CN113957167A - Cherry rootstock specific molecular marker and screening method and application thereof - Google Patents
Cherry rootstock specific molecular marker and screening method and application thereof Download PDFInfo
- Publication number
- CN113957167A CN113957167A CN202110812606.5A CN202110812606A CN113957167A CN 113957167 A CN113957167 A CN 113957167A CN 202110812606 A CN202110812606 A CN 202110812606A CN 113957167 A CN113957167 A CN 113957167A
- Authority
- CN
- China
- Prior art keywords
- cherry
- snp
- varieties
- sites
- rootstocks
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses 5 cherry rootstock specific molecular markers and a screening method and application thereof, wherein the screening method comprises the following steps: (1) taking leaves to extract genome DNA; (2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified; (3) filtering sequencing data, and then obtaining SNP loci by using GATK, (4) screening loci with at least one variety different from other varieties in 5 kinds of cherry rootstocks according to the typing result of each variety; (5) according to the screening strategy, 7134 SNP loci for identifying 5 kinds of cherry rootstocks are finally screened. The invention develops two simple, convenient, rapid and reliable methods for identifying 5 kinds of cherry stocks based on the locus marks, and lays a technical foundation for accurately controlling cherry varieties from the source. The tissue culture seedlings and the grafted seedlings of the 5 cherry rootstocks can be accurately distinguished, and a technical foundation is laid for ensuring accurate identification and control of cherry rootstock varieties in scientific research departments, nursery stock breeding and orchard planting enterprises.
Description
Technical Field
The invention relates to 5 cherry rootstock specific molecular markers and a screening method and application thereof, belonging to the technical field of biology.
Background
Cherry (Cerasus spp.) is a plant of the genus Prunus (Prunus) of the subfamily Prunoideae (Prunoideae) of the family Rosaceae (Rosaceae). The utilization of the dwarfing rootstocks for close planting cultivation is an important measure for realizing early fruit bearing, high yield, high quality and high efficiency of fruit trees. At the end of the 20 th century, vigorous stocks such as koute, folium isatidis, northeast cherries and the like are mainly used for producing the Chinese sweet cherries, the trees are tall and big, the fruits are late, the yield is low, and the development of dwarf and dense planting cultivation of the Chinese sweet cherries is restricted. At present, the old cherry orchard reconstruction and new cherry orchard construction generally adopt cherry dwarfing close planting stock grafted varieties, and the disease resistance, yield and environmental adaptability of cherries are improved.
The cherry dwarf close-planting disease-resistant rootstocks are not of a plurality of varieties, and the rootstocks mainly applied in a large amount at present are Gisela series, Landing series and Jingchun series. The invention provides the cherry stock identification method capable of clearly distinguishing three series and the same series of different varieties, lays a technical foundation for ensuring accurate identification and control of cherry stock varieties for scientific research departments, nursery stock breeding and orchard planting enterprises, and also provides technical support for enterprises to carry out large-scale seedling breeding on cherry stocks.
Disclosure of Invention
Aiming at the defect that the seedling stage of 5 cherry stocks is difficult to identify in the prior art, the invention provides a screening method of specific molecular markers of the 5 cherry stocks, 7134 SNP markers specific to varieties are screened by the method, two simple, convenient, rapid and reliable methods for identifying the 5 cherry stocks are developed based on the markers, and a technical foundation is laid for accurately controlling the varieties of cherries from the source.
In order to solve the technical problems, the invention adopts the following technical scheme:
firstly, the invention provides a method for screening specific molecular markers of 5 cherry rootstocks by using a simplified genome sequencing technology Super-GBS, which comprises the following steps:
(1) extracting genome DNA by using known and accurate Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 as samples;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) screening all sites which have completely consistent individual types and have no individual deletion and are different from other varieties in the consistent sites of the individual types according to the typing result of each variety; finally, 7134 SNP sites are screened, and the specific table is shown in table 1;
(6) and (3) constructing an evolutionary tree and clustering analysis by using 7134 SNP loci or part of the SNP loci.
According to the marker loci in table 1, thousands of sets of SNP locus marker groups capable of accurately identifying 5 varieties of cherry rootstock can be screened, wherein the invention lists three sets of SNP locus marker group information and marker amplification primer information capable of accurately identifying 5 varieties of cherry rootstock as follows:
table 2 enables accurate identification of a set of SNP site information of 5 cherry rootstocks
SNP site identifying primer information in Table 2 described in Table 3
Table 4 enables accurate identification of a set of SNP site information of 5 cherry rootstocks
SNP site identifying primer information in Table 4 described in Table 5
Table 6 enables accurate identification of a set of SNP site information of 5 cherry rootstocks
SNP site identifying primer information in Table 6 shown in Table 7
The invention has the beneficial effects that: the tissue culture seedlings, the grafted seedlings and the finished seedlings of the 5 kinds of cherry stocks can be accurately distinguished, the control of breeding enterprises on varieties is ensured, and economic loss caused by errors in the breeding process is reduced.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 shows that an evolutionary tree is constructed by utilizing 7134 specific SNP markers of screened Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F105 cherry rootstocks, and 5 cherry rootstocks can be accurately distinguished.
FIG. 2 shows that sequencing and SNP screening of cherry rootstock samples are carried out by a Super-GBS method, the finally screened SNP sites coincide with more than 90% of 7134 SNP sites which are determined to be effective, and 5 cherry rootstocks are classified by utilizing the coincident sites, so that the 5 cherry rootstocks can be accurately distinguished.
In fig. 1 and 2 of the present invention, the varieties corresponding to the sample numbers are shown in the following table:
| serial number | Variety of (IV) C | Sample numbering |
| 1 | Jingchun No. 3-H11 | B-65，B-34，B-19，B-26 |
| 2 | Lan ding No. 3-H22 | B-17，B-32，B-50，B-69 |
| 3 | Gisela 5#, and | B-1，B-3，B-4，B-6，B-7，B-9，B-11 |
| 4 | jingchun No. 1-H10 | B-48，B-52，B-16，B-23，B-30，B-31，B-39，B-43 |
| 5 | Lan ding No. 2-F10 | B-58，B-47，B-67 |
Detailed Description
Example 1
The embodiment provides a method for screening 5 cherry rootstock specific SNP molecular markers including Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 by using a simplified genome sequencing technology Super-GBS, which comprises the following steps:
(1) extracting genome DNA by utilizing 3 strains of known varieties of Beijing spring No. 3-H11, 3 strains of Landing No. 3-H22, 5 strains of Gisela No. 5, 6 strains of Beijing spring No. 1-H10 and 2 strains of Landing No. 2-F10 cherry rootstock samples;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) screening all individual genotypes in each variety according to the typing result of each variety, wherein the typing of all individuals in each variety is completely consistent, the typing consistent sites have no individual deletion, and the typing consistent sites are different from at least one variety site in other 5 cherry rootstock varieties, and finally screening 7134 SNP sites;
(6) and (3) constructing an evolutionary tree and clustering analysis by using 7134 SNP loci.
The specific operation steps are as follows:
this example mainly comprises the following steps, i.e., digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
Super-GBS library construction is carried out on 3 Jingchun No. 3-H11, 3 Landing No. 3-H22, 5 Gisela No. 5, 6 Jingchun No. 1-H10 and 2 Landing No. 2-F10 cherry rootstocks with accurate varieties provided by a standard institution purchased by the company, and the specific process is as follows (the usage amount of enzyme digestion reagent of each sample is as follows):
DEPC water: 21.4 mu L; 10 × CutSmart buffer: 3 mu L of the solution; PstI-HF (4 units): 0.2 mu L; MspI (8 units): 0.4 mu L;
DNA (50 ng/. mu.L): 5 mu L of the solution; all the components are mixed evenly and then cut for 2h at 37 ℃, and then the temperature is kept for 20min at 75 ℃ to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
DEPC water: 13 mu L of the solution; 10 XT 4 ligase buffer: 4 mu L of the solution; PstI Adaptor (0.1 μ M): 1 mu L of the solution; common adaptor (10 μ M): 1.5 mu L; t4 DNA ligase (400U/. mu.L): 0.5 mu L; and (3) enzyme digestion products: 20 μ L.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. And (3) purification:
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. mu.L of 70% ethanol. Finally, the DNA was recovered from the beads using 40. mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification:
DEPC water: 16 mu L of the solution; taq5 × Master Mix: 5 mu L of the solution; primer 1(10 μ M): 0.5 mu L; primer 2(10 μ M): 0.5 mu L;
purified ligation product: 3 μ L.
Mixing all the components, placing in a PCR instrument, performing amplification for 16 cycles under the reaction condition of pre-denaturation at 95 ℃ for 30s, performing annealing at 62 ℃ for 20s, performing extension at 68 ℃ for 15s, performing extension at 68 ℃ for 5min, and storing at 4 ℃.
5. Mixing the libraries:
the library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE 150. The linker and primer sequences used in the library construction process are detailed in Table 8 below.
TABLE 8 construction of linker and primer sequences for Super-GBS sequencing libraries
| Name (R) | Sequence (5 '-3') |
| Common adaptor top | GATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT |
| Common adaptor bot | CGAGATCGGAAGAGCGGGGACTTTAAGC |
| PstI adaptor top | CACGACGCTCTTCCGATCTAACXXXXXXTGCA |
| PstI adaptor bot | YYYYYYAGATCGGAAGAGCGTCGTG |
| Primer1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| Primer2 | CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAA |
6. Analysis of
Performing Super-GBS sequencing on 19 samples of 5 cherry rootstock varieties to obtain 61M high-quality reads. And (3) aligning the high-quality reads to a reference genome, wherein the alignment rate is 77.85-84.67%, and the average sequencing depth of all samples is 37.47X. Obtaining SNP sites by using GATK (v3.8-1) software, then screening at least one SNP site different from other varieties among 5 varieties to finally obtain 7134 SNP sites, analyzing by treebest software, drawing by using R package ggtree, wherein the sites can be used for accurately identifying 5 varieties of cherry rootstocks, and the identification result is shown in figure 1.
Example 2
This example provides the method of the present invention for identifying the variety of 1 each of 5 cherry stocks randomly collected from the variety nursery of Shandong Dafeng Yuan agriculture Co., Ltd, and simultaneously adding the sequencing data of 5 cherry stocks of known variety (sample in example 1) as a control for testing and verification. The method comprises the following steps:
(1) randomly collecting 1 plant of each of Jingchun No. 3-H11, lan Ding No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and lan Ding No. 2-F10 cherry rootstocks from a variety garden of agriculture Limited company in Shandong Dafeng Yuan to extract genome DNA;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; all samples were culled for sites that were of the same type. Reserving the SNP sites which coincide with 7134 sites in the table 1 to finally obtain 6848 SNP sites;
(5) and constructing an evolutionary tree by using the 6848 SNP sites which are finally obtained, and determining the variety of the cherry sample in the collected variety garden.
The specific operation steps are as follows:
this example mainly comprises the following steps, i.e., digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
Super-GBS library construction is carried out on 1 strain of each of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 randomly collected from variety gardens of agriculture Limited companies in Shandong Dafeng gardens, and the specific process is as follows (the using amount of each sample is as follows):
DEPC water: 21.4 mu L; 10 × CutSmart buffer: 3 mu L of the solution; PstI-HF (4 units): 0.2 mu L; MspI (8 units): 0.4 mu L;
DNA(50ng/μL)：5μL。
all the components are mixed evenly and then cut for 2h at 37 ℃, and then the temperature is kept for 20min at 75 ℃ to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
DEPC water: 13 mu L of the solution; 10 XT 4 ligase buffer: 4 mu L of the solution; PstI Adaptor (0.1 μ M): 1 mu L of the solution; common adaptor (10 μ M): 1.5 mu L; t4 DNA ligase (400U/. mu.L): 0.5 mu L;
and (3) enzyme digestion products: 20 μ L.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. And (3) purification:
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. mu.L of 70% ethanol. Finally, the DNA was recovered from the beads using 40. mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification:
DEPC water: 16 mu L of the solution; taq5 × Master Mix: 5 mu L of the solution; primer 1(10 μ M): 0.5 mu L; primer 2(10 μ M): 0.5 mu L;
purified ligation product: 3 μ L.
Mixing all the components, placing in a PCR instrument, performing amplification for 16 cycles under the reaction condition of pre-denaturation at 95 ℃ for 30s, performing annealing at 62 ℃ for 20s, performing extension at 68 ℃ for 15s, performing extension at 68 ℃ for 5min, and storing at 4 ℃.
5. Mixing the libraries:
the library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE 150. The linker and primer sequences used in the library construction process are detailed in Table 8 of example 1.
6. And (3) selecting SNP sites which are overlapped with the sequencing result according to the SNP site information in the table 1, and finally obtaining 6848 SNP sites.
7. Analysis of
Super-GBS sequencing was performed on 5 samples, resulting in a total of 13.7M high quality reads. High quality reads were aligned to the reference genome at 77.75-83.62, with an average sequencing depth of 38.1 for all samples. Obtaining a large number of SNP sites by utilizing GATK (v3.8-1) software, comparing the SNP sites with 7134 SNP sites in a table 1 to finally obtain 6848 SNP sites in the 7134 SNP sites, analyzing by adopting treebest software, drawing by utilizing R package ggtree, wherein the sites can be used for accurately identifying 5 cherry rootstock varieties, and identification results are shown in a figure 2.
Example 3
The embodiment provides a PCR detection primer corresponding to the SNP site design, multiple copies of cherry stocks are randomly collected from a variety garden of Shandong Dafeng garden agriculture Limited company to perform PCR amplification, 5 kinds of cherry stocks are identified by a sequencing method, and 5 kinds of cherry stocks of known varieties are added as positive controls to perform tests and verification. The method comprises the following steps:
(1) 2 strains of the accurate variety of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 which are provided by a standard institution purchased by the company are respectively taken, and genome DNA is extracted;
(2) randomly collecting 2 strains of Jingchun No. 3-H11, lan Ding No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and lan Ding No. 2-F10 from a variety garden of agriculture Limited company in Dafeng garden in Shandong, and extracting genome DNA;
(3) SNP locus groups which can accurately identify 5 varieties of cherry rootstock varieties are formed by selecting loci from 7134 SNP loci and are shown in a table 2;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, which is shown in Table 3;
(5) performing PCR amplification by using universal primers of 5 cherry rootstocks in the table 3;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) performing typing interpretation on the cherry rootstock variety according to the sequence of the corresponding site in the sequencing result by referring to the used SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 2, and the sequences of the primers are shown in Table 3. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
DNA：2μL；Taq2×Master Mix：25μL；Primer F(10μM)：1μL；Primer R(10μM)：1μL； ddH2O：21μL。
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 5 cherry rootstock varieties are typed by using a SNP locus marker group (shown in table 2) screened from 7134 SNP loci of the invention.
4. Analysis of
The sequence comparison identification result shows that 10 identification results of 5 cherry rootstocks of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 are consistent with the actual variety condition.
Example 4
The embodiment provides a PCR detection primer corresponding to the SNP site design, multiple copies of cherry stock sapling genome DNA are randomly collected from a variety garden of Shandong Dafeng garden agriculture Limited company for PCR amplification, 5 kinds of cherry stock varieties are identified by a sequencing method, and 5 kinds of cherry stocks of known varieties are added as positive controls for test and verification. The method comprises the following steps:
(1) 2 strains of the accurate variety of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 which are provided by a standard institution purchased by the company are respectively taken, and genome DNA is extracted;
(2) randomly collecting 2 strains of Jingchun No. 3-H11, lan Ding No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and lan Ding No. 2-F10 from a variety garden of agriculture Limited company in Dafeng garden in Shandong, and extracting genome DNA;
(3) SNP locus groups which can accurately identify 5 varieties of cherry rootstock varieties and are formed by selecting loci from 7134 SNP loci are shown in a table 4;
(4) designing PCR amplified upstream and downstream primers according to the genomic position of the selected SNP locus, which is shown in Table 5;
(5) performing PCR amplification by using universal primers of 5 cherry rootstocks in the table 5;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) performing typing interpretation on the cherry rootstock variety according to the sequence of the corresponding site in the sequencing result by referring to the used SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 4, and the sequences of the primers are shown in Table 5. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
DNA：2μL；Taq2×Master Mix：25μL；Primer F(10μM)：1μL；Primer R(10μM)：1μL； ddH2O：21μL。
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 5 cherry rootstock varieties are typed by using a SNP locus marker group (shown in table 4) screened from 7134 SNP loci of the invention.
4. Analysis of
The sequence comparison identification result shows that 10 identification results of 5 cherry rootstocks of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 are consistent with the actual variety condition.
Example 5
The embodiment provides a PCR detection primer corresponding to the SNP site design, multiple copies of cherry stocks are randomly collected from a variety garden of Shandong Dafeng garden agriculture Limited company to perform PCR amplification, 5 kinds of cherry stocks are identified by a sequencing method, and 5 kinds of cherry stocks of known varieties are added as positive controls to perform tests and verification. The method comprises the following steps:
(1) 2 strains of the accurate variety of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 which are provided by a standard institution purchased by the company are respectively taken, and genome DNA is extracted;
(2) randomly collecting 2 strains of Jingchun No. 3-H11, lan Ding No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and lan Ding No. 2-F10 from a variety garden of agriculture Limited company in Dafeng garden in Shandong, and extracting genome DNA;
(3) SNP locus groups which can accurately identify 5 varieties of cherry rootstock varieties are formed by selecting loci from 7134 SNP loci and are shown in a table 6;
(4) designing PCR amplified upstream and downstream primers according to the genomic position of the selected SNP locus, which is shown in Table 7;
(5) performing PCR amplification by using universal primers of 5 cherry rootstocks in the table 7;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) performing typing interpretation on the cherry rootstock variety according to the sequence of the corresponding site in the sequencing result by referring to the used SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed based on the positions of the sites in Table 6, and the primer sequences are shown in Table 7. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
DNA：2μL；Taq2×Master Mix：25μL；Primer F(10μM)：1μL；Primer R(10μM)：1μL； ddH2O：21μL。
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 5 cherry rootstock varieties are typed by using a SNP locus marker group (shown in table 6) screened from 7134 SNP loci of the invention.
4. Analysis of
The sequence comparison identification result shows that 10 identification results of 5 cherry rootstock varieties of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 are consistent with the actual variety condition.
Other SNP locus marker groups are selected from 7134 SNP loci, and 5 cherry rootstock varieties of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 can be accurately identified.
Table 1 of the invention is as follows:
in Table 1, numerals 1 to 5 represent: jingchun No. 3-H11, lan ding No. 3-H22, Jisaila No. 5, Jingchun No. 1-H10 and lan ding No. 2-F10
Sequence listing
<110> agriculture Co Ltd in Dafeng Yuan Shandong
<120> cherry rootstock specific molecular marker and screening method and application thereof
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tctcggccaa aagagaaggg 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttggctggaa cacgtcatct 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcttgcattc agttgtgcca 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agcccgtgct tgcttctaat 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ctactcgggg catgtacgtc 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggcaacactt gccggatttt 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gggcgaagat agcccatcaa 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
agaatgcaat ggagtgccca 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
cgtggggttt ttcatgcgtt 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ggctctatct tgatgccgct 20
Claims (6)
1. The method can accurately identify the SNP sites of 5 cherry rootstocks including Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10, and is characterized by comprising 7134 sites, wherein the specific sites are shown in Table 1.
2. The SNP locus according to claim 1, wherein thousands of sets of SNP locus marker groups capable of accurately identifying 5 varieties of cherry rootstock can be screened, wherein three sets of SNP locus marker group information and marker amplification primer information capable of accurately identifying 5 varieties of cherry rootstock are as follows:
table 2 enables accurate identification of a set of SNP site information of 5 cherry rootstocks
SNP site identifying primer information in Table 2 described in Table 3
Table 4 enables accurate identification of a set of SNP site information of 5 cherry rootstocks
SNP site identifying primer information in Table 4 described in Table 5
Table 6 enables accurate identification of a set of SNP site information of 5 cherry rootstocks
SNP site identifying primer information in Table 6 shown in Table 7
3. The method for screening the specific molecular marker of the cherry rootstock variety by using the simplified genome sequencing technology Super-GBS is characterized by comprising the following steps:
(1) extracting genome DNA by using 5 cherry rootstock varieties with accurate varieties, including Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10 as samples;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) according to the typing result of each variety, firstly, sites with consistent typing in all samples are removed, then, sites with complete consistent individual typing and no individual deletion in each variety are screened, SNP sites are obtained, the obtained SNP sites are filtered and screened by using standard samples of 5 varieties of cherry rootstocks, the SNP sites are verified by using blind samples of 5 varieties of cherry rootstocks, and finally, the SNP sites capable of accurately identifying the 5 varieties of cherry rootstocks are obtained (see table 1).
4. The method for screening the specific molecular markers of the 5 varieties of cherry rootstock by using the simplified genome sequencing technology Super-GBS according to claim 3, wherein the SNP filtering condition is that the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%.
5. The application of the SNP locus of claim 1 in accurately identifying 5 cherry rootstock varieties of Jingchun No. 3-H11, Landing No. 3-H22, Gisela No. 5, Jingchun No. 1-H10 and Landing No. 2-F10.
6. A PCR method for accurately identifying 5 varieties of cherry rootstocks is characterized by comprising the following steps:
(1) selecting a site group formed by combining several SNP sites from the SNP sites in the table 1 of claim 1 and capable of identifying 5 varieties of cherry rootstocks;
(2) designing a specific PCR amplification primer according to the genome position of the locus;
(3) extracting 5 kinds of cherry rootstock sample genome DNA;
(4) the SNP marker set screening method according to claim 2, wherein the three selected site sets and the specific primers corresponding to the sites are shown in tables 2 to 7 in claim 2;
(5) carrying out PCR amplification by using a primer capable of amplifying the SNP locus;
(6) performing first-generation sequencing on the obtained PCR product;
(7) and (4) carrying out cherry rootstock variety analysis and identification according to the sequence information by contrasting SNP locus information.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110812606.5A CN113957167B (en) | 2021-07-19 | 2021-07-19 | Cherry rootstock specific molecular marker and screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110812606.5A CN113957167B (en) | 2021-07-19 | 2021-07-19 | Cherry rootstock specific molecular marker and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113957167A true CN113957167A (en) | 2022-01-21 |
| CN113957167B CN113957167B (en) | 2022-09-27 |
Family
ID=79460395
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110812606.5A Active CN113957167B (en) | 2021-07-19 | 2021-07-19 | Cherry rootstock specific molecular marker and screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113957167B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921855A (en) * | 2010-08-18 | 2010-12-22 | 西北农林科技大学 | Method for identifying Prunus mahaleb CDR-1 stock molecules |
| CN108103235A (en) * | 2018-02-11 | 2018-06-01 | 山东省果树研究所 | A kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation |
| CN111349717A (en) * | 2020-05-06 | 2020-06-30 | 北京市林业果树科学研究院 | SSR (simple sequence repeat) markers of sweet cherry stock resources and fingerprint spectrum database thereof |
-
2021
- 2021-07-19 CN CN202110812606.5A patent/CN113957167B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921855A (en) * | 2010-08-18 | 2010-12-22 | 西北农林科技大学 | Method for identifying Prunus mahaleb CDR-1 stock molecules |
| CN108103235A (en) * | 2018-02-11 | 2018-06-01 | 山东省果树研究所 | A kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation |
| CN111349717A (en) * | 2020-05-06 | 2020-06-30 | 北京市林业果树科学研究院 | SSR (simple sequence repeat) markers of sweet cherry stock resources and fingerprint spectrum database thereof |
Non-Patent Citations (1)
| Title |
|---|
| 张灵灵等: "樱花组织培养研究现状、问题及展望", 《江汉大学学报(自然科学版)》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113957167B (en) | 2022-09-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111560463B (en) | Three gala apple specific molecular markers and screening method and application thereof | |
| CN107345256B (en) | Transcriptome sequencing-based EST-SSR primer group for developing mucuna pruriens, method and application | |
| Choi et al. | Development of nuclear gene-derived molecular markers linked to legume genetic maps | |
| CN108754013B (en) | Molecular marker closely linked with hot pepper cytoplasmic male sterility restoring gene and obtaining method and application thereof | |
| Ritland et al. | Genetic mapping in conifers | |
| Chhetri et al. | Genome-wide association study of wood anatomical and morphological traits in Populus trichocarpa | |
| CN108588255B (en) | Indel marker development for distinguishing five pepper cultivars and application thereof | |
| CN111916151B (en) | Traceability detection method and application of verticillium wilt of alfalfa | |
| CN113957167B (en) | Cherry rootstock specific molecular marker and screening method and application thereof | |
| CN113444827B (en) | Grape variety specific molecular marker and screening method and application thereof | |
| CN113584206B (en) | Cherry main cultivated variety specific molecular marker and screening method and application thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN113549705B (en) | Pear stock specific molecular marker and screening method and application thereof | |
| CN113355392B (en) | Apple rootstock specific molecular marker locus, and screening method and application thereof | |
| CN111235303B (en) | Method for identifying cord-grass and spartina alterniflora | |
| CN115141893A (en) | Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof | |
| CN113493819B (en) | Fuji series apple specific molecular marker locus, and screening method and application thereof | |
| CN108676906B (en) | SSR locus of corn chloroplast genome and application of SSR locus in variety identification | |
| CN113930531B (en) | Grape stock specificity molecular marker and screening method and application thereof | |
| CN113215300B (en) | 7 apple variety specific molecular markers and screening method and application thereof | |
| Cervera et al. | Applications of Molecular Marker Technologies in Popf)/us Breeding1 | |
| CN113355445B (en) | Pear variety specific molecular marker and screening method and application thereof | |
| CN110643728A (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| Lu et al. | Genome-Wide Association Study of Wood Anatomical and Morphological | |
| CN113322341A (en) | Blueberry variety specific molecular marker locus as well as screening method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |