CN111549053B - Method for single nucleotide mutation of cauliflower - Google Patents

Abstract

The invention discloses a method for single nucleotide mutation of cauliflower. The method for single nucleotide mutation of cauliflower disclosed by the invention comprises the following steps: using the following hypocotyl as an explant, performing gene editing on cauliflower by using a BE3 system to obtain the cauliflower with single nucleotide mutation, wherein the cauliflower is cauliflower Korso, the method adopts PHSE901-Basta, the sequence of PHSE901-Basta is a sequence 3 in a sequence table, and the concentration of a bacterial liquid infecting the explant meets OD₆₀₀The value was 0.1. The ALS gene and the CENH3 gene of cauliflower Korso are subjected to single nucleotide mutation by using the method disclosed by the invention, and the editing efficiencies of the ALS gene and the CENH3 gene are respectively 24.7% and 80.0%. The invention provides an effective technical means in the aspects of germplasm improvement of cauliflower and brassica vegetables, gene separation based on a mutant library, gene function verification and the like.

Description

Method for single nucleotide mutation of cauliflower

Technical Field

The invention relates to a method for single nucleotide mutation of cauliflower, belonging to the technical field of agricultural biology.

Background

Broccoli (Brassica oleracea var. botrytis) is a widely cultivated Brassica vegetable of the brassicaceae family. It has strong self-incompatibility and needs long-term vernalization and low-temperature induction for flowering. These properties significantly increase the difficulty of using physical or chemical mutagens to induce mutations and create new germplasm. Brassica vegetable crops are important vegetable groups, and along with the completion of whole genome sequencing and functional genome research of Chinese cabbages and cabbages, how to utilize functional gene editing mutation and directionally and genetically improve the existing germplasm becomes one of the most important subjects in the field of genetic breeding.

Gene editing technology can carry out efficient, accurate and specific modification on plant genomes. In particular to CRISPR/Cas9, and provides a revolutionary solution for creating targeted point mutation and germplasm innovation.

Mutations at several key sites in the ALS gene, i.e. the acetolactate synthase gene, at different sites of which single nucleotides are mutated, result in the alteration of the encoded amino acids, which may confer herbicide resistance to the plant, CENH3 (centromere-specific histone H3 variant) gene, which may affect the centromere localization function of its protein and may induce the material to be hybridized with it to be haploid. The single nucleotide mutation of the two genes can generate available excellent phenotypes, and the method has extremely high breeding application value.

Disclosure of Invention

The invention provides a high-efficiency, stable and simple technical method for creating site-specific mutation by gene editing aiming at the defects of the conventional cauliflower transgenosis and gene editing technology.

The invention provides a method for single nucleotide mutation of a cauliflower gene, which comprises the following steps: using the hypocotyl as an explant, and carrying out gene editing on the cauliflower by utilizing a BE3 system to obtain the cauliflower with single nucleotide mutation.

In the above method, the cauliflower may be cauliflower Korso.

In the method, the gene editing can be carried out by adopting PHSE901-Basta, and the sequence of the PHSE901-Basta is a sequence 3 in a sequence table.

In the method, the concentration of the bacterial liquid infecting the explant can meet OD₆₀₀The value was 0.1.

The above method used Basta for screening.

The co-culture medium used in the above method may be a culture medium obtained by adding 6-BA and NAA to MS medium, the concentrations of 6-BA and NAA in the co-culture medium being 3mg/L and 0.1mg/L, respectively.

The screening medium used in the above method may be a medium obtained by adding Basta and carbenicillin to the co-culture medium, the concentrations of Basta and carbenicillin in the screening medium being 3mg/L and 300mg/L, respectively.

The bud elongation medium used in the above method may be a medium obtained by adding Basta and carbenicillin to an MS medium, the concentrations of Basta and carbenicillin in the bud elongation medium being 3mg/L and 200mg/L, respectively.

In the above method, the gene may be an ALS gene or a CENH3 gene.

In the above method, the gene is an ALS gene, and the target sequence may be sequence 1 in a sequence table;

the gene is CENH3 gene, and the target sequence can be sequence 2 in the sequence table.

Specifically, the method for mutating the single nucleotide of the cauliflower gene is a method for mutating the single nucleotide of an ALS gene in the cauliflower Korso or a method for mutating the single nucleotide of a CENH3 gene in the cauliflower Korso.

The method for mutating the single nucleotide of the ALS gene in the cauliflower Korso can comprise the following steps: will OD₆₀₀The EHA105/PHSE901-Basta-ALS bacterial liquid with the value of 0.1 infects hypocotyls of the cauliflower Korso to obtain an infected explant; co-culturing the infected explant in the co-culture medium to obtain a co-cultured explant; screening the explants subjected to co-culture in the screening culture medium to obtain resistant buds; culturing the resistant bud in the bud elongation culture medium to obtain a resistant seedling, and detecting the ALS gene of the resistant seedling to obtain cauliflower with the ALS gene having single nucleotide mutation;

the EHA105/PHSE901-Basta-ALS is a recombinant strain obtained by introducing PHSE901-Basta-ALS into an agrobacterium EHA105, and the PHSE901-Basta-ALS is a recombinant vector obtained by inserting double-stranded DNA shown in a sequence 1 in a sequence table into the PHSE901-Basta by BsaI.

The ALS gene may have a single nucleotide mutation of C₆C₇C₈-T₆T₇T₈、C₆C₇C₈-T₆T₇C₈、C₆C₇C₈-C₆T₇T₈、C₆C₇C₈-T₆C₇T₈、C₆C₇C₈-C₆T₇C₈Or C₆C₇C₈-T₆C₇C₈；

Said C is₆C₇C₈-T₆T₇T₈The 5 th to 7 th cytosine deoxynucleotides in a sequence 1 in the ALS gene are mutated into thymine deoxynucleotides; said C is₆C₇C₈-T₆T₇C₈In the ALS gene, the 5 th and 6 th cytosine deoxynucleotides in the sequence 1 are mutated into thymine deoxynucleotides; said C is₆C₇C₈-C₆T₇T₈In the ALS gene, the cytosine deoxynucleotides at the 6 th site and the 7 th site of the sequence 1 are mutated into thymine deoxynucleotides; said C is₆C₇C₈-T₆C₇T₈In the ALS gene, the 5 th and 7 th cytosine deoxynucleotides in the sequence 1 are mutated into thymine deoxynucleotides; said C is₆C₇C₈-C₆T₇C₈In order to mutate cytosine deoxynucleotide at the 6 th site of the sequence 1 in the ALS gene into thymine deoxynucleotide; said C is₆C₇C₈-T₆C₇C₈In order to mutate cytosine deoxynucleotide at the 5 th site of the sequence 1 in the ALS gene into thymine deoxynucleotide.

The method for single nucleotide mutation of the CENH3 gene in the cauliflower Korso can comprise the following steps: will OD₆₀₀The bacterial liquid EHA105/PHSE901-Basta-CENH3 with the value of 0.1 infects hypocotyls of the cauliflower Korso to obtain an infected explant; co-culturing the infected explant in the co-culture medium to obtain a co-cultured explant; screening the co-cultured explant in the screening culture medium to obtain the antibodySexual buds; culturing the resistant bud in the bud elongation culture medium to obtain a resistant seedling, and detecting the ALS gene of the resistant seedling to obtain cauliflower with the ALS gene having single nucleotide mutation;

the EHA105/PHSE901-Basta-CENH3 is a recombinant strain obtained by introducing PHSE901-Basta-CENH3 into agrobacterium EHA105, and the PHSE901-Basta-CENH3 is a recombinant vector obtained by inserting double-stranded DNA shown in a sequence 2 in a sequence table into the PHSE901-Basta by BsaI.

The mononucleotide mutation of the CENH3 gene can be realized by mutating cytosine deoxynucleotide at the 4 th site of the sequence 2 in the CENH3 gene into thymine deoxynucleotide.

The application of the method for single nucleotide mutation of the cauliflower gene in the breeding of the cauliflower also belongs to the protection scope of the invention.

The invention also provides a kit for the editing of cauliflower menus, which consists of the PHSE901-Basta, the co-culture medium, the screening medium and the bud elongation medium.

In the present invention, the cauliflower may be cauliflower Korso.

The invention successfully obtains the cauliflower with the ALS gene and the CENH3 gene having single nucleotide mutation by taking the cauliflower hypocotyl as an explant and transforming by an agrobacterium-mediated method, wherein the editing efficiencies of the ALS gene and the CENH3 gene are respectively 24.7 percent and 80.0 percent. The invention provides an effective technical means in the aspects of germplasm improvement of cauliflower or brassica vegetables, gene separation based on a mutant library, gene function verification and the like.

Drawings

FIG. 1 shows regeneration of explant shoots after 2 weeks of TDZ medium culture.

FIG. 2 shows explants cultured in TDZ medium.

FIG. 3 shows explant shoot regeneration after 2 weeks of 6-BA medium culture.

FIG. 4 shows GUS staining of hypocotyls infected with suspensions of different concentrations of bacterial body weight.

FIG. 5 shows the acquisition of transformation resistant seedlings with cauliflower hypocotyls as explants. A. B is Basta screening culture after the hypocotyl explant agrobacterium infection; c is a transformant (namely a resistant regeneration plant) which is detected to be positive by a Basta test strip.

FIG. 6 shows PCR detection of T0 generation plants. The first and second rows are PCR products of gRNA-IDF and gRNA-IDR, and the third row is PCR products of nCas9-IDF and nCas 9-IDR. M: the leftmost is the standard DNA molecular weight (Trans 2K plus DNA Marker); +: positive control (engineered), CK: negative control (untransformed cauliflower DNA); ntc: control without template; the other lanes are the detection results of the resistant regenerated plants, and the positive seedlings are the same as the positive control bands.

FIG. 7 shows the single base editing and identification of cauliflower. a: korso (Ko) and Arabidopsis thaliana (At) ALS gene target sequence comparison, UGG is PAM region, three nucleotides in red font are target change sites, namely proline (P) 182 th coding site of ALS, and cytosine deoxynucleotide in 4-9 th position in a box can be mutated into thymine deoxynucleotide. b: korso (Ko) and Arabidopsis thaliana (At) CENH3 gene target sequence comparisons. c: related structures are edited for genes in the recombinant vector. d and e: PCR sequencing of two gene-editing strains respectively shows that C-T mutation occurs at the target site.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.

The broccoli Korso (Wang et al, Production and characterization of organic fibrous composites between plants, bothritis and B. nigra and hair developers for the selection of advanced pre-drying materials, Plant Cell Rep (2011)30: 1811-.

WX100, R8 and XLH65 in The following examples are described in The literature (Zhu et al, The Genetic Diversity and Relationships of Cauliflower (Brassica Oleracea var. Borrytis) incorporated Lines used by SSR Markers, PLoS One, December 6,2018; 13(12) e0208551.doi:10.1371/journal. hole. 0208551), and The biological material is publicly available from The Applicant, and is only used for repeating The experiments related to The present invention, and is not available for other uses.

The cauliflower in the following examples is also a product of Xiamen vegetable seed Co.

The broccoli Taisong in the following examples is a product of Zhejiang Shen Hainan Prolate Co.

The following examples of broccoli flourishing pine are products of cultivator and breeding industries, ltd.

Example 1 optimization of Gene editing conditions and materials for Cauliflower

Selection of Gene editing Material

Comparison of shoot regeneration capacity was performed with hypocotyls and petioled cotyledons of 7 cauliflower (Korso, WX100, R8, XLH65, shanmei, taisong, shensong) as explants. The method comprises the following steps:

1. selecting healthy and plump seeds, cleaning the seeds for 1 time by sterile water, soaking the seeds in 70 percent (v/v) ethanol water solution for 30 seconds, and washing the seeds for 2 times by the sterile water; sterilizing with 3% sodium hypochlorite for 15min (adding 2-3 drops of Tween-20, keeping out of the sun, covering with sealing film, and shaking continuously); rinsed with sterile water about 4 times (no visible foam) and blown dry on sterilized filter paper.

2. Transferring the sterilized seeds into a germination culture medium (namely an MS culture medium), carrying out light-shielding culture (weak light) for 3-4d, growing hypocotyls to be about 3cm, cutting growing points at two ends when cotyledons are not unfolded, cutting into 3-5mm small sections, and horizontally placing on a differentiation culture medium (a culture medium obtained by adding 6-BA and NAA into the MS culture medium, wherein the concentrations of the 6-BA and the NAA are respectively 3mg/L and 0.1mg/L) for culture. When the cotyledon with stalk is an explant, the cotyledon growth point is cut off with a sharp blade and the cotyledon stalk is retained to the maximum extent, and the cotyledon with stalk is inserted into a differentiation medium.

3. Culturing at 25-28 ℃ for 12h/d at 2000Lx, and subculturing for 1 time every 2 weeks. Counting the number of adventitious buds after 4 weeks, calculating the bud regeneration rate, wherein the bud regeneration rate is the bud generation number/explant number multiplied by 100%, and selecting a high-efficiency bud regeneration material.

The results are shown in tables 1 and 2, and it can be seen that Korso has significantly better regeneration capacity than other materials, and the regeneration rate of buds exceeds 85% whether the cotyledon with stalk or hypocotyl is the explant. Is the first choice material for subsequent gene editing research.

TABLE 1 regeneration of explants buds with petiole leaves from different genes

TABLE 2 regeneration of hypocotyl explant shoots of different genotypes

Selection of culture medium

The Korso hypocotyl is used as an explant, and the influence of different differentiation media on the regeneration bud is compared, wherein the differentiation media are TDZ media and BA media.

TDZ culture medium: in the medium obtained by adding TDZ and NAA to the MS medium, the concentrations of TDZ and NAA in the medium were 0.2mg/L and 0.1mg/L, respectively.

BA medium: for the culture medium obtained by adding 6-BA and NAA to the MS culture medium, the concentrations of 6-BA and NAA in the culture medium were 3mg/L and 0.1mg/L, respectively.

1. Selecting healthy and plump seeds, cleaning the seeds for 1 time by sterile water, soaking the seeds in 70 percent (v/v) ethanol water solution for 30 seconds, and washing the seeds for 2 times by the sterile water; sterilizing with 3% sodium hypochlorite for 15min (adding 2-3 drops of Tween-20, keeping out of the sun, covering with sealing film, and shaking continuously); rinsed with sterile water about 4 times (no visible foam) and blown dry on sterilized filter paper.

2. Transferring the sterilized seeds into a germination culture medium (namely an MS culture medium), carrying out light-shielding culture (weak light) for 3-4d, wherein the hypocotyl grows to be about 3cm, cutting growth points at two ends of the hypocotyl by a sharp blade when cotyledons are not unfolded, cutting 3-5mm small sections, and horizontally placing the small sections on a differentiation culture medium for culture.

3. Culturing at 25-28 ℃ for 12h/d at 2000Lx, and subculturing for 1 time every 2 weeks. Counting the number of buds after 4 weeks, calculating the adventitious bud regeneration rate, wherein the bud regeneration rate is the bud generation number/explant number multiplied by 100%, and selecting a proper hormone ratio.

Counting the number of shoots and calculating the regeneration efficiency, the results showed that TDZ medium was inferior to BA medium in terms of the maximum number of shoots of a single explant and the frequency of explants with adventitious bud formation, and that the former was prone to regenerate a large amount of white callus, had more vitrified adventitious buds and had more malformed buds (Table 3, FIGS. 1-3).

TABLE 3 Effect of different hormone ratios on adventitious bud regeneration

In table 1, wherein regeneration efficiency is the number of explants with shoot initiation/number of explants × 100%.

Thirdly, selecting infection concentration of bacterial liquid

In the following steps, the cultivation was carried out at 28 ℃ for 12 hours of light/12 hours of dark, unless otherwise specified.

1. The pBI121 vector is introduced into agrobacterium EHA105 to obtain recombinant strain EHA105/pBI 121.

2. Selecting healthy and plump Korso seeds, washing the seeds with sterile water for 1 time, soaking the seeds in 70% (v/v) ethanol water solution for 30 seconds, and washing the seeds with sterile water for 2 times; sterilizing with 3% sodium hypochlorite for 15min (adding 2-3 drops of Tween-20, keeping out of the sun, covering with sealing film, and shaking continuously); rinsing with sterile water for about 4 times (no significant foam), and blow-drying on sterilized filter paper to obtain sterilized seeds.

3. After the step 1 is finished, transferring the disinfected seeds into a germination culture medium (namely an MS culture medium), carrying out shading culture (weak light) for 3-4d, enabling hypocotyls to grow to be about 3cm, cutting growing points at two ends of the hypocotyls by a sharp blade, cutting 3-5mm small sections, horizontally placing the small sections on a pre-culture medium (the culture medium obtained by adding 6-BA and NAA into the MS culture medium, wherein the concentrations of the 6-BA and the NAA are respectively 3mg/L and 0.1mg/L), and carrying out weak light pre-culture for 2 days to obtain the pre-cultured hypocotyls.

4. The recombinant strain EHA105/pBI121 was inoculated into 10mL of LB medium containing 50mg/L kanamycin and 25mg/L rifampicin, and shaken overnight at 28 ℃ to obtain a bacterial solution.

5. After the step 3 is finished, transferring the bacterial liquid into a centrifugal tube at 2000rpm for 15min, abandoning the supernatant, collecting the precipitate, carrying out heavy suspension on the supernatant by using a liquid MS culture medium on a super clean bench, and then measuring OD₆₀₀Value, adjustment of OD₆₀₀Values of 0.1, 0.3 and 0.5, respectively, gave a bacterial body weight suspension.

6. And (3) putting the hypocotyls after the pre-culture in the step (2) into a culture dish containing 2ml of liquid MS culture medium, sucking out the liquid culture medium after all the hypocotyls are transferred, then adding the bacterial suspension in the step (4), infecting for 5min, taking out all the explants after infection, placing the explants on sterile filter paper, and drying the bacterial solution to obtain the explants infected by the bacterial solutions with different concentrations.

7. Culturing explants infected by bacterial liquids with different concentrations in a co-culture medium (the co-culture medium is a culture medium obtained by adding 6-BA and NAA into an MS culture medium, the concentrations of the 6-BA and the NAA are respectively 3mg/L and 0.1mg/L), carrying out GUS staining after two days, observing the infection conditions of the bacterial liquids with different concentrations, and using uninfected explants as a reference.

The results are shown in FIG. 4, showing OD₆₀₀The bacterial heavy suspension with the infection effect of 0.1 is the best, and the transformation efficiency is the highest.

Example 2 Gene editing of cauliflower

In this example, a plant with single nucleotide mutations of an ALS gene (acetolactate synthase gene) and a CENH3 gene (centromere-specific histone H3 variant gene) of broccoli was constructed, and a double-stranded DNA fragment shown as sequence 1 in the ALS gene and a double-stranded DNA fragment shown as sequence 2 in the CENH3 gene were used as single nucleotide mutation targets, and the specific steps were as follows:

first, construction of recombinant vector

Four single-stranded DNAs were synthesized as follows:

ALS-F：5′-ATTGAGGTCCCTCGCCGGATGAT-3′，ALS-R：5′-AAACATCATCCGGCGAGGGACCT-3′；

CENH3-F：5′-ATTGGCTCTTATGGCTATTCAAG-3′，CENH3-R：5′-AAACCTTGAATAGCCATAAGAGC-3′。

6 mu L of ALS-F and ALS-R are respectively and uniformly mixed in an equimolar way to be used for touch down PCR, the reaction conditions are 95 ℃/10min, 95 ℃/1min and 70 cycles, the temperature of each cycle is reduced by 1 ℃, and the temperature is reduced by 16 ℃ to finish, thus obtaining ALS target double-stranded DNA with BsaI enzyme digestion joint. The CENH3 target double-stranded DNA was obtained in the same manner.

Cutting a PHSE901-Basta (the sequence of which is sequence 3 in a sequence table) vector by using an endonuclease BsaI, recovering a vector framework, connecting the vector framework and ALS target double-stranded DNA, and marking the obtained recombinant vector with a correct sequence as PHSE 901-Basta-ALS; and connecting the vector framework and CENH3 target double-stranded DNA, and recording the obtained recombinant vector with a correct sequence as PHSE901-Basta-CENH 3.

Wherein, the 338-808 th site of the sequence 3 is a U6-26p promoter, the 1900-1975 th site is a sgRNA framework sequence, the 1994-2323 site is a U6-26t terminator, the 3818-7918 th site is a BE3 gene, and the 9917-10469 th site is a Bar gene.

Second, construction of recombinant bacteria

The obtained recombinant vector PHSE901-Basta-ALS is introduced into the agrobacterium EHA105 to obtain a recombinant strain EHA105/PHSE901-Basta-ALS, the obtained recombinant vector PHSE901-Basta-CENH3 is introduced into the agrobacterium EHA105 to obtain a recombinant strain EHA105/PHSE901-Basta-CENH3, and the starting vector PHSE901-Basta is introduced into the agrobacterium EHA105 to obtain an empty vector control recombinant strain.

Third, construction of transgenic plants

And (3) respectively utilizing the recombinant bacteria EHA105/PHSE901-Basta-ALS, EHA105/PHSE901-Basta-CENH3 and the empty vector control recombinant bacteria obtained in the step two to construct transgenic plants, wherein the following steps are carried out under the conditions of 28 ℃, 12h of light and 12h of darkness if no special instruction exists.

1. Selecting healthy and plump cauliflower Korso seeds, washing with sterile water for 1 time, soaking in 70% (v/v) ethanol water solution for 30S, and washing with sterile water for 2 times; sterilizing with 3% sodium hypochlorite for 15min (adding 2-3 drops of Tween-20, keeping out of the sun, covering with sealing film, and shaking continuously); rinsing with sterile water for about 4 times (no significant foam), and blow-drying on sterilized filter paper to obtain sterilized seeds.

2. After the step 1 is finished, transferring the disinfected seeds into a germination culture medium (namely an MS culture medium), carrying out shading culture (weak light) for 3-4d, enabling hypocotyls to grow to be about 3cm, cutting growing points at two ends of the hypocotyls by a sharp blade, cutting 3-5mm small sections to be used as explants, horizontally placing the explants on a pre-culture medium (the culture medium obtained by adding 6-BA and NAA into the MS culture medium, wherein the concentrations of the 6-BA and the NAA are respectively 3mg/L and 0.1mg/L), and carrying out weak light pre-culture for 2 days to obtain the pre-cultured hypocotyls.

3. The recombinant bacteria were inoculated into 10mL LB medium containing 50mg/L kanamycin and 25mg/L rifampicin, and shaken overnight at 28 ℃ to obtain a bacterial solution.

4. After the step 3 is finished, transferring the bacterial liquid into a centrifugal tube at 2000rpm for 15min, abandoning the supernatant, collecting the precipitate, carrying out heavy suspension on the supernatant by using a liquid MS culture medium on a super clean bench, and then measuring OD₆₀₀Value, adjustment of OD₆₀₀The value was 0.1, and a bacterial suspension was obtained.

5. And (3) putting the hypocotyls subjected to the pre-culture in the step (2) into a culture dish containing 2ml of liquid MS culture medium, sucking out the liquid culture medium after all the hypocotyls are transferred, then adding the bacterial suspension in the step (4), infecting for 5min, taking out all the explants after infection, placing the explants on sterile filter paper, and drying the bacterial solution to obtain the infected explants.

6. And (4) respectively transferring the explants infected in the step (5) to a co-culture medium (the co-culture medium is a culture medium obtained by adding 6-BA and NAA into an MS culture medium, and the concentrations of the 6-BA and the NAA are respectively 3mg/L and 0.1mg/L), and carrying out co-culture for 2 days in the dark.

7. After completion of step 6, the explants which had not been infected with the bacteria and had been co-cultured with good growth were transferred to screening Medium 1 (a medium obtained by adding Basta and carbenicillin (Cb) to the co-culture medium at concentrations of 3mg/L and 300mg/L, respectively) for screening. During the screening period, the culture medium is changed once a week, and the resistant buds are obtained after the screening for 3-6 weeks.

8. Transferring the screened resistant buds to a bud elongation culture medium (a culture medium obtained by adding Basta and carbenicillin (Cb) to an MS culture medium, wherein the concentrations of the Basta and the carbenicillin (Cb) are respectively 3mg/L and 200mg/L) for continuous growth, and changing the culture medium once after 2 weeks until rooting and seedling emergence (A and B in figure 5) are realized, thus obtaining the resistant seedlings.

The obtained resistant seedlings were further tested and screened using a Basta test strip to obtain resistant regenerated plants (FIG. 5, C).

9. PCR detection of resistant regenerated plants: resistant strain genomic DNA was extracted by CTAB method, and then the Cas9 and gRNA regions of the regenerated strain were identified by PCR and screened to obtain positive seedlings (FIG. 6). The primer sequences are as follows:

nCas9-IDF：5′-CATACCTCCCAGAACACAAATAAGC-3′；

nCas9-IDR：5′-ACTGAAGGGCAATAGTGAAGAATGT-3′；

gRNA-IDF：5′-TGTCCCAGGATTAGAATGATTAGGC-3′；

gRNA-IDR：5′-CCCCAGAAATTGAACGCCGAAGAAC-3′。

10. and performing PCR amplification on the positive seedling target editing section obtained by identification, sequencing the obtained PCR product (figure 7), and analyzing the gene editing result. Primers used for detecting ALS gene editing conditions are as follows: AlS 7: 5'-AAGAACAAGACTTTCGTCTCCC-3', respectively; AlS 762: 5 '-CCCCATCAAAGTACTCGCAA 3'; primers used for detecting CENH3 gene editing condition are as follows: CENH 3-245: 5 '-GTTACAAGCCTGGAACCGTTGC 3'; CENH 3-457: GCATAGCATCAGAGAACAAGCC 3'.

Fourth, result analysis

In step 9 of the third step, 85 ALS gene editing positive seedlings verified by PCR were obtained, and 120 CENH3 gene editing positive seedlings were obtained.

The PCR sequencing results (fig. 7) for the target gene show that: 21 out of 85 positive seedlings for editing ALS gene have ALS gene single base substitution mutation, and the mutation type is C, and the percentage of the plants subjected to gene editing is 24.7 percent₆C₇C₈-T₆T₇T₈(i.e., in the sequence listingCytosine deoxynucleotide at 5 th to 7 th positions of the sequence 1 is mutated into thymine deoxynucleotide) is 9 strains, and the mutation type is C₆C₇C₈-T₆T₇C₈(i.e. the 5 th and 6 th cytosine deoxynucleotides in the sequence 1 in the sequence table are all mutated into thymine deoxynucleotides) are 5 strains, and the mutation type is C₆C₇C₈-C₆T₇T₈(i.e. the 6 th and 7 th cytosine deoxynucleotides in the sequence 1 in the sequence table are all mutated into thymine deoxynucleotides) are 3 strains, and the mutation type is C₆C₇C₈-T₆C₇T₈(i.e. the 5 th and 7 th cytosine deoxynucleotides in the sequence 1 in the sequence table are all mutated into thymine deoxynucleotides) is 1 strain, and the mutation type is C₆C₇C₈-C₆T₇C₈(i.e. the 6 th cytosine deoxynucleotide in the sequence 1 in the sequence table is mutated into thymine deoxynucleotide) is 1 strain, and the mutation type is C₆C₇C₈-T₆C₇C₈(i.e. the 5 th cytosine deoxynucleotide in the sequence 1 in the sequence table is mutated into thymine deoxynucleotide) is 2 strains.

96 positive seedlings edited by the CENH3 gene of 120 plants have single base substitution mutation, the gene-edited plants account for 80.0%, and the mutation is that the 4 th cytosine deoxynucleotide of the sequence 2 in the sequence table is mutated into thymine deoxynucleotide. The ALS gene and the CENH3 gene in the plants treated by the empty vector control recombinant bacteria are not changed.

The transformation efficiencies (number of positive seedlings/number of explants x 100%) when ALS gene-edited regenerated plants and CENH3 gene-edited regenerated plants were prepared were 16.7% and 17.2%, respectively. The editing efficiency of ALS gene and CENH3 gene was 24.7% and 80.0% (number of plants edited by base substitution/number of positive seedlings x 100%), respectively. Therefore, the method can efficiently create the mononucleotide site-directed mutant plant in the cauliflower seeds.

Fifth, comparison of genetic transformation efficiency of different explants

According to the method of the third step, the screening time in the step 7 is changed to 20 days, and other steps are not changed. The result shows that the bud generation and regeneration seedlings with the following hypocotyls as explants have good growth states, the difference between the screened dead seedlings and the survival seedlings is obvious, the false positive is low, and the transformation efficiency is between 12.4% and 17.6%.

According to the method of the third step, cotyledons with stalks are selected as explants in the step 2, and the screening time in the step 7 is 35 days. The result shows that when the cotyledon with the stalk is taken as the explant, the selection needs longer time, the false positive seedlings can be better removed after 35 days of selection, and the transformation efficiency is lower than that of the hypocotyl and is between 4.2 and 7.2 percent. Therefore, the hypocotyl is used as an explant, so that the efficient transformation and editing mutant strain can be obtained.

Sixth, comparison of different screening Agents

According to the method of the first step to the third step, PHSE901-Basta is replaced by PHSE901-Kana (PHSE901-Kana is a recombinant vector obtained by replacing a resistance gene in PHSE901-Basta with a Kana gene), cauliflower Korso hypocotyls are used as explants, and 7 in the third step are respectively screened by using a screening culture medium 1 and a screening culture medium 2, wherein the screening culture medium 2 is a culture medium obtained by adding kanamycin and carbenicillin into a co-culture medium, and the concentrations of kanamycin and carbenicillin are respectively 50mg/L and 300 mg/L.

The result shows that the seedling vitrification is easy to occur when the screening culture medium 2 is used for screening, the growth and the survival of the regenerated seedling are influenced, the quantity of the regenerated seedling is less than that of the regenerated seedling transformed by the Bar screening marker, and the transformation efficiency is low.

In conclusion, the cauliflower Korso hypocotyl explant is obtained through a comparison test under different conditions, agrobacterium tumefaciens OD0.1 is used as the optimal infection concentration, Bar is used as a transformation screening marker, and the optimized culture medium is used for carrying out mutation on the cauliflower menuin base, so that the method has good application value.

<110> agriculture and forestry academy of sciences of Beijing City

<120> method for single nucleotide mutation of cauliflower

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> cauliflower (Brassica oleracea var. botrytis)

<400> 1

aggtccctcg ccggatgat 19

<210> 2

<211> 19

<212> DNA

<213> cauliflower (Brassica oleracea var. botrytis)

<400> 2

gctcttatgg ctattcaag 19

<210> 3

<211> 17040

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

gtttacccgc caatatatcc tgtcaaacac tgatagttta aactgaaggc gggaaacgac 60

aatctgatcc aagctcaagc tgctctagca ttcgccattc aggctgcgca actgttggga 120

agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc 180

aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc 240

cagtgccaag cttcgacttg ccttccgcac aatacatcat ttcttcttag ctttttttct 300

tcttcttcgt tcatacagtt tttttttgtt tatcagctta cattttcttg aaccgtagct 360

ttcgttttct tctttttaac tttccattcg gagtttttgt atcttgtttc atagtttgtc 420

ccaggattag aatgattagg catcgaacct tcaagaattt gattgaataa aacatcttca 480

ttcttaagat atgaagataa tcttcaaaag gcccctggga atctgaaaga agagaagcag 540

gcccatttat atgggaaaga acaatagtat ttcttatata ggcccattta agttgaaaac 600

aatcttcaaa agtcccacat cgcttagata agaaaacgaa gctgagttta tatacagcta 660

gagtcgaagt agtgattggg agaccaaccc agtggacata agcctgttcg gttcgtaagc 720

tgtaatgcaa gtagcgtatg cgctcacgca actggtccag aaccttgacc gaacgcagcg 780

gtggtaacgg cgcagtggcg gttttcatgg cttgttatga ctgttttttt ggggtacagt 840

ctatgcctcg ggcatccaag cagcaagcgc gttacgccgt gggtcgatgt ttgatgttat 900

ggagcagcaa cgatgttacg cagcagggca gtcgccctaa aacaaagtta aacatcatgg 960

gggaagcggt gatcgccgaa gtatcgactc aactatcaga ggtagttggc gtcatcgagc 1020

gccatctcga accgacgttg ctggccgtac atttgtacgg ctccgcagtg gatggcggcc 1080

tgaagccaca cagtgatatt gatttgctgg ttacggtgac cgtaaggctt gatgaaacaa 1140

cgcggcgagc tttgatcaac gaccttttgg aaacttcggc ttcccctgga gagagcgaga 1200

ttctccgcgc tgtagaagtc accattgttg tgcacgacga catcattccg tggcgttatc 1260

cagctaagcg cgaactgcaa tttggagaat ggcagcgcaa tgacattctt gcaggtatct 1320

tcgagccagc cacgatcgac attgatctgg ctatcttgct gacaaaagca agagaacata 1380

gcgttgcctt ggtaggtcca gcggcggagg aactctttga tccggttcct gaacaggatc 1440

tatttgaggc gctaaatgaa accttaacgc tatggaactc gccgcccgac tgggctggcg 1500

atgagcgaaa tgtagtgctt acgttgtccc gcatttggta cagcgcagta accggcaaaa 1560

tcgcgccgaa ggatgtcgct gccgactggg caatggagcg cctgccggcc cagtatcagc 1620

ccgtcatact tgaagctaga caggcttatc ttggacaaga agaagatcgc ttggcctcgc 1680

gcgcagatca gttggaagaa tttgtccact acgtgaaagg cgagatcacc aaggtagtcg 1740

gcaaataatg tctagctaga aattcgttca agccgacgcc gcttcgcggc gcggcttaac 1800

tcaagcgtta gatgcactaa gcacataatt gctcacagcc aaactatcag gtcaagtctg 1860

cttttattat ttttaagcgt gcataataag ccggtctcgg ttttagagct agaaatagca 1920

agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 1980

tttgcaaaat tttccagatc gatttcttct tcctctgttc ttcggcgttc aatttctggg 2040

gttttctctt cgttttctgt aactgaaacc taaaatttga cctaaaaaaa atctcaaata 2100

atatgattca gtggttttgt acttttcagt tagttgagtt ttgcagttcc gatgagataa 2160

accaataagc ttgcatgcct gcaggtcaac atggtggagc acgacacact tgtctactcc 2220

aaaaatatca aagatacagt ctcagaagac caaagggcaa ttgagacttt tcaacaaagg 2280

gtaatatccg gaaacctcct cggattccat tgcccagcta tctgtcactt tattgtgaag 2340

atagtggaaa aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg aaaggccatc 2400

gttgaagatg cctctgccga cagtggtccc aaagatggac ccccacccac gaggagcatc 2460

gtggaaaaag aagacgttcc aaccacgtct tcaaagcaag tggattgatg tgataacatg 2520

gtggagcacg acacacttgt ctactccaaa aatatcaaag atacagtctc agaagaccaa 2580

agggcaattg agacttttca acaaagggta atatccggaa acctcctcgg attccattgc 2640

ccagctatct gtcactttat tgtgaagata gtggaaaagg aaggtggctc ctacaaatgc 2700

catcattgcg ataaaggaaa ggccatcgtt gaagatgcct ctgccgacag tggtcccaaa 2760

gatggacccc cacccacgag gagcatcgtg gaaaaagaag acgttccaac cacgtcttca 2820

aagcaagtgg attgatgtga tatctccact gacgtaaggg atgacgcaca atcccactat 2880

ccttcgcaag acccttcctc tatataagga agttcatttc atttggagag gacctcgacc 2940

tcaacacaac atatacaaaa caaacgaatc tcaagcaatc aagcattcta cttctattgc 3000

agcaatttaa atcatttctt ttaaagcaaa agcaattttc tgaaaatttt caccatttac 3060

gaacgatact cgagtaatct agatgtcttc cgagacagga ccggttgccg tcgaccctac 3120

tcttagaagg cgcattgagc cacacgagtt cgaggtgttc ttcgatccga gagagctgag 3180

gaaggagact tgcctccttt acgagatcaa ttggggcgga aggcactcta tttggcgcca 3240

tacctcccag aacacaaata agcatgtgga ggttaatttc atcgagaagt tcactaccga 3300

gaggtacttc tgcccaaaca cacgctgcag catcacttgg ttccttagct ggtcaccgtg 3360

cggagagtgc tctcgcgcca ttacagagtt cctgtccaga tacccgcacg ttactctttt 3420

catctacatt gccagactgt accaccatgc ggatcctcgc aacagacagg gtcttaggga 3480

cctgatcagc tcaggcgtca ccatccagat tatgacagag caggagtctg gatactgctg 3540

gcgcaacttc gtgaattact ctccttccaa tgaggctcac tggccaagat acccgcatct 3600

gtgggtcagg ctctacgtgc tcgagcttta ctgcatcatt cttggtctgc ctccatgcct 3660

caacatcctt agaaggaagc agccacagct cacattcttc actattgccc ttcagtcttg 3720

ccactaccag aggcttccgc ctcatattct gtgggcgact ggcctcaaga gcggctcaga 3780

gactccggga acatctgagt ccgctactcc tgagtctgac aagaagtact ccatcggact 3840

cgccattggt actaactccg ttggatgggc ggtcatcacc gatgagtaca aggtgcctag 3900

caagaagttc aaggttcttg gtaacacaga cagacactca atcaagaaga atctgattgg 3960

tgctctgctc ttcgattctg gagagactgc cgaggctacc aggctcaaga gaaccgcccg 4020

cagaaggtac acacgcagaa agaataggat ctgctacctt caggagattt tctctaacga 4080

gatggctaag gttgatgaca gcttcttcca tcgccttgag gagtcattcc tggtcgagga 4140

ggacaagaag cacgagagac atcctatctt cggtaacatt gtcgatgagg tggcctacca 4200

cgagaagtac ccaactatct accatcttag gaagaagctg gtggatagca ccgacaaggc 4260

ggatctccgc cttatctacc tggctctcgc ccacatgatt aagttcagag gccatttcct 4320

catcgagggc gatctcaacc cagataattc agacgtcgat aagctcttca tccagcttgt 4380

gcagacatac aatcagcttt tcgaggagaa cccgattaat gcgagcggtg ttgatgcgaa 4440

ggctatcctg tcagctagac tcagcaagtc aaggcgcctg gagaacctca tcgcccagct 4500

gccaggcgag aagaagaacg gtcttttcgg caatctgatt gcgctttctc tgggactcac 4560

cccgaacttc aagtccaatt tcgacctggc tgaggatgcc aagctccagc tgtctaagga 4620

tacatacgat gacgatctcg acaaccttct ggctcagatc ggcgaccagt acgccgatct 4680

cttccttgct gccaagaatc ttagcgatgc catcctcctt tcagacattc tgagagttaa 4740

cactgagatt accaaggctc cgctgtctgc ctccatgatc aagagatacg atgagcacca 4800

tcaggacctc actctgctca aggcgctggt ccgccagcag ctccctgaga agtacaagga 4860

gatcttcttc gaccagtcta agaacggcta cgcgggttac attgatggtg gcgctagcca 4920

ggaggagttc tacaagttca tcaagccaat tctggagaag atggatggca ctgaggagct 4980

tctggtcaag ctcaataggg aggatctcct taggaagcag cgcaccttcg acaacggatc 5040

tatccctcac cagattcatc ttggagagct gcacgccatc ctcagaaggc aggaggattt 5100

ctacccattc cttaaggaca accgcgagaa gatcgagaag attctgactt tcagaatccc 5160

ttactacgtt ggcccgctcg ctagaggcaa ctctaggttc gcgtggatga ccaggaagtc 5220

agaggagact atcacccctt ggaacttcga ggaggtggtt gacaagggag ccagcgcgca 5280

gtcattcatt gagcgcatga ctaatttcga taagaacctg cctaatgaga aggtcctccc 5340

aaagcatagc ctgctctacg agtacttcac tgtgtacaac gagcttacca aggtgaagta 5400

tgtgacagag ggcatgcgca agccggcttt cctttcagga gagcagaaga aggccatcgt 5460

ggatcttctg ttcaagacta atagaaaggt caccgtgaag cagctgaagg aggattactt 5520

caagaagatt gagtgcttcg actctgttga gatctccggt gtcgaggata ggttcaacgc 5580

ttccctcggc acctaccacg acctccttaa gatcattaag gacaaggatt tcctggataa 5640

cgaggagaat gaggacatcc tcgaggatat tgtgctgaca ctcactcttt tcgaggacag 5700

ggagatgatc gaggagcgcc ttaagacata cgcgcatctg ttcgacgata aggttatgaa 5760

gcagctcaag cgcagaaggt acactggatg gggtagactc tctaggaagc tcatcaacgg 5820

catcagagat aagcagtctg gcaagactat tctcgatttc cttaagtccg acggcttcgc 5880

taacaggaat ttcatgcagc tcattcacga cgattctctt actttcaagg aggacatcca 5940

gaaggcgcag gttagcggcc agggagattc actgcacgag catatcgcga acctcgctgg 6000

ctcccctgct atcaagaagg gcatcctcca gaccgttaag gtcgtggatg agctggttaa 6060

ggtcatgggc agacataagc cagagaacat cgtcattgag atggccaggg agaatcagac 6120

aactcagaag ggacagaaga actctaggga gcgcatgaag agaatcgagg agggtattaa 6180

ggagcttggc tcccagatcc tgaaggagca cccggtggag aacacacagc tgcagaatga 6240

gaagctgtac ctctactacc tccagaatgg ccgcgacatg tatgtggatc aggagcttga 6300

cattaacaga ctttctgact acgatgtgga ccatatcgtt ccacagtctt tccttaagga 6360

cgattccatt gataataagg tgctgactag atccgataag aacaggggaa agtctgacaa 6420

tgttccgtcc gaggaggttg tcaagaagat gaagaactac tggaggcagc tgctcaatgc 6480

taagctcatc acccagagga agttcgacaa ccttacaaag gccgagcgcg gaggtctgag 6540

cgagcttgat aaggcgggtt tcattaagag acagctcgtt gagacaaggc agatcactaa 6600

gcacgtcgcc cagattcttg actcaaggat gaacaccaag tacgacgaga atgataagct 6660

gatccgcgag gtgaaggtta ttacactgaa gagcaagctc gtttcagatt tcagaaagga 6720

cttccagttc tacaaggtca gggagatcaa caattaccac catgcccatg atgcgtacct 6780

caacgcggtg gttggtactg ctcttattaa gaagtacccg aagctggagt ctgagttcgt 6840

gtacggcgat tacaaggtgt acgacgttag aaagatgatc gctaagagcg agcaggagat 6900

tggcaaggct accgccaagt acttcttcta ctcaaacatt atgaatttct tcaagacaga 6960

gatcactctc gcgaacggcg agatcagaaa gaggccactt attgagacta acggcgagac 7020

aggagagatc gtctgggata agggtcgcga cttcgctact gtcagaaagg tgctctctat 7080

gccgcaggtt aatattgtca agaagactga ggtgcagacc ggcggattct ctaaggagtc 7140

cattctccct aagaggaact ccgacaagct catcgcccgc aagaaggatt gggaccctaa 7200

gaagtacggt ggcttcgata gcccaaccgt cgcttactca gtgcttgtcg tggccaaggt 7260

cgagaaggga aagagcaaga agctgaagtc agtgaaggag cttctgggta tcacaattat 7320

ggagaggtct tccttcgaga agaatcctat cgacttcctc gaggcgaagg gctacaagga 7380

ggttaagaag gatcttatca ttaagctgcc aaagtactca cttttcgagc tggagaacgg 7440

acgcaagaga atgctggcgt ctgctggaga gcttcagaag ggtaatgagc ttgctctgcc 7500

gtctaagtat gtgaacttcc tctaccttgc ctctcattac gagaagctca agggctcccc 7560

tgaggacaac gagcagaagc agctgttcgt cgagcagcac aagcattacc tcgatgagat 7620

cattgagcag attagcgagt tctcaaagag agtgatcctc gccgatgcga atctcgacaa 7680

ggttcttagc gcgtacaaca agcaccgcga taagccaatc agagagcagg ctgagaatat 7740

cattcatctc ttcaccctta caaacctggg tgctccggcg gctttcaagt acttcgatac 7800

cacaattgac aggaagcgct acacttcaac caaggaggtg ctggacgcca ccctcatcca 7860

ccagtctatt actggcctct acgagactag gatcgatctc tcccagcttg gtggtgactc 7920

tggcggatcc accaacctca gcgatatcat tgagaaggag acaggcaagc agcttgttat 7980

ccaggagtca attctgatgc tcccggagga ggtggaggag gttattggca ataagcctga 8040

gtctgatatc ctcgtgcata ctgcctacga tgagagcacc gacgagaacg ttatgctcct 8100

tacatcagac gcgcctgagt acaagccttg ggctctcgtc attcaggatt ccaacggaga 8160

gaataagatc aagatgctta gcggtggctc tcctaagaag aagagaaagg tgtgagctca 8220

gagctttcgt tcgtatcatc ggtttcgaca acgttcgtca agttcaatgc atcagtttca 8280

ttgcgcacac accagaatcc tactgagttt gagtattatg gcattgggaa aactgttttt 8340

cttgtaccat ttgttgtgct tgtaatttac tgtgtttttt attcggtttt cgctatcgaa 8400

ctgtgaaatg gaaatggatg gagaagagtt aatgaatgat atggtccttt tgttcattct 8460

caaattaata ttatttgttt tttctcttat ttgttgtgtg ttgaatttga aattataaga 8520

gatatgcaaa cattttgttt tgagtaaaaa tgtgtcaaat cgtggcctct aatgaccgaa 8580

gttaatatga ggagtaaaac acttgtagtt gtaccattat gcttattcac taggcaacaa 8640

atatattttc agacctagaa aagctgcaaa tgttactgaa tacaagtatg tcctcttgtg 8700

ttttagacat ttatgaactt tcctttatgt aattttccag aatccttgtc agattctaat 8760

cattgcttta taattatagt tatactcatg gatttgtagt tgagtatgaa aatatttttt 8820

aatgcatttt atgacttgcc aattgattga caacgaattc gtaatcatgt catagctgtt 8880

tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 8940

gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 9000

gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 9060

ggggagaggc ggtttgcgta ttggctagag cagcttgcca acatggtgga gcacgacact 9120

ctcgtctact ccaagaatat caaagataca gtctcagaag accaaagggc tattgagact 9180

tttcaacaaa gggtaatatc gggaaacctc ctcggattcc attgcccagc tatctgtcac 9240

ttcatcaaaa ggacagtaga aaaggaaggt ggcacctaca aatgccatca ttgcgataaa 9300

ggaaaggcta tcgttcaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc 9360

acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga 9420

tgtgaacatg gtggagcacg acactctcgt ctactccaag aatatcaaag atacagtctc 9480

agaagaccaa agggctattg agacttttca acaaagggta atatcgggaa acctcctcgg 9540

attccattgc ccagctatct gtcacttcat caaaaggaca gtagaaaagg aaggtggcac 9600

ctacaaatgc catcattgcg ataaaggaaa ggctatcgtt caagatgcct ctgccgacag 9660

tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag acgttccaac 9720

cacgtcttca aagcaagtgg attgatgtga tatctccact gacgtaaggg atgacgcaca 9780

atcccactat ccttcgcaag acccttcctc tatataagga agttcatttc atttggagag 9840

gacacgctga aatcaccagt ctctctctac aaatctatct ctctcgagct ttcgcagatc 9900

cggggggcaa tgagatatga gcccagaacg acgcccggcc gacatccgcc gtgccaccga 9960

ggcggacatg ccggcggtct gcaccatcgt caaccactac atcgagacaa gcacggtcaa 10020

cttccgtacc gagccgcagg aaccgcagga gtggacggac gacctcgtcc gtctgcggga 10080

gcgctatccc tggctcgtcg ccgaggtgga cggcgaggtc gccggcatcg cctacgcggg 10140

cccctggaag gcacgcaacg cctacgactg gacggccgag tcgaccgtgt acgtctcccc 10200

ccgccaccag cggacgggac tgggctccac gctctacacc cacctgctga agtccctgga 10260

ggcacagggc ttcaagagcg tggtcgctgt catcgggctg cccaacgacc cgagcgtgcg 10320

catgcacgag gcgctcggat atgccccccg cggcatgctg cgggcggccg gcttcaagca 10380

cgggaactgg catgacgtgg gtttctggca gctggacttg agcctgccgg taccgccccg 10440

tccggtcctg cccgtcaccg agatctgaag tagatgccga ccgggatctg tcgatcgaca 10500

agctcgagtt tctccataat aatgtgtgag tagttcccag ataagggaat tagggttcct 10560

atagggtttc gctcatgtgt tgagcatata agaaaccctt agtatgtatt tgtatttgta 10620

aaatacttct atcaataaaa tttctaattc ctaaaaccaa aatccagtac taaaatccag 10680

atcccccgaa ttaattcggc gttaattcag tacattaaaa acgtccgcaa tgtgttatta 10740

agttgtctaa gcgtcaattt gtttacacca caatatatcc tgccaccagc cagccaacag 10800

ctccccgacc ggcagctcgg cacaaaatca ccactcgata caggcagccc atcagtccgg 10860

gacggcgtca gcgggagagc cgttgtaagg cggcagactt tgctcatgtt accgatgcta 10920

ttcggaagaa cggcaactaa gctgccgggt ttgaaacacg gatgatctcg cggagggtag 10980

catgttgatt gtaacgatga cagagcgttg ctgcctgtga tcaccgcggt ttcaaaatcg 11040

gctccgtcga tactatgtta tacgccaact ttgaaaacaa ctttgaaaaa gctgttttct 11100

ggtatttaag gttttagaat gcaaggaaca gtgaattgga gttcgtcttg ttataattag 11160

cttcttgggg tatctttaaa tactgtagaa aagaggaagg aaataataaa tggctaaaat 11220

gagaatatca ccggaattga aaaaactgat cgaaaaatac cgctgcgtaa aagatacgga 11280

aggaatgtct cctgctaagg tatataagct ggtgggagaa aatgaaaacc tatatttaaa 11340

aatgacggac agccggtata aagggaccac ctatgatgtg gaacgggaaa aggacatgat 11400

gctatggctg gaaggaaagc tgcctgttcc aaaggtcctg cactttgaac ggcatgatgg 11460

ctggagcaat ctgctcatga gtgaggccga tggcgtcctt tgctcggaag agtatgaaga 11520

tgaacaaagc cctgaaaaga ttatcgagct gtatgcggag tgcatcaggc tctttcactc 11580

catcgacata tcggattgtc cctatacgaa tagcttagac agccgcttag ccgaattgga 11640

ttacttactg aataacgatc tggccgatgt ggattgcgaa aactgggaag aagacactcc 11700

atttaaagat ccgcgcgagc tgtatgattt tttaaagacg gaaaagcccg aagaggaact 11760

tgtcttttcc cacggcgacc tgggagacag caacatcttt gtgaaagatg gcaaagtaag 11820

tggctttatt gatcttggga gaagcggcag ggcggacaag tggtatgaca ttgccttctg 11880

cgtccggtcg atcagggagg atatcgggga agaacagtat gtcgagctat tttttgactt 11940

actggggatc aagcctgatt gggagaaaat aaaatattat attttactgg atgaattgtt 12000

ttagtaccta gaatgcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc 12060

agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg 12120

ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct 12180

accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct 12240

tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct 12300

cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg 12360

gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc 12420

gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga 12480

gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg 12540

cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta 12600

tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg 12660

ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg 12720

ctggcctttt gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat 12780

taccgccttt gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc 12840

agtgagcgag gaagcggaag agcgcctgat gcggtatttt ctccttacgc atctgtgcgg 12900

tatttcacac cgcatatggt gcactctcag tacaatctgc tctgatgccg catagttaag 12960

ccagtataca ctccgctatc gctacgtgac tgggtcatgg ctgcgccccg acacccgcca 13020

acacccgctg acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct 13080

gtgaccgtct ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg 13140

aggcagggtg ccttgatgtg ggcgccggcg gtcgagtggc gacggcgcgg cttgtccgcg 13200

ccctggtaga ttgcctggcc gtaggccagc catttttgag cggccagcgg ccgcgatagg 13260

ccgacgcgaa gcggcggggc gtagggagcg cagcgaccga agggtaggcg ctttttgcag 13320

ctcttcggct gtgcgctggc cagacagtta tgcacaggcc aggcgggttt taagagtttt 13380

aataagtttt aaagagtttt aggcggaaaa atcgcctttt ttctctttta tatcagtcac 13440

ttacatgtgt gaccggttcc caatgtacgg ctttgggttc ccaatgtacg ggttccggtt 13500

cccaatgtac ggctttgggt tcccaatgta cgtgctatcc acaggaaaca gaccttttcg 13560

acctttttcc cctgctaggg caatttgccc tagcatctgc tccgtacatt aggaaccggc 13620

ggatgcttcg ccctcgatca ggttgcggta gcgcatgact aggatcgggc cagcctgccc 13680

cgcctcctcc ttcaaatcgt actccggcag gtcatttgac ccgatcagct tgcgcacggt 13740

gaaacagaac ttcttgaact ctccggcgct gccactgcgt tcgtagatcg tcttgaacaa 13800

ccatctggct tctgccttgc ctgcggcgcg gcgtgccagg cggtagagaa aacggccgat 13860

gccgggatcg atcaaaaagt aatcggggtg aaccgtcagc acgtccgggt tcttgccttc 13920

tgtgatctcg cggtacatcc aatcagctag ctcgatctcg atgtactccg gccgcccggt 13980

ttcgctcttt acgatcttgt agcggctaat caaggcttca ccctcggata ccgtcaccag 14040

gcggccgttc ttggccttct tcgtacgctg catggcaacg tgcgtggtgt ttaaccgaat 14100

gcaggtttct accaggtcgt ctttctgctt tccgccatcg gctcgccggc agaacttgag 14160

tacgtccgca acgtgtggac ggaacacgcg gccgggcttg tctcccttcc cttcccggta 14220

tcggttcatg gattcggtta gatgggaaac cgccatcagt accaggtcgt aatcccacac 14280

actggccatg ccggccggcc ctgcggaaac ctctacgtgc ccgtctggaa gctcgtagcg 14340

gatcacctcg ccagctcgtc ggtcacgctt cgacagacgg aaaacggcca cgtccatgat 14400

gctgcgacta tcgcgggtgc ccacgtcata gagcatcgga acgaaaaaat ctggttgctc 14460

gtcgcccttg ggcggcttcc taatcgacgg cgcaccggct gccggcggtt gccgggattc 14520

tttgcggatt cgatcagcgg ccgcttgcca cgattcaccg gggcgtgctt ctgcctcgat 14580

gcgttgccgc tgggcggcct gcgcggcctt caacttctcc accaggtcat cacccagcgc 14640

cgcgccgatt tgtaccgggc cggatggttt gcgaccgctc acgccgattc ctcgggcttg 14700

ggggttccag tgccattgca gggccggcag gcaacccagc cgcttacgcc tggccaaccg 14760

cccgttcctc cacacatggg gcattccacg gcgtcggtgc ctggttgttc ttgattttcc 14820

atgccgcctc ctttagccgc taaaattcat ctactcattt attcatttgc tcatttactc 14880

tggtagctgc gcgatgtatt cagatagcag ctcggtaatg gtcttgcctt ggcgtaccgc 14940

gtacatcttc agcttggtgt gatcctccgc cggcaactga aagttgaccc gcttcatggc 15000

tggcgtgtct gccaggctgg ccaacgttgc agccttgctg ctgcgtgcgc tcggacggcc 15060

ggcacttagc gtgtttgtgc ttttgctcat tttctcttta cctcattaac tcaaatgagt 15120

tttgatttaa tttcagcggc cagcgcctgg acctcgcggg cagcgtcgcc ctcgggttct 15180

gattcaagaa cggttgtgcc ggcggcggca gtgcctgggt agctcacgcg ctgcgtgata 15240

cgggactcaa gaatgggcag ctcgtacccg gccagcgcct cggcaacctc accgccgatg 15300

cgcgtgcctt tgatcgcccg cgacacgaca aaggccgctt gtagccttcc atccgtgacc 15360

tcaatgcgct gcttaaccag ctccaccagg tcggcggtgg cccatatgtc gtaagggctt 15420

ggctgcaccg gaatcagcac gaagtcggct gccttgatcg cggacacagc caagtccgcc 15480

gcctggggcg ctccgtcgat cactacgaag tcgcgccggc cgatggcctt cacgtcgcgg 15540

tcaatcgtcg ggcggtcgat gccgacaacg gttagcggtt gatcttcccg cacggccgcc 15600

caatcgcggg cactgccctg gggatcggaa tcgactaaca gaacatcggc cccggcgagt 15660

tgcagggcgc gggctagatg ggttgcgatg gtcgtcttgc ctgacccgcc tttctggtta 15720

agtacagcga taaccttcat gcgttcccct tgcgtatttg tttatttact catcgcatca 15780

tatacgcagc gaccgcatga cgcaagctgt tttactcaaa tacacatcac ctttttagac 15840

ggcggcgctc ggtttcttca gcggccaagc tggccggcca ggccgccagc ttggcatcag 15900

acaaaccggc caggatttca tgcagccgca cggttgagac gtgcgcgggc ggctcgaaca 15960

cgtacccggc cgcgatcatc tccgcctcga tctcttcggt aatgaaaaac ggttcgtcct 16020

ggccgtcctg gtgcggtttc atgcttgttc ctcttggcgt tcattctcgg cggccgccag 16080

ggcgtcggcc tcggtcaatg cgtcctcacg gaaggcaccg cgccgcctgg cctcggtggg 16140

cgtcacttcc tcgctgcgct caagtgcgcg gtacagggtc gagcgatgca cgccaagcag 16200

tgcagccgcc tctttcacgg tgcggccttc ctggtcgatc agctcgcggg cgtgcgcgat 16260

ctgtgccggg gtgagggtag ggcgggggcc aaacttcacg cctcgggcct tggcggcctc 16320

gcgcccgctc cgggtgcggt cgatgattag ggaacgctcg aactcggcaa tgccggcgaa 16380

cacggtcaac accatgcggc cggccggcgt ggtggtgtcg gcccacggct ctgccaggct 16440

acgcaggccc gcgccggcct cctggatgcg ctcggcaatg tccagtaggt cgcgggtgct 16500

gcgggccagg cggtctagcc tggtcactgt cacaacgtcg ccagggcgta ggtggtcaag 16560

catcctggcc agctccgggc ggtcgcgcct ggtgccggtg atcttctcgg aaaacagctt 16620

ggtgcagccg gccgcgtgca gttcggcccg ttggttggtc aagtcctggt cgtcggtgct 16680

gacgcgggca tagcccagca ggccagcggc ggcgctcttg ttcatggcgt aatgtctccg 16740

gttctagtcg caagtattct actttatgcg actaaaacac gcgacaagaa aacgccagga 16800

aaagggcagg gcggcagcct gtcgcgtaac ttaggacttg tgcgacatgt cgttttcaga 16860

agacggctgc actgaacgtc agaagccgac tgcactatag cagcggaggg gttggatcaa 16920

agtactttga tcccgagggg aaccctgtgg ttggcatgca catacaaatg gacgaacgga 16980

taaacctttt cacgcccttt taaatatccg attattctaa taaacgctct tttctcttag 17040

Claims (2)

1. A method for single nucleotide mutation of a cauliflower gene, comprising: using cauliflower Korso hypocotyls as explants, carrying out gene editing on the cauliflower by BE3, and screening by Basta to obtain the cauliflower with single nucleotide mutation;

the gene editing is carried out by adopting PHSE901-Basta, and the sequence of the PHSE901-Basta is a sequence 3 in a sequence table;

the concentration of the agrobacterium liquid infecting the explant meets OD₆₀₀A value of 0.1;

the co-culture medium is obtained by adding 6-BA and NAA into MS culture medium, and the concentrations of 6-BA and NAA in the co-culture medium are 3mg/L and 0.1mg/L respectively;

the screening culture medium is obtained by adding Basta and carbenicillin to the co-culture medium, and the concentrations of Basta and carbenicillin in the screening culture medium are 3mg/L and 300mg/L respectively;

the bud elongation culture medium is obtained by adding Basta and carbenicillin into an MS culture medium, and the concentrations of Basta and carbenicillin in the bud elongation culture medium are 3mg/L and 200mg/L respectively;

the gene isALSThe gene has a target sequence of sequence 1 in the sequence table, or the gene isCENH3The gene and the target sequence are sequence 2 in the sequence table.

2. Use of the method of claim 1 in cauliflower breeding.

Images