CN114041416A - Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety - Google Patents

Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety Download PDF

Info

Publication number
CN114041416A
CN114041416A CN202110723086.0A CN202110723086A CN114041416A CN 114041416 A CN114041416 A CN 114041416A CN 202110723086 A CN202110723086 A CN 202110723086A CN 114041416 A CN114041416 A CN 114041416A
Authority
CN
China
Prior art keywords
resistance
disease
gene
rice
breeding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110723086.0A
Other languages
Chinese (zh)
Inventor
何秀英
陆展华
刘维
卢东柏
王晓飞
王石光
薛皦
方志强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Rice Research Institute Guangdong Academy Of Agricultural Sciences
Original Assignee
Rice Research Institute Guangdong Academy Of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rice Research Institute Guangdong Academy Of Agricultural Sciences filed Critical Rice Research Institute Guangdong Academy Of Agricultural Sciences
Priority to CN202110723086.0A priority Critical patent/CN114041416A/en
Publication of CN114041416A publication Critical patent/CN114041416A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
    • A01H1/122—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • A01H1/1245—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance
    • A01H1/125—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance for bacterial resistance
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12—Processes for modifying agronomic input traits, e.g. crop yield
    • A01H1/122—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • A01H1/1245—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance
    • A01H1/1255—Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, e.g. pathogen, pest or disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention provides a breeding method of a disease-resistant fragrant Guangdong silk seedling rice variety, which comprises the following steps: (1) hybridizing the donor parent and the receptor parent to obtain F1Seed generation; planting F1Generation to obtain F2Seed generation; (2) f is to be2Planting more than or equal to 1000 plants in the seed generation, and selecting a target plant to obtain a single plant seed; (3) planting 100 single seeds according to strains, simultaneously carrying out natural disease resistance identification of rice blast and artificial inoculation of bacterial blight in a rice blast region, screening strains with good resistance for line selection, selecting a target single plant for detection of a resistance gene Pi2 and a flavor gene fgr, and reserving the single plants with positive double genes of the resistance gene Pi2 and the flavor gene fgr; (4) resistance gene Pi2 and carrying out field planting line selection on the single plants with double positive genes of the aroma gene fgr, carrying out resistance identification, and selecting a target silk seedling rice variety to obtain the disease-resistant aroma type Guangdong silk seedling rice variety. The method can breed the target strain in a short time, has obvious breeding effect and can adapt to a cultivation mode with rapid development.

Description

Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety
Technical Field
The invention belongs to the technical field of breeding, and particularly relates to a breeding method of a disease-resistant fragrant Guangdong silk seedling rice variety.
Background
The Guangdong silk seedling rice is a super-high-quality fragrant rice variety with the regional characteristics of Guangdong, and the rice grains are slender and fragrant, so that the Guangdong silk seedling rice is a remarkable characteristic that the Guangdong silk seedling rice is different from other rice. With the rapid improvement of living standard, the demand of people for high-quality silk seedling rice is continuously expanded. However, the conventional filamentous seedling rice (such as Zengcheng filamentous seedling, Meixiangzhan No. 2, ivory and the like) has good quality, but has insufficient yield, disease resistance and lodging resistance, and is difficult to adapt to a rapid development cultivation mode.
The traditional hybrid line selection method has long time for improving disease resistance, and the fragrance controlled by a recessive gene is easy to lose in the line selection process. In addition, since coastal areas in Guangdong are greatly influenced by typhoon and rainwater, rice blast and bacterial leaf blight in areas are important diseases of rice, and planting of high-quality seedling rice varieties is seriously influenced, a breeding method is urgently needed to improve the yield and disease resistance of the seedling rice so as to adapt to the current cultivation mode.
Disclosure of Invention
The embodiment of the invention provides a breeding method of a disease-resistant fragrant Guangdong silk seedling rice variety, aiming at solving the problems of low yield, weak disease resistance, poor comprehensive agronomic characters and the like of the Guangdong silk seedling rice at present. The method can breed the target strain in a relatively short time, has obvious breeding effect and can greatly reduce the investment of manpower and material resources.
The embodiment of the invention is realized in such a way that the breeding method of the disease-resistant fragrant Guangdong silk seedling rice variety comprises the following steps:
(1) hybridizing a donor parent with good disease resistance with a Guangdong silk seedling rice receptor parent to obtain F1Seed generation; planting F1Generation and harvest F2Seed generation;
(2) planting F2Selecting more than or equal to 1000 individual plants in the generation, selecting the individual plants which have excellent comprehensive agronomic characters and long grain types and are positive to the resistance gene Pi2 and the aroma gene fgr under the assistance of molecular markers to obtain individual plant seeds;
(3) planting 100 single-plant seeds in the step (2) according to strains, and simultaneously carrying out rice blast resistance identification and bacterial leaf blight resistance identification of spontaneous outbreak in a rice blast area; judging the rice blast resistance according to the currently popular classification method, and screening a rice blast-resistant strain system with no typical scab on leaves, no neck blast on rice ears and no scab on grains; in the identification of the bacterial leaf blight resistance, the bacterial leaf blight is artificially inoculated, 20 strains are inoculated to each strain, the length of a lesion is investigated after 20 days of inoculation, and if the lesion is less than 5cm, the strain is a bacterial leaf blight resistant strain; screening a strain with good resistance for line selection, selecting a single strain with long grain type, good high yield, thick and strong stem and upright leaves for detecting a resistance gene Pi2 and a flavor gene fgr, and reserving a single strain with positive double genes of the resistance gene Pi2 and the flavor gene fgr;
(4) and (4) carrying out field planting line selection on the single plants with the resistance gene Pi2 and the fragrance gene fgr in the step (3) and carrying out resistance identification on rice blast and bacterial leaf blight, and selecting the rice seedling rice variety with long grain type and good high yield to obtain the disease-resistant fragrant Guangdong rice seedling rice variety.
In the step (1):
the donor parent with good disease resistance is a donor parent with excellent disease resistance and comprehensive agronomic characters, and is preferably a silk seedling rice variety which has good yield, strong disease resistance, excellent comprehensive agronomic characters and is popularized and applied in a large area at present.
The donor parent is preferably Yuenongsi or Yuenongsi.
The Guangdong silk sprout rice receptor parent is preferably densefruit jecorice root.
In the step (2),
the screening indexes of the comprehensive agronomic characters are mainly plant height of 95-100cm, upright functional leaves, strong tillering force, thick and strong stems and the like.
The long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
In the step (3), the step (c),
the strain with good resistance refers to a strain with light incidence of leaf blast and neck blast.
The long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
In the step (4), the step (c),
the long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
The Guangdong silk seedling rice is a silk seedling rice variety with thick and strong stems, upright leaves, rice blast resistance, bacterial leaf blight resistance and fragrance.
Further, the molecular markers assist in selection of a closely linked marker (RM7231) for the resistance gene Pi2 gene and a functional marker for the flavor gene fgr.
In the molecular marker assisted selection, primers for detecting the resistance gene Pi2 were as follows:
the forward primer sequence for the detection of the resistance gene Pi2 was: AACCCTAGACTACTCCCGGTCTCC, respectively;
the reverse primer sequence for the detection of the resistance gene Pi2 was: ACCTTGGCGAGCTCTGTTTCG are provided.
The primers for detecting the aroma gene fgr are as follows:
the sequence of the forward primer for detecting the aroma gene fgr is as follows: GTTAGGTTGCATTTACTGGGAG are provided.
The sequence of the reverse primer for detecting the aroma gene fgr is as follows: GAATGATGCTCAAAGTGTCT are provided.
Compared with the prior art, the invention has the beneficial effects that:
(1) compared with the traditional line selection, the invention selects the resistance gene and the aroma gene in low generation through the molecular marker, avoids the loss of the recessive aroma gene in the breeding, and can quickly select the rice blast resistance stable line;
(2) the invention combines molecular marker auxiliary selection and pedigree breeding, the advantages are complementary, the target genotype and the comprehensive agronomic characters are concerned in the whole breeding process, and the breeding target is clear;
(3) the method utilizes the dominant variety which is planted in a large area and has excellent comprehensive agronomic characters as the parent, greatly improves the genetic background of the current Guangdong silk seedling rice variety, can breed the target strain in a relatively short time, has obvious breeding effect, greatly reduces the investment of manpower and material resources, can adapt to a cultivation mode of rapid development, and lays an important foundation for improving the disease resistance, lodging resistance and comprehensive agronomic characters of the Guangdong silk seedling rice.
(4) The yield of the disease-resistant fragrant Guangdong silk seedling rice variety obtained by the invention is 5% higher than that of the current Guangdong silk seedling rice regional test control variety Meixiang No. 2, and the rice blast and bacterial leaf blight resistance can reach the above level.
Detailed Description
The technical solutions in the embodiments of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without any inventive step, shall fall within the scope of the present invention.
It should be noted that if directional indications (such as up, down, left, right, front, back, top, and bottom … …) are involved in the embodiment of the present invention, the directional indications are only used to explain the relative position relationship between the components, the motion situation, and the like in a specific posture, and if the specific posture is changed, the directional indications are changed accordingly.
In this application, unless expressly stated or limited otherwise, the terms "mounted," "connected," "secured," and the like are to be construed broadly and can include, for example, fixed and removable connections or integral parts; can be mechanically or electrically connected; they may be directly connected or indirectly connected through intervening media, or they may be connected through the interior of two elements or through the interaction of two elements unless otherwise specifically limited. The specific meaning of the above terms in the present application can be understood by those of ordinary skill in the art according to specific circumstances.
It will be understood that when an element is referred to as being "secured to" or "disposed on" another element, it can be directly on the other element or intervening elements may also be present. When an element is referred to as being "connected" to another element, it can be directly connected to the other element or intervening elements may also be present.
In addition, if there is a description of "first", "second", etc. in an embodiment of the present invention, the description of "first", "second", etc. is for descriptive purposes only and is not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In addition, technical solutions between various embodiments may be combined with each other, but must be realized by a person skilled in the art, and when the technical solutions are contradictory or cannot be realized, the combination of the technical solutions should not be considered to exist, and is not within the protection scope of the present invention.
At present, the traditional shredded rice (such as Zengcheng shredded rice, Meixiangzhan No. 2, ivory flavor, and the like) has good quality, but has insufficient yield, disease resistance and lodging resistance, and is difficult to adapt to a rapid development cultivation mode. The traditional hybrid line selection method has long time for improving disease resistance, and the fragrance controlled by recessive genes is easy to lose in the line selection process. In addition, since coastal areas in Guangdong are greatly influenced by typhoon and rainwater, rice blast and bacterial leaf blight in areas are important diseases of rice, and planting of high-quality seedling rice varieties is seriously influenced, a breeding method is urgently needed to improve the yield and disease resistance of the seedling rice so as to adapt to the current cultivation mode. Based on the technical problem, the invention provides a breeding method of the disease-resistant fragrant Guangdong silk seedling rice variety to solve the technical problem.
The invention can directionally and accurately improve the comprehensive agronomic characters and disease resistance of Guangdong silk seedling rice by selecting a high-quality rice variety with excellent comprehensive characters and good resistance to hybridization with a high-quality silk seedling rice variety, combining the molecular marker-assisted selection of a rice blast resistance gene and a flavor control gene, the identification of a rice blast disease area and the identification of the resistance of rice blast and bacterial blight through artificial inoculation. The breeding method has the advantages of clear target, simple method and obvious effect, and greatly reduces the investment of manpower, financial resources and material resources.
Example 1
Specifically, the breeding method of the disease-resistant fragrant Guangdong silk seedling rice variety provided by the embodiment of the invention comprises the following steps:
(1) hybridizing the Guangdong silk seedling donor parent with good disease resistance with the Guangzhou silk seedling rice (ivory) acceptor parent to obtain F1Seed generation; planting F1Generation to obtain F2Seed generation;
(2) planting F2Selecting more than or equal to 1000 individual plants in the generation, selecting the individual plants which have excellent comprehensive agronomic characters and long grain types and are positive to the resistance gene Pi2 and the aroma gene fgr under the assistance of molecular markers to obtain individual plant seeds;
(3) planting 100 single-plant seeds in the step (2) according to strains, and simultaneously carrying out rice blast resistance identification and bacterial leaf blight resistance identification of spontaneous outbreak in a rice blast area; judging the rice blast resistance according to the currently popular classification method, and screening a rice blast-resistant strain system with no typical scab on leaves, no neck blast on rice ears and no scab on grains; in the identification of the bacterial leaf blight resistance, the bacterial leaf blight is artificially inoculated, 20 strains are inoculated to each strain, the length of a lesion is investigated after 20 days of inoculation, and if the lesion is less than 5cm, the strain is a bacterial leaf blight resistant strain; screening a strain with good resistance for line selection, selecting a single strain with long grain type, good high yield, thick and strong stem and upright leaves for detecting a resistance gene Pi2 and a flavor gene fgr, and reserving a single strain with positive double genes of the resistance gene Pi2 and the flavor gene fgr;
(4) and (3) carrying out field planting line selection on the resistance gene Pi2 and the single plant with double positive genes of the flavor gene fgr in the step (3), carrying out resistance identification on rice blast and bacterial leaf blight, selecting a seedling rice variety with slender grain type and good high yield, and obtaining the disease-resistant fragrant Guangdong seedling rice variety with the yield 5% higher than that of the current Guangdong seedling rice (fragrant rice group) regional test control variety Meixiang and the rice blast and bacterial leaf blight resistance level.
The donor parent Yuenongsimiao in the step (1) is a seedling rice variety which has good high yield, strong disease resistance, excellent comprehensive agronomic performance and is popularized and applied in large area at present.
In the step (2), the screening indexes with excellent comprehensive agronomic characters mainly comprise plant height of 95-100cm, upright functional leaves, strong tillering force, thick and strong stems and the like.
In the step (3), the strain with good resistance refers to a strain with light incidence of leaf blast and panicle neck blast.
The long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
The obtained Guangdong silk seedling rice is a silk seedling rice variety with thick and strong stems, upright leaves, rice blast resistance, bacterial leaf blight resistance and fragrance.
Further, the molecular markers assist in selection of a closely linked marker (RM7231) for the resistance gene Pi2 gene and a functional marker for the flavor gene fgr.
In the molecular marker assisted selection, primers for detecting the resistance gene Pi2 were as follows:
the sequence of the forward primer detected by the resistance gene Pi2 was: AACCCTAGACTACTCCCGGTCTCC, respectively;
the sequence of the reverse primer detected by the resistance gene Pi2 was: ACCTTGGCGAGCTCTGTTTCG are provided.
The primers for detecting the aroma gene fgr are as follows:
the sequence of the forward primer for detecting the aroma gene fgr is as follows: GTTAGGTTGCATTTACTGGGAG are provided.
The sequence of the reverse primer for detecting the fragrance gene fgr is as follows: GAATGATGCTCAAAGTGTCT are provided.
Example 2
Specifically, the breeding method of the disease-resistant fragrant Guangdong silk seedling rice variety provided by the embodiment of the invention comprises the following steps:
(1) will utensilHybridizing the Guangdong grass silk seedling donor parent with good disease resistance with the Guangzhou silk seedling rice (ivory) acceptor parent to obtain F1Seed generation; planting F1Generation to obtain F2Seed generation;
(2) planting F2Selecting more than or equal to 1000 individual plants in the generation, selecting the individual plants which have excellent comprehensive agronomic characters and long grain types and are positive to the resistance gene Pi2 and the aroma gene fgr under the assistance of molecular markers to obtain individual plant seeds;
(3) planting 100 single plants of the seeds in the step (2) according to plant lines, simultaneously carrying out self-morbidity rice blast resistance identification and bacterial blight artificial inoculation in a rice blast region, screening the plant lines with good resistance for line selection, selecting the single plants with long grain type, good yield, thick and strong stems and upright leaves for detecting a resistance gene Pi2 and a fragrance gene fgr, and reserving the single plants with positive double genes of the resistance gene Pi2 and the fragrance gene fgr;
(4) and (3) carrying out field planting line selection on the resistance gene Pi2 and the single plant with double positive genes of the flavor gene fgr in the step (3), carrying out resistance identification on rice blast and bacterial leaf blight, selecting a seedling rice variety with slender grain shape and good high yield, and obtaining the disease-resistant fragrant Guangdong seedling rice variety with the yield 5% higher than that of the current Guangdong seedling rice area test control variety Meixiang, and the rice blast and bacterial leaf blight resistance higher than the standard.
The donor parent Yuenongsimiao in the step (1) is a seedling rice variety which has good high yield, strong disease resistance, excellent comprehensive agronomic performance and is popularized and applied in large area at present.
In the step (2), the screening indexes with excellent comprehensive agronomic characters mainly comprise plant height of 95-100cm, upright functional leaves, strong tillering force, thick and strong stems and the like.
In the step (3), the strain with good resistance refers to a strain with light incidence of leaf blast and panicle neck blast.
The long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
The obtained Guangdong silk seedling rice is a silk seedling rice variety with thick and strong stems, upright leaves, rice blast resistance, bacterial leaf blight resistance and fragrance.
Further, the molecular markers assist in selection of a closely linked marker (RM7231) for the resistance gene Pi2 gene and a functional marker for the flavor gene fgr.
In molecular marker assisted selection, primers for detection of resistance gene Pi2 and fragrance gene fgr were as follows:
the sequence of the forward primer detected by the resistance gene Pi2 is as follows: AACCCTAGACTACTCCCGGTCTCC, respectively;
the sequence of the reverse primer detected by the resistance gene Pi2 is as follows: ACCTTGGCGAGCTCTGTTTCG are provided.
The sequence of the forward primer for detecting the fragrance gene fgr is as follows: GTTAGGTTGCATTTACTGGGAG are provided.
The sequence of the reverse primer for detecting the fragrance gene fgr is as follows: GAATGATGCTCAAAGTGTCT are provided.
Compared with the traditional line selection, the invention selects the resistance gene and the aroma gene in low generation through the molecular marker, avoids the loss of the recessive aroma gene in the breeding, and can quickly select the stable rice blast resistance line.
The invention combines molecular marker auxiliary selection and pedigree breeding, has complementary advantages, pays attention to target genotype and comprehensive agronomic characters in the whole breeding process, and has clear breeding target.
The method utilizes the dominant variety which is planted in a large area and has excellent comprehensive agronomic characters as the parent, greatly improves the genetic background of the current Guangdong silk seedling rice variety, can breed the target product line in a relatively short time, has obvious breeding effect, greatly reduces the investment of manpower and material resources, can adapt to a cultivation mode of rapid development, and lays an important foundation for improving the disease resistance, lodging resistance and comprehensive agronomic characters of the Guangdong silk seedling rice.
The invention utilizes indica rice varieties with good high yield, strong disease resistance, good rice quality and the like as resistance source donor parents to be hybridized with the current Guangdong silk seedling rice varieties with excellent quality, and combines methods such as molecular marker assisted selection, disease resistance identification and the like to directionally improve and breed the novel Guangdong silk seedling rice line with excellent comprehensive agronomic characters and good disease resistance. The breeding method can breed the target strain in a relatively short time, has remarkable breeding effect, and greatly reduces the investment of manpower and material resources. The disease-resistant fragrant Guangdong silk seedling rice obtained by the method has high yield, excellent disease resistance and lodging resistance, and can adapt to a rapid-development farming mode.
It should be understood that although the present description refers to embodiments, not every embodiment contains only a single technical solution, and such description is for clarity only, and those skilled in the art should take the description as a whole, and the technical solutions in the embodiments may be appropriately combined to form other embodiments that can be understood by those skilled in the art.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Claims (10)

1. A breeding method of a disease-resistant fragrant Guangdong silk seedling rice variety is characterized by comprising the following steps: the method comprises the following steps:
(1) hybridizing a donor parent with good disease resistance with a Guangdong silk seedling rice receptor parent to obtain F1Seed generation; planting F1Generation and harvest F2Seed generation;
(2) planting F2Selecting more than or equal to 1000 individual plants in the generation, selecting the individual plants which have excellent comprehensive agronomic characters and long grain types and are positive to the resistance gene Pi2 and the aroma gene fgr under the assistance of molecular markers to obtain individual seeds;
(3) planting 100 single-plant seeds in the step (2) according to plant lines, and simultaneously carrying out natural disease rice blast resistance identification and bacterial leaf blight resistance identification in a rice blast area; judging the rice blast resistance according to the currently popular classification method, and screening a rice blast-resistant strain system with no typical scab on leaves, no neck blast on rice ears and no scab on grains; in the identification of the bacterial leaf blight resistance, the bacterial leaf blight is artificially inoculated, 20 strains are inoculated to each strain, the length of a lesion is investigated after 20 days of inoculation, and if the lesion is less than 5cm, the strain is a bacterial leaf blight resistant strain; screening a strain with good resistance for line selection, selecting a single strain with long grain type, good high yield, thick and strong stem and upright leaves for detecting a resistance gene Pi2 and a flavor gene fgr, and reserving a single strain with positive double genes of the resistance gene Pi2 and the flavor gene fgr;
(4) and (4) carrying out field planting line selection on the single plants with the resistance gene Pi2 and the fragrance gene fgr in the step (3) and carrying out resistance identification on rice blast and bacterial leaf blight, and selecting the rice seedling rice variety with long grain type and good high yield to obtain the disease-resistant fragrant Guangdong rice seedling rice variety.
2. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: in the step (1):
the donor parent with good disease resistance is the donor parent with excellent disease resistance and comprehensive agronomic characters.
3. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: the donor parent is Yuenongsimiao or Yuexiangsimiao.
4. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: the Guangdong silk seedling rice receptor parent is the ivory.
5. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: in the step (2), the screening indexes with excellent comprehensive agronomic characters mainly comprise plant height of 95-100cm, upright functional leaves, strong tillering force, thick and strong stems and the like.
The long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
6. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: in the step (3), the strain with good resistance refers to a strain with light incidence of leaf blast and panicle neck blast;
the long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
7. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: in the step (4), the long and thin grain type means that the length-width ratio of the rice grains is more than or equal to 3.5.
8. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: the molecular markers assist in selection of the resistance gene Pi2 gene closely linked marker RM7231 and the fragrance gene fgr functional marker.
9. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that:
in the molecular marker assisted selection, primers for detecting the resistance gene Pi2 were as follows:
the forward primer sequence for the detection of the resistance gene Pi2 was: AACCCTAGACTACTCCCGGTCTCC, respectively;
the reverse primer sequence for the detection of the resistance gene Pi2 was: ACCTTGGCGAGCTCTGTTTCG are provided.
10. The method for breeding the disease-resistant aromatic Guangdong silk seedling rice variety according to claim 1, which is characterized in that: the primers for detecting the aroma gene fgr are as follows:
the sequence of the forward primer for detecting the aroma gene fgr is as follows: GTTAGGTTGCATTTACTGGGAG are provided.
The sequence of the reverse primer for detecting the aroma gene fgr is as follows: GAATGATGCTCAAAGTGTCT are provided.
CN202110723086.0A 2021-06-28 2021-06-28 Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety Pending CN114041416A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110723086.0A CN114041416A (en) 2021-06-28 2021-06-28 Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110723086.0A CN114041416A (en) 2021-06-28 2021-06-28 Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety

Publications (1)

Publication Number Publication Date
CN114041416A true CN114041416A (en) 2022-02-15

Family

ID=80204322

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110723086.0A Pending CN114041416A (en) 2021-06-28 2021-06-28 Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety

Country Status (1)

Country Link
CN (1) CN114041416A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101185420A (en) * 2007-12-24 2008-05-28 广东省农业科学院水稻研究所 High efficiency rice breeding method
CN111903500A (en) * 2020-07-31 2020-11-10 广西壮族自治区农业科学院 Breeding method of fragrant rice blast resistant restorer cinnamon 5886 with high harvest index
CN112262766A (en) * 2020-07-31 2021-01-26 广东省农业科学院水稻研究所 Phenotype-based breeding method for new lodging-resistant rice variety

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101185420A (en) * 2007-12-24 2008-05-28 广东省农业科学院水稻研究所 High efficiency rice breeding method
CN111903500A (en) * 2020-07-31 2020-11-10 广西壮族自治区农业科学院 Breeding method of fragrant rice blast resistant restorer cinnamon 5886 with high harvest index
CN112262766A (en) * 2020-07-31 2021-01-26 广东省农业科学院水稻研究所 Phenotype-based breeding method for new lodging-resistant rice variety

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
李金华等: "优质抗稻瘟病杂交水稻新组合长优736", 《杂交水稻》 *

Similar Documents

Publication Publication Date Title
US9439385B2 (en) Alfalfa plants having improved fast recovery after harvest and methods for producing same
Li et al. RFLP facilitated analysis of tiller and leaf angles in rice (Oryza sativa L.)
CN111903500B (en) Breeding method of fragrant rice blast resistant restorer cinnamon 5886 with high harvest index
CN109042292B (en) Hybrid rice seed production method for parents of rice transplanting at same period
CN113349050B (en) Breeding method of disease-resistant fragrant rice variety rich in anthocyanin
CN101300957A (en) Method for breeding Zhen dao No. 13 using ladder polymerization improved technique
CN113273460B (en) Lodging-resistant conventional japonica rice breeding method
CN114041416A (en) Breeding method of disease-resistant fragrant Guangdong silk seedling rice variety
Ariyaratna et al. Plant architecture and its responses to high planting density and low fertilizer of reduced culm number mutants in rice (Oryza sativa L.)
US20040199962A1 (en) Novel soybean
US7189897B2 (en) Soybean cultivar 13946
CN111567397A (en) High-quality long-grain fragrance type japonica rice Wujing 9075 and breeding method
CN111869562A (en) High-quality small-grain aromatic japonica rice Wuxiangjing 113 and breeding method
US7361809B2 (en) Soybean 13948
CN109089873B (en) Method for obtaining hybrid rice parent combination for synchronous direct seeding seed production
Aman et al. Common Breeding Techniques in Rice (Orzya sativa L.): Review
CN109548647B (en) Breeding method of high-yield early-maturing anti-premature-senescence rice restorer series hybrid rice combination
US7301074B2 (en) Soybean
US7179966B2 (en) Soybean cultivar 11939-31
US5780705A (en) Inbred corn line ZS01301
US20030177545A1 (en) Inbred corn line G0302
CN118895383A (en) Breeding method for efficiently cultivating herbicide-resistant semi-waxy fragrant japonica rice based on brown index
Djanaguiraman et al. Growth, development and physiology of grain sorghum
CN114931093A (en) Breeding method of high-efficiency, large-spike, long-and-thin-grain, low-chalkiness and high-quality conventional fragrant rice and application thereof
CN116195508A (en) Creation method of novel yellow pulp crack-resistant high-sugar small watermelon germplasm

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20220215

RJ01 Rejection of invention patent application after publication