids relative to the ELE2/ELE2 normal hybrid lines i.e. from 6.4 to 7.6
(see Table 3). This result indicates that the ELEi genetic factor is capable of increasing the number of leaves above the ear.
Average number of leaves below and above the ear in five heterozygous ELEj ELE2 hybrids and five homozygous ELE2 ELE2 maize hybrids
Figure imgf000054_0002
BE = Below the ear AE = Above the ear
Example 4: The effect of modifier (minor) genes
ELE1 /ELE1 line i.e. lines 11-111 and VIGOR B was crossed with five normal ELE2/ELE2 lines having different number of leaves above the ear ranging from 5.0 to 6.6. The results obtained demonstrate that in all progeny lines carrying the ELEi allele (i.e. ELE1/ELE2 and ELEJ/ELET ), the number of leaves above the ear was increased by one to three leaves. Furthermore, the average number of leaves above the ear in the F.sub. l, F.sub.2 and the two backcrosses populations was shown to be associated with the number of leaves above the ear of the normal parental lines (Table 4). This indicates that the differences between the normal lines are affected by modifiers (minor) genes.
Table 4: Average number of leaves above the ear in progeny of crosses between ELEJ ELEJ line and five normal ELE2/ELE2 lines
Figure imgf000055_0001
BC-N = backcross of Fl plants to the normal line (4-11, 1-105, 6-133, 8-21 and 3-57) BC-11-111 = backcross of Fl plants to ELEl/ELEl line 11-111
Example 5: Genetic inheritance of the ELE1 factor
A total of 13,475 plants of F.sub.2 populations derived from crosses between ELEl/ELEl line (i.e. 11-111 or VIGOR B) and various normal ELE2/ELE2 lines were tested for the segregation pattern of the number of leaves above the ear. The null hypothesis used was that the number of leaves is genetically controlled by the ELE gene (as demonstrated above), wherein the ELE1 allele that adds leaves above the ear is not dominant to the ELE2 allele present in the normal lines. However, the number of leaves above the ear can be modified somewhat by modifier genes (see Example 4). Accordingly, the F.sub.2 population is expected to segregate in a 1 :2: 1 ratio for the ELEl/ELEl : ELE1/ELE2 : ELE2/ELE2 genotypes provided adjustment is made for the effect of the modifier genes.
The results of this experiment show that the mean number of leaves of all the F.sub.2 plants was 7.05. A deviation of 0.25 leaves below and above the average was allowed for the effect of the modifier genes. Accordingly, the expected number of leaves above the ear for the heterogzyote ELE1/ELE2 should range between 6.8 - 7.3. The adjusted results fit well with the expected results of the null hypothesis with a probability of 0.50 < P < 0.75 (Table 5).
Thus it is concluded from the above results that the ELE1 allele that adds leaves above the ear is not dominant to the ELE2 allele presented in the normal lines.
Table 5: Segregation of leaves number above the ear and fitness of the adjusted data to a 1:2:1 ratio
Figure imgf000056_0001
LAE = Leaves above the ear
Example 6: The ELE gene is not allelic to the Lfy gene
Seeds of homozygous Lfy/Lf line (U.S. Pat. No. 4,513,532) were obtained from the International Institute of Tropical Agriculture (IITA) in Ibadan, Nigeria. This line was crossed with the ELEi /ELEi line (i.e. 11-111 and VIGOR B) and a normal ELE2/ELE2 line 1-105. The F.sub. l plants were advanced to the F.sub.2 generation by selfing and the number of leaves above the ear was counted in the two segregating populations.
The results obtained showed that the number of leaves above the ear ranged from 5 to 14 in the cross with line 1-105 and from 6 to 15 in the cross with 11-111 with approximately similar distribution pattern (Table 6). If the ELE and Lfy genes were allelic, all the plants in the cross with 11-111 or VIGOR B should have had at least 8 leaves and above. The presence of 17.3 percent of plants with 6 or 7 leaves above the ear (Table 6) clearly indicates that the ELE and the Lfy genes are not allelic. Namely, they are two different genes. Frequency distribution (%) of the number of leaves above the ear in F.sub.2 segregating populations of the crosses Lfy Lfy x ELE1 ELE1 and Lfy Lfy x ELE2/ELE2
Figure imgf000057_0001
Example 7: The effect of increased number of leaves above the ear on plant and ear heights and number of days from planting to pollen shed and silking
The effect of increased number of leaves above the ear on height and the number of days from planting to flowering was studied in F.sub.2 populations of a cross between ELEi /ELEi line (i.e. lines 11-111 and VIGOR B) with several normal ELE2/ELE2 lines segregating for number of leaves above the ear. It was shown that plant height was increased with the increased number of leaves above the ear, but unexpectedly, the ear height was not affected (Table 7). Accordingly, the ratio of ear height to plant height was reduced with the increased number of leaves above the ear. Both, the number of days to anthesis and silking were slightly increased with the increased number of leaves above the ear.
The effect of leaf number above the ear on ear and plant height and days to anthesis and silking in F.sub.2 segregating populations
Figure imgf000057_0002
LAE = Leaves above the ear
Example 8: The effect of number of leaves above the ear on yield components
The effect of number of leaves above the ear on yield components was studied in F.sub.2 populations of crosses between lines 11-111 or VIGOR B and normal inbred lines. It was shown that the number of leaves above the ear is indicative of the ELE genotype. All other genes, unless closely linked, were randomly segregating among the plants. The test was done in two planting densities, the normal density of about 50,000 plants/ha and at a lower density of about 25,000 plants/ha. Plants with six leave above the ear were used as a reference for normal maize (100%) to avoid the possibility that some of the plants with 5 leaves grew in poor soil conditions. Analysis of the plant populations in the different planting densities revealed that at about 50,000 plants/ha the average ear weight was increased by about 32.3 percent in plants having 9 leaves above the ear as compared with plants with 6 leaves above the ear. The average number of ears per plant was not affected (Table 8). It was further demonstrated by this experiment that this increase was due to both an increase in the number of kernels per ear and the average kernal's weight. At a lower density of about 25,000, the average weight of the first ear was increased by about 20 percent and the average number of ears per plant was increased by about 25.0 percent.
The results described above clearly show that the increased number of leaves above the ear controlled by the ELE1 genetic determinant allele affect is surprisingly associated with the increase of yield and desirable yield components such as the number of kernels per ear and the average kernal's weight.
Table 8: The effect of number of leaves above the ear (LAE) on yield and yield component in F.sub.2 segregating populations
Figure imgf000058_0001
AE = above the ear Example 9: The effect of number of leaves above the ear under stress caused by
Striga hermonthica
A similar approach as described in Example 8 herein above was taken to test the effect of additional leaves above the ear under stress caused by Striga hermonthica. The same F.sub.2 populations as described above were planted in striga infested and non-infested fields. It was revealed that the stress caused by striga reduced the average yield per plant (Table 9). However, the relative yield increase of plants having 6 LAE to plants having 9 LAE was higher under the stress caused by striga. As a result, it is herein clearly shown that the striga tolerance index calculated as the ratio of yield under striga infested and non-infested conditions was increased with the increased number of leaves above the ears. This result indicates that the addition of leaves above the ear, herein shown to be associated with the ELE1 genetic allele, significantly improves stress tolerance of maize plants.
The effect of the number of leaves above the ear (LAE) on maize yield in F.sub.2 populations planted under striga infested and non- infested fields
Figure imgf000059_0001
AE = Above the ear
Str. Tol. Index = Yield under striga infested divided by the yield under striga
infested conditions
Example 10: Yield of ELE hybrids
Several publicly available U.S Corn Belt inbred lines were converted to ELEi /ELEi genotype. The conversion was done by direct selfing of selected F.sub.2 progenies of a cross between the inbred lines and the ELEi /ELEi line for five generation or selfing after one or two cycles of backcrossing. The developed lines were first test-crossed with B73 and Mol7, a well known publically available heterotic U.S Corn Belt lines. ELE hybrids were developed based on the results of the test-crosses. The performance of the ELE hybrids was tested in comparison to the hybrid B73 x Mol7 and two commercially grown hybrids in Israel (Table 10). The results demonstrated the yield superiority of the ELE hybrids compared with the control hybrids. Significant yield increase was obtained, ranging from about 9 to about 36 percent above the normal hybrid B73 x Mol7. It was further shown that the ELE hybrids were similar in maturity to the controls.
Grain yield (T/ha), number of leaves above the ear (LAE) and relative silking of 12 experimental ELE hybrids and 3 control hybrids
Figure imgf000060_0001
AE = Above the ear
1) Average of four replications
2) Number of days to 50% silking relative to B73 x Mol7
3) Yields having the same letter are not significantly different at the 5% level (Newman -Keul' s test)
The leaves No. above the ear (LAE) is ranging between 5-6 LAE in diverse maize line sources. In VIGOR B line crosses the LAE is ranging from 7-9 leaves.
Example 11: Genetic markers This example describes the genetic analysis performed in order to discover novel genetic markers associated with the extra leaves above the ear (LAE) phenotype. The project was designed to meet that challenges by using NRGENE's GenoMAGICTM algorithm package. Genotype by sequencing (GBS) data of 100 F2 segregating population derived from a cross between B73 and ELE line was produced and analyzed using GenoMAGICTM platform. Genotype x phenotype (LAE) association analysis was done and the analysis results are reported herein.
Objectives:
Mapping the genomic region (QTL) affecting leaves No. above the ear (LAE) trait, in a segregating F2 population, of cross between normal maize line B73 and ELE line (i.e. lines 11-111 and VIGOR B), and designing unique DNA markers for the associated QTL. These objectives will provide the following:
• Genomic location of the QTL/s associated with the LAE phenotype.
• Set of unique DNA tags for each discovered QTL. Definitions:
Quantitative trait loci (QTLs) are herein refers to as stretches of DNA containing or linked to the genes that underlie a quantitative trait.
DNA tag is herein defined as a short DNA sequence (up to about 100 bp), such as a sequence surrounding a single base-pair change.
DNA marker set herein refers to a set of DNA tag information that all together represents the uniqueness of the favorable donor line allele vs. other alleles in the evaluated population.
Material and Methods:
Plant materials and phenotypes
An F2 population containing 100 plants from a cross between B73 and ELE line (i.e. lines 11-111 and VIGOR B) were used in this exemplary project.
Phenotypic data of leaves No. above the ear (LAE) was recorded for each analyzed plant.
GBS analysis The F2 individuals and the parental line (ELE line) were genotyped by sequencing (GBS) in average coverage of 0.2x and lx, respectively.
Following the GBS data analysis using NRGENE's GenoMAGICTM platform, the total tags per population after filtration were 10,644,808, and the total segregating tags after filtration were 125,369.
Results:
QTL analysis
The phenotype data and GBS analysis results were processed and analyzed using NRGENE's GenoMAGICTM platform for QTL analysis.
One major QTL (QTL1) was found on the end of chromosome 6:
Location: chromosome-6, between 163,304,486 to 169, 147,729.
Interval size: 5,843,243 bp.
Peak of QTL (top 90%): chromosome-6, between 167,722,310 and 167,901,681. Interval size: 179,371 bp.
R2 of QTL1 : 0.32
P value: 7.4077e-09
LodScore: 8.38
Average homozygote 1 : 7.67 n=27
Average heterozygote: 7.00 n=45
Average homozygote 2: 6.29 n=28
DNA Tags
All tag sequences and following statistics are based on the peak region (179,371 bp) extended with 100 Kb from each side (chromosome-6 167,622,310 16, 801,681).
Total of 45 segregating tags (100 bp long) in the QTL region, were found. From those tags, 9 (SEQ ID No: 1-9) were with the sequence of the donor allele (see Table 11).
Table 11: Location and sequence of the 9 segregating tags Tag Location
SEQ ID Sequence (100 bp)
NO. Chromosome start end
CAGGCCGTCAGATCCAGATGAACGCCTGAGATCTGATGGCGAGCTCGGACTGGT
1 6 167,722,214 167,722,314
TTGCGAACCGGTTCGCTGCGGCACCGCCCGACTCCACGGCGAAGCT
AGCTTCGCCGGAGGCGAGCGCATGGCCACAGCGAGAGTCTGGGGCACTGGGAA
2 6 167,722,310 167,722,410
AAGGCTCAGGCGGGATCGGGGCGACACGACGAACTCAGTCGTGGGTA
AGCTTTGGCACCTGCATAACTTATAGACTAGAGCAAACTAGTTAGTTCAATAATT
3 6 167,732,600 167,732,700
TGTGTTGGGCAATTCAATCACCAAAATCATTTAGGAAAAAGGTGT
GCAGCGCCACACGACCGGATCTACGCTCAGCCACTCGCTGCAACTACAACCCGA
4 6 167,749,885 167,749,985
CGCTACAAGGCACGTTCCTGCAATCTAGAGCTCAACGCGATAAGCT
AGCTTCCCCTGCACGCCGATACTACGCAGATCTCGAATGTCAGGGCACAAGAAG
5 6 167,768,942 167,769,042
ATTGCTCGAGCGGCGAACATTAGTAGCTCCAAGTACTGCATCTATT
TGTCGGGGCTCAGTACCCTTGAGCATGCCCCCCTTAGCTATAAAAGGGGAGGCA
6 6 167,769,059 167,769,159
TGCAACGTTACATTACAGGCTCTGGGAGACTCTGGGCTCTCAAGCT
TGTCGGGGCTCAGTACCCTTTGTGCATGCCCCCTTAGCTATAAAAGGGGAGGCAT
7 6 167,769,059 167,769,159
GCAACGTTACAATATAGGCTCTAGGAGACTCTGGGCTCTCAAGCT
AGCTTCCACAACAATCCAACACACAATGGAGTAGGGTATTACGTTCCGGCGGCT
8 6 167,769,154 167,769,254
CAAACCACTCTAAACCCTCGCGTGTTCATGTGCTCGGTGATCGCCT
ACCGCGTCCAAGCAACGGCTGCGCTAGAGCTTGCCGAACACAACGACACATGT
9 6 167,953,279 167,953,379
GGTCACGTAGTATTGCTTCCAGAGGTCGAACTGGCAGTCGCCAAGCT
Conclusions:
A single QTL with major effect on the LAE phenotype was discovered in a relatively small genomic interval containing a limited number of putative genes (annotated to B73). Nine novel DNA-tags having a nucleotide sequence corresponding to the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 9 have been revealed, co-segregating with the LAE phenotype of the ELE donor line. These novel molecular markers are useful for identifying high yield in maize associated with extra LAE phenotype.
Thus, it is evident by the results disclosed herein that the present invention provides novel and unique molecular markers co-segregating with extra LAE trait. These genetic biomarkers include DNA tag markers identifying extra LAE phenotype surprisingly associated with high yield properties in maize such as increased grain yield, increased kernel weight, increased ear weight, enhanced plant height, improved relative silking time, and striga tolerance as compared to control normal maize line lacking the genetic markers co-segregating with extra LAE trait associated with the ELE1 QTL. Therefore, the markers of Table 11 are useful in detecting high yield maize plants, which exhibit extra LEA phenotype, and screening out low yield plants.
Example 12: Grain and silage maize trials
General details:
Crop: Maize for grain and silage
Trial type: Hybrid seeds
Number of trials: 3
Location: Italy, near Milano (grain and silage trials)
Spain: near Sevilla (grain trial only)
Technical details:
Number of treatments: ELE hybrid (i.e. VII hybrid) + 3 commercial hybrids (lacking the ELE trait) as controls
Number of replicates: 3
Number of applications: 12 plots per trial
Planting: Yes
Plots size: 6 to 7m long for sowing
Rows: 4 rows
Density: According to local use
Trial maintenance:
Trial marking: Yes
Staking: Yes
Labelling: Yes
Harvest: Yes
Samples collection: Yes for silage trials only, to evaluate the % of dry mater
Plot weight: Yes
HLW (weight 100 Ltr (hi)): Yes
Moisture: Yes
Thousand Kernel Weight: No
Assessment:
Date of flowering
Results:
Grain trial: Average grain yield of ELE hybrid: between about 10 ton/hectare and about 20 ton/hectare. More specifically,
Minimum grain yield - 10 ton/hectare
Medium grain yield - 15 ton/hectare
Optimum grain yield - 20 ton/hectare
Silage trial:
Average silage yield of ELE hybrid between about 15 ton/hectare and about 30 ton/hectare. More specifically,
Minimum silage yield - 15 ton/hectare
Medium silage yield - 20 ton/hectare
Optimum silage yield - 30 ton/ hectare
It is demonstrated that the tested ELE hybrid, comprising within it's genome the genetic markers associated with additional LAE phenotype, has significantly increased grain and/or silage yield by about 5% to about 20%, relative to a reference commercial hybrid lacking the ELE trait.

Claims

Claims:
1. A maize plant exhibiting additional leaves above the ear (LAE) architecture, wherein said architecture co-segregates with a molecular marker having a nucleotide sequence corresponding to a nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof.
2. The maize plant of claim 1, wherein said architecture co-segregates with a molecular marker profile selected from the group consisting of: a. at least one molecular marker as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; b. at least two molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; c. at least three molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; d. at least four molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; e. at least five molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; f. at least six molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; g. at least seven molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; h. at least eight molecular markers selected from the group of nucleotide sequences corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9; i. nine molecular markers having a nucleotide sequence corresponding to the nucleotide sequences consisting of SEQ ID NO: l to SEQ ID NO:9; and any combination thereof; further wherein said plant has a higher yield relative to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
3. The maize plant of claim 1, wherein said plant has a molecular marker profile defined by the equation ¾, =∑fL< mjt j), where M is the total number of molecular markers, said molecular markers having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9 and any combination thereof, ;¾,0) is the presence of molecular marker i in maize plant j, and ¾, . is the number of molecular markers in said plant j.
4. The maize plant of claim 3, wherein the yield rank of said plant j relative to a second reference maize plant i is defined by the equation
Figure imgf000067_0001
> where S is the total number of maize plants compared, and R(j) is the yield rank of said plant j relative to said second reference maize plant i.
5. The maize plant of claim 1, wherein said architecture is associated with the ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729.
6. The maize plant of claim 1, wherein said plant architecture is characterized by additional two or three or four leaves above the ear.
7. The maize plant of claim 1, wherein said plant architecture is characterized by up to four additional leaves above the ear.
8. The maize plant of claim 1, wherein said plant architecture is characterized by less than five additional leaves above the ear.
9. The maize plant of claim 1, wherein said plant is a hybrid.
10. The maize plant of claim 1, wherein the genome of said plant comprises a homozygous configuration of said at least one molecular marker.
11. The maize plant of claim 1, wherein the genome of said plant comprises a heterozygous configuration of said at least one molecular marker.
12. The maize plant of claim 1, wherein said at least one molecular marker is independently segregated from Lfy genetic factor.
13. The maize plant of claim 1, wherein said additional LAE architecture is controlled by a genetic determinant which shows a non-recessive inheritance and is co-segregating with said at least one of said molecular marker.
14. The maize plant of claim 13, wherein said genetic determinant is in a heterozygous configuration.
15. The maize plant of claim 14, wherein said heterozygous configuration of said genetic determinant confers at least one heterotic phenotypic effect with respect to high yield in maize.
16. The maize plant according to claim 13, wherein said genetic determinant shows incomplete dominant inheritance with respect to the additional LAE phenotype.
17. The maize plant of claim 13, wherein said genetic determinant is characterized by the presence of at least one ELE1 allele, co-segregating with said at least one molecular marker.
18. The maize plant of claim 17, wherein said plant is heterozygous for the ELE1 allele.
19. The maize plant of claim 17, wherein said plant is homozygous for the ELE1 allele.
20. The maize plant of claim 17, wherein the genome of said plant is characterized by the presence of at least one ELE1 allele is co-segregating with said at least one molecular marker and at least one ELE2 allele lacking said at least one molecular marker.
21. The maize plant of claim 17, wherein said maize plant is characterized by additional leaves above the ear (LAE) architecture in homozygous ELE1/ELE1 genotype configuration as compared with a homozygous ELE2/ELE2 genotype configuration of a normal maize plant.
22. The maize plant of claim 17, wherein said maize plant is characterized by additional leaves above the ear (LAE) architecture in heterozygous ELE1/ELE2 genotype configuration as compared with a homozygous ELE2/ELE2 genotype of normal maize plant.
23. The maize plant of claim 1, wherein the genome of said plant comprises at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, said at least one molecular marker is associated with increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
24. The maize plant of claim 23, wherein said maize plant is characterized by an increased yield of up to 40% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
25. The maize plant of claim 23, wherein said maize plant is characterized by an increased yield of between about 5% and about 20% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
26. The maize plant of claim 23, wherein said maize plant is characterized by an increased yield of about 30% and more, greater than the yield of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
27. The maize plant according to claim 1, wherein said plant has grain yield of at least 10 ton/hectare.
28. The maize plant according to claim 1, wherein said plant has grain yield of about 15 ton/hectare.
29. The maize plant according to claim 1, wherein said plant has grain yield of between about 10 ton/hectare and about 20 ton/hectare.
30. The maize plant according to claim 1, wherein said plant has grain yield of about 20 ton/hectare.
31. The maize plant according to claim 1, wherein said plant has silage yield of at least 15 ton/hectare.
32. The maize plant according to claim 1, wherein said plant has silage yield of about 20 ton/hectare.
33. The maize plant according to claim 1, wherein said plant has silage yield of between about 15 ton/hectare and about 30 ton/hectare.
34. The maize plant according to claim 1, wherein said plant has silage yield of about 30 ton/hectare.
35. The maize plant of claim 1, wherein said maize plant is characterized by an increased plant height without significant effect on ear height.
36. The maize plant of claim 1, wherein said maize plant is characterized by an increased average kernel weight and an increased number of kernels per ear at normal planting density, as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
37. The maize plant of claim 1, wherein said plant has an increased average kernel weight at a normal planting density, as compared to the average kernel weight of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
38. The maize plant of claim 1, wherein said plant has an increased number of kernels per ear at a normal planting density, as compared to the number of kernels per ear of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
39. The maize plant of any one of claims 37 and 38, wherein at a low planting density said plant further exhibits an increased average number of ears per plant as compared to the number of ears per plant of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
40. The maize plant of claim 1, wherein said at least one molecular marker is co- segregating with improved stress tolerance, particularly with improved characteristic selected from the group consisting of: nicking between pollen shed and silk emergence, "Stay Green" characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, increased dry weight yield, adaptation to higher density planting, and any combination thereof.
41. The maize plant of claim 1, wherein said pant exhibits an improved stress tolerance, particularly an improved characteristic selected from a group comprising: nicking between pollen shed and silk emergence, "Stay Green" characteristic (stem lodging resistance), compensation for low stand by improved prolificacy, parasite tolerance, pests tolerance, draught tolerance, earliness, adaptation to higher density planting, and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
42. The maize plant of claim 1, wherein said pant exhibits an increased tolerance to striga, as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
43. The maize plant of claim 42, wherein the tolerance to striga is calculated as the ratio of yield under striga infested and non infested conditions {striga tolerance Index).
44. The maize plant of claim 1, wherein said additional LAE architecture is obtainable from maize line VIGOR B, deposited with NCIMB under accession number 42074, said LAE architecture is co-segregating with said at least one molecular marker.
45. The maize plant of claim 5, which can be obtained from a donor plant comprising said ELE QTL conferring a phenotype with additional leaves above the ear (LAE), particularly maize line VIGOR B, deposited with NCEVIB under accession number 42074, through introgression of said ELE QTL or part thereof into a recipient plant lacking said QTL or part thereof such that said introgressed plant exhibits additional LAE architecture phenotype.
46. Seed of a plant according to any one of claims 1 to 45.
47. Plant material obtainable from a plant according to any one of claims 1 to 46.
48. Plant parts of a plant according to any one of claims 1 to 47.
49. Maize kernels of a plant according to any one of claims 1 to 48.
50. Maize kernels according to claim 49 which are processed kernels.
51. The maize plant according to claim 1, wherein said plant is an inbred, a dihaploid or a hybrid.
52. Pollen of the maize plant of claim 1.
53. An ovule of the plant of claim 1.
54. The maize plant of claim 1 further comprising an additional trait selected from the group consisting of at least one type of disease resistance and at least one type of stress resistance and any combination thereof.
55. The maize plant of claim 1 further comprising an additional trait introduced by genetic transformation.
56. The maize plant, or part thereof, of claim 1, wherein the plant or parts thereof have been transformed so that its genomic material contains one or more transgenes operably linked to one or more regulatory elements.
57. A tissue culture of regenerable cells of a maize plant of claim 1.
58. A tissue culture of claim 57, comprising cells or protoplasts from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruit and seeds.
59. The tissue culture of regenerable cells of claim 57, wherein the tissue regenerates plants exhibiting an additional leaves above the ear (LAE) architecture, said architecture is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
60. A maize plant regenerated from the tissue culture of claim 59, wherein said plant exhibits an additional leaves above the ear (LAE) architecture, said architecture is controlled by a genetic determinant which shows a co-dominant inheritance and co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
61. A hybrid maize plant comprising a co-dominant genetic allele ELE1, wherein said allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE).
62. A hybrid maize plant characterized by an ELE QTL located on chromosome 6 between position 163,304,486 and position 169,147,729, said QTL confers additional leaves above the ear (LAE) phenotype, said genetic determinant is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, and is being capable of transmission to progeny plants substantially as a single non-dominant gene.
63. Maize seed derived from the hybrid maize plant of any one of claims 61 and 62.
64. The maize seed of claim 63, wherein said maize plant is a female parent plant.
65. The maize seed of claim 63, wherein said maize plant is a male parent plant.
66. The maize plant of claim 1, wherein said plant exhibits an improved and more efficient root system as compared to the root system of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
67. A method for producing seed maize with additional leaves above the ear (LAE) architecture, said method comprising the steps of: pollinating a first maize plant with pollen of a second maize plant, wherein at least one of the maize plants possess within its genome at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 co-segregating with additional leaves above the ear (LAE) architecture, and harvesting seeds produced by the pollinated maize plant.
68. The method of claim 67, wherein at least one of the first or second maize plants possesses a homozygous configuration of said at least one molecular marker.
69. The method of claim 67, wherein at least one of the first or second maize plants possesses a heterozygous configuration of said at least one molecular marker.
70. A method of producing a maize plant exhibiting an additional leaves above the ear (LAE) architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, comprising the steps of a. selecting a donor maize plant with additional LAE architecture, and a recipient maize plant with a normal LAE architecture; b. crossing said donor plant with said recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype; c. screening for and selecting from said progeny plants at least one plant exhibiting an additional leaves above the ear architecture, which is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO: 9; and d. optionally, harvesting the resultant progeny seed.
71. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting an increased yield of up to 40% as compared to the yield of a maize plant of similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
72. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting increased yield characteristic greater than a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant, said increased yield characteristic is associated with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:9.
73. The method of claim 72, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting an increased yield of up to 40% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
74. The method of claim 72, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting an increased yield of about 5% to about 20% greater than the yield of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
75. The method of claim 72, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting an increased yield of about 30% and more, greater than the yield of a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
76. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting grain yield of at least 10 ton/hectare.
77. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting grain yield of about 15 ton/hectare.
78. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting grain yield of between about 10 ton/hectare and about 20 ton/hectare.
79. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting grain yield of about 20 ton/hectare.
80. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting silage yield of at least 15 ton/hectare.
81. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting silage yield of about 20 ton/hectare.
82. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting silage yield of between about 15 ton/hectare and about 30 ton/hectare.
83. The method of any one of claims 67 and 70, comprising additional steps of screening for and selecting from said progeny plants at least one plant exhibiting silage yield of about 30 ton/hectare.
84. The method of any one of claims 67 and 70, comprising steps of crossing a donor plant, particularly maize line VIGOR B, deposited with NCIMB under accession number 42074, with a recipient plant to obtain at least one progeny plant exhibiting the additional LAE phenotype, and screening for and selecting from the progeny plants at least one plant exhibiting an additional leaves above the ear phenotype which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9, and, optionally, harvesting the resultant progeny seed.
85. A method for producing hybrid maize seed exhibiting an additional leaves above the ear (LAE) architecture, said method comprising steps of crossing first and second maize plants, wherein at least one of said maize plants is characterized by the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 which is co-segregating with additional leaves above the ear (LAE) phenotype, said at least one molecular marker shows co dominant inheritance.
86. The method according to any one of claims 67- 85, comprising additional steps of self-pollinating a maize plant possessing said at least one molecular marker through at least one generation until said at least one molecular marker is in a homozygous configuration, said at least one molecular marker is co-segregating with a phenotype with additional LAE which is transmittable to progeny as a co- dominant allele.
87. The method according to any one of claims 67- 86, comprising additional steps of backcrossing a maize plant used as a recurrent parent with a second maize plant possessing said at least one molecular marker co-segregating with a phenotype with additional leaves above the ear which is transmissible to progeny as co-dominant allele.
88. The method according to any one of claims 67- 87, obtained by other means then conventional crossing, particularly different types of genetic engineering methods or any other technique.
89. A method for screening for a maize plant exhibiting additional LAE architecture which is co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 comprising the steps of: screening the genome of a maize plant for the presence of at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; said at least one molecular marker co- segregates with additional LAE architecture.
90. Seed maize produced by the method according to any one of claims 67- 89.
91. A maize plant produced by the method according to any one of claims 67- 89.
92. An isolated nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, wherein said isolated nucleotide sequence is co-segregating with additional leaves above the ear (LAE) architecture.
93. The isolated nucleotide sequence according to claim 92, wherein said additional LAE architecture is associated with increased yield properties as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
94. The isolated nucleotide sequence according to claim 93, wherein said increased yield properties are selected from the group consisting of: increased plant height without significant effect on ear height, increased average kernel weight, increased number of kernels per ear, increased average number of ears per plant, increased dry weight yield, improved stress tolerance and any combination thereof, as compared to a second plant with a similar genetic constitution and lacking at least one of said molecular markers of said maize plant.
95. Isolated oligonucleotide sequences annealing with the nucleotide sequence of claim 92, wherein said sequences are suitable for the detection and production of maize plants having additional leaves above the ear (LAE) architecture.
96. Maize genetic markers, sequences or elements, plants, seeds and plant products as described in claims 1-95 for the use in multiple geographical and/or weather- related environments (e.g. tropical, sub-tropic, temperate, etc).
97. Use of an isolated nucleotide sequence having at least 90% sequence identity with the nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO: 9, for detection and production of maize plants having additional leaves above the ear (LAE) architecture.
98. A method for producing inbred maize seed characterized by additional LAE architecture which is co-segregating with a nucleotide sequence corresponding to the nucleotide sequence selected from the group consisting of SEQ ID NO: l to SEQ ID NO:9, said method comprising inbreeding a maize plant which is characterized by said at least one molecular marker, until the genetic composition of the progeny of such inbreeding becomes substantially stable.
99. The method of claim 98 comprising additional steps of : a. crossing a first maize plant that is a hybrid maize plant comprising a co- dominant genetic allele ELE1, wherein said allele is co- segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9 and is capable of conferring a phenotype of additional leaves above the ear (LAE) with a second maize plant used as a recurrent parent to yield first progeny seeds; b. growing the first progeny seed under suitable plant growth conditions to yield an Fl maize plant of the first hybrid plant, said Fl maize plant comprises said co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO:9; and optionally, c. crossing the plant obtained in step (b) with itself or with a third maize plant to yield second progeny seeds derived from said first hybrid plant; d. growing the second progeny seed under suitable plant growth conditions to yield additional maize plant derived of said first hybrid plant, said additional maize plant comprises said co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: l to SEQ ID NO: 9; and further optionally, e. repeating the steps of crossing and growing from (a) to (d) one or more times to generate further maize plants derived from said first hybrid plant, said further maize plants are characterized by the presence of said co-dominant ELE1 genetic allele conferring additional leaves above the ear and co-segregating with at least one molecular marker having a nucleotide sequence corresponding to the nucleotide sequence as set forth in any one of SEQ ID NO: 1 to SEQ ID NO:9.
100. Maize seed produced by the method of claim 99.
101. A maize plant grown from the seed of claim 100.
102. A method for increasing maize yield production to a commercially relevant extent in multiple geographical and/or weather-related environments or areas comprising growing in said geographical area maize plant according to claim 1.
103. A method of producing maize kernels or processed maize kernels as a food product, comprising the steps of:
a. providing a maize plant according to claim 1; b. mutilating or propagating said maize plant; c. allowing the plant to grow corn ears; and, d. harvesting the kernels of said corn ears.
104. Use of the seed deposited under accession number NCIMB 42074 for the production of maize kernels.
105. Use of the maize plant of claim 1 or maize kernels grown from a maize plant according to claim 1 as fresh produce, as fresh cut produce, or for processing such as canning and animal feed and silage preparation.
106. A maize field or maize greenhouse comprising plants of claims 1-66.
PCT/IL2016/050215 2015-03-01 2016-02-29 Markers for high yield in maize WO2016139657A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP16758551.2A EP3264885A4 (en) 2015-03-01 2016-02-29 Markers for high yield in maize

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562126618P 2015-03-01 2015-03-01
US62/126,618 2015-03-01

Publications (1)

Publication Number Publication Date
WO2016139657A1 true WO2016139657A1 (en) 2016-09-09

Family

ID=56848771

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2016/050215 WO2016139657A1 (en) 2015-03-01 2016-02-29 Markers for high yield in maize

Country Status (2)

Country Link
EP (1) EP3264885A4 (en)
WO (1) WO2016139657A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106544423A (en) * 2016-10-31 2017-03-29 中国农业大学 The application of molecular labeling resistant to lodging and its polymorphism in identification corn proterties resistant to lodging
CN114292942A (en) * 2020-10-19 2022-04-08 中国科学院植物研究所 Major QTL for regulating and controlling maize leaf senescence and molecular marker and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014037947A1 (en) * 2012-09-09 2014-03-13 Y.E. Vigor.Corn Production of maize plant with increased yield and additional leaves above the ear archtecture by using non dominant genetic factor

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4513532A (en) * 1983-04-14 1985-04-30 Cornnuts Hybrids, Inc. Genetic factor capable of altering leaf number and distribution in maize
US20080008996A1 (en) * 1999-06-29 2008-01-10 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
WO2009091518A2 (en) * 2008-01-15 2009-07-23 Monsanto Technology, Llc Isolated novel nucleic acid and protein molecules from corn and methods of using those molecules to generate transgenic plant with enhanced agronomic traits

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014037947A1 (en) * 2012-09-09 2014-03-13 Y.E. Vigor.Corn Production of maize plant with increased yield and additional leaves above the ear archtecture by using non dominant genetic factor
US20150173318A1 (en) * 2012-09-09 2015-06-25 Y.E. Vigor.Corn Novel genetic factor capable of increasing yield in maize and method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LI XIN ET AL.: "Genetic analysis of ele mutants and comparative mapping of ele l locus in the control of organ internal asymmetry in garden pea.", JOURNAL OF INTEGRATIVE PLANT BIOLOGY, vol. 52, no. 6, 17 May 2010 (2010-05-17), pages 528 - 535, XP055478535 *
See also references of EP3264885A4 *
SINJUSHIN, A.: "Mutation genetics of pea (Pisum sativum L.): What is done and what is left to do.", RATARSTVO I POVRTARSTVO, vol. 50, no. 2, 28 October 2013 (2013-10-28), pages 36 - 43, XP055478538 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106544423A (en) * 2016-10-31 2017-03-29 中国农业大学 The application of molecular labeling resistant to lodging and its polymorphism in identification corn proterties resistant to lodging
CN114292942A (en) * 2020-10-19 2022-04-08 中国科学院植物研究所 Major QTL for regulating and controlling maize leaf senescence and molecular marker and application thereof
CN114292942B (en) * 2020-10-19 2024-01-30 中国科学院植物研究所 Main effect QTL for regulating and controlling corn leaf senescence, molecular marker and application thereof

Also Published As

Publication number Publication date
EP3264885A4 (en) 2018-08-01
EP3264885A1 (en) 2018-01-10

Similar Documents

Publication Publication Date Title
US10143174B2 (en) Pepper plant
AU2010313913B2 (en) Hybrid seed potato breeding
AU2017239475A1 (en) Hybrid seed potato breeding
US10226014B2 (en) Peronospora resistance in spinacia sp
US10226015B2 (en) Peronospora resistance in Spinacia sp
US20130198884A1 (en) Spinach hybrid variety nun 01084
US20150173318A1 (en) Novel genetic factor capable of increasing yield in maize and method thereof
US10039245B2 (en) High yield tomato plants
US20220295719A1 (en) Prolific flowering watermelon
US20130254914A1 (en) Spinach hybrid variety callisto
EP2244552A1 (en) Methods for improving the yield of cucumber plants
Bishnoi et al. Barley breeding
WO2016139657A1 (en) Markers for high yield in maize
US20230232762A1 (en) Capsicum annuum plants having improved thrips resistance
RU2792674C2 (en) Productive flowering watermelon plant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16758551

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2016758551

Country of ref document: EP