CN113355445B - Pear variety specific molecular marker and screening method and application thereof - Google Patents
Pear variety specific molecular marker and screening method and application thereof Download PDFInfo
- Publication number
- CN113355445B CN113355445B CN202110694322.0A CN202110694322A CN113355445B CN 113355445 B CN113355445 B CN 113355445B CN 202110694322 A CN202110694322 A CN 202110694322A CN 113355445 B CN113355445 B CN 113355445B
- Authority
- CN
- China
- Prior art keywords
- pear
- snp
- pears
- varieties
- pear varieties
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific molecular marker of 12 pear varieties and a screening method and application thereof, comprising the following steps: (1) taking leaves to extract genome DNA; (2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified; (3) after filtering sequencing data, obtaining SNP loci by using GATK, and filtering the SNP to improve the accuracy of the SNP; (4) screening at least one different site of 12 pear varieties from other varieties according to the typing result of each variety; (5) according to the screening strategy, 4479 SNP loci for identifying 12 pear varieties are finally screened, and thousands of SNP locus marker groups capable of efficiently identifying 12 pear varieties can be combined according to the types of the pear varieties which can be distinguished by each locus in the SNP loci; (6) two simple, convenient, rapid and reliable methods for identifying 12 pear varieties are developed based on the locus marks, and a technical basis is laid for ensuring accurate identification and control of the pear varieties by scientific research departments, nursery stock breeding and orchard planting enterprises.
Description
Technical Field
The invention relates to a specific molecular marker for 12 pear varieties, a screening method and application thereof, belonging to the technical field of biology.
Background
The pear is a plant of the genus Pyri (Pyrus L.) of the subfamily Pyricularia (Pomaceae) of the Rosaceae (Rosaceae), is one of the main fruit trees planted in China, and has the second cultivation area and yield to the apple. China is one of three origin centers of the world pears and is also the first country of pear production, and the yield accounts for 65% of the total amount of the world. The pear plants are divided into four populations of European population, Mediterranean population, Miyaya population and east Asian population. The autumn pear system, the western pear system, the white pear system and the Chinese pear system are main cultivation varieties of pear trees at present. The pear variety breeding history is long, more than 100 varieties are common in China at present, the varieties are multiple, the structure is unreasonable, and the variety updating speed is slow; the improved variety nursery stock breeding system is not sound, the nursery stock quality is lack of guarantee, the pear orchard management mostly adopts the traditional mode, and the research, development and application of labor-saving cultivation management technology are insufficient and are the restriction factors of the development of pears in China. In recent years, with the introduction of foreign excellent varieties and cultivation techniques and the application of molecular assisted breeding techniques, new excellent varieties and cultivation management modes are gradually entering and replacing the traditional breeding, breeding and planting modes.
The 12 pear varieties are selected from new superior varieties popularized in main pear planting production areas in China in recent years, have excellent properties and high quality, occupy the high-end market of pear products, and are mainstream products produced by variety breeding departments and orchard enterprises. Therefore, the accurate identification and identification of the strains of the varieties have great significance for the links of new variety breeding, resource nursery garden establishment, enterprise nursery stock breeding and selling, orchard nursery stock planting production and the like of scientific research departments.
Disclosure of Invention
The invention provides specific molecular marker loci of 12 pear varieties, a screening method and application thereof, 4479 variety specific SNP markers are screened in total, two simple, convenient, rapid and reliable methods for identifying 12 pear varieties are developed based on the markers, and a technical basis is laid for accurately controlling the pear varieties from the source.
The invention is realized by adopting the following technical scheme:
the method for screening the specific molecular markers of 12 pear varieties by using the simplified genome sequencing technology Super-GBS comprises the following steps:
(1) taking the known and accurate autumn pear, golden pear, crown, early crisp, jinfeng, new pear No. 7, fragrant pear, Chinese flowering, rich water, JUMBO new high and lucky pear varieties as samples, and taking leaves to extract genome DNA;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) screening all sites which have completely consistent individual types and have no individual deletion and are different from other varieties in the consistent sites of the individual types according to the typing result of each variety; finally, 4479 SNP sites are screened, and the details are shown in Table 1;
(6) and (3) constructing an evolutionary tree and clustering analysis by using 4479 SNP loci or partial SNP loci.
In Table 1, the numbers 1-12 of the head part respectively represent autumn moon pear, rich water, JUMBO Xingao, Happy water, Huangjin pear, crown, early crisp, Jinfeng, Xin pear No. 7, Yulu fragrance, fragrant pear, Huajin.
Secondly, the invention provides a method for identifying 12 pear varieties by using a PCR method, which comprises the following steps:
(1) selecting several SNP loci from the SNP loci in Table 1 to combine into a locus group capable of identifying 12 pear varieties;
(2) designing a specific PCR amplification primer according to the genome position of the locus;
(3) extracting leaf genome DNA of 12 pear varieties;
(4) the SNP marker set selection method according to claim 2, wherein the three selected site sets and the specific primers corresponding to the sites are shown in the following tables 2 to 7;
(5) carrying out PCR amplification by using a primer capable of amplifying the SNP locus;
(6) performing first-generation sequencing on the obtained PCR product;
(7) and (5) carrying out analysis and variety identification on the pear varieties according to the sequence information and the SNP site information.
The invention can screen out thousands of groups of SNP locus marker groups which can accurately identify 12 pear varieties, wherein the invention lists three groups of SNP locus marker group information and marker amplification primer information which can accurately identify 12 pear varieties as follows:
table 2A set of SNP site information capable of accurately identifying 12 pear varieties
TABLE 3 SNP site identifying primer information in Table 2
TABLE 4 set of SNP site information enabling accurate identification of 12 pear varieties
TABLE 5 SNP site identifying primer information in Table 4
Table 6A set of SNP site information capable of accurately identifying 12 pear varieties
TABLE 7 SNP site identifying primer information in Table 6
The invention has the beneficial effects that: the genome diversity of the pear varieties is small, a large amount of interference information needs to be filtered in the screening process, and finally the SNP sites capable of accurately identifying 12 pear varieties can be obtained, the sites can be used together or reasonably combined and used in groups, and the tissue culture seedlings, the grafting seedlings and the finished seedlings of autumn moon pears, golden pears, crown, early shortbread, Jinfeng, New pear No. 7, Yulu fragrance, fragrant pears, Huajin, rich water, JUMBO new height and fortune water can be accurately identified, so that the control of the varieties by seedling enterprises is ensured, and the economic loss caused by errors in the breeding process is reduced.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a diagram of an evolutionary tree constructed by using 4479 specific SNP markers (the SNP markers are shown in Table 1) of 12 screened autumn moon pears, golden pears, crown, early crisps, jinfeng pears, new pears No. 7, yulu fragrant pears, bergamot, Huajin, rich water, JUMBO Xingao and lucky water, and can accurately distinguish 12 pear varieties.
FIG. 2 is a diagram showing that 12 pear varieties can be accurately distinguished by classifying more than 90% of 4479 SNP loci selected by utilizing the selection.
In fig. 1 and 2 of the present invention, the varieties corresponding to the sample numbers are shown in the following table:
| serial number | Variety of the same | Number of samples | Sample numbering |
| 1 | Autumn moon pear | 3 | C-16、C-29、C-45 |
| 2 | Golden pear | 4 | C-61、C-50、C-22、C-25 |
| 3 | Imperial crown | 4 | C-39、C-32、C-53、C-64 |
| 4 | Early crisp | 5 | C-19、C-17、C-42、C-56、C-66 |
| 5 | Jinfeng tea | 4 | C-31、C-18、C-47、C-71 |
| 6 | New pear No. 7 | 2 | C-23、C-34 |
| 7 | Yulu incense | 4 | C-54、C-21、C-60、C-69 |
| 8 | Fragrant pear | 4 | C-24、C-33、C-77、C-80 |
| 9 | Hua Jin | 5 | C-36、C-26、C-38、C-57、C-75 |
| 10 | Rich Water | 4 | C-41、C-28、C-43、C-63 |
| 11 | JUMBO New height | 4 | C-55、C-46、C-48、C-52 |
| 12 | Happy water | 3 | C-78、C-65、C-70 |
Detailed Description
Example 1
The embodiment provides a method for screening out SNP molecular markers of 12 pear varieties including autumn pear, golden pear, crown, early crisp, Jinfeng, New Pear No. 7, Yulu fragrant, fragrant pear, Huajin, rich water, JUMBO Xingao and Happy water by using a simplified genome sequencing technology Super-GBS, which comprises the following steps:
(1) taking 2 autumn moon pears, 3 golden pears, 3 crown crowns, 4 early crisps, 3 jinfeng pears, 2 new pears No. 7, 3 jade dew, 3 fragrant pears, 4 Huajin pears, 3 rich water, 3 JUMBO new high and 2 lucky water pear variety samples with accurate varieties, and taking leaves to extract genome DNA;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) screening SNP loci which have completely consistent individual types and have no individual deletion at the consistent typing loci and are different from at least one variety locus in other 11 pear varieties according to the typing result of each variety, and finally screening 4479 SNP loci;
(6) and (3) constructing an evolutionary tree and clustering analysis by using 4479 SNP loci.
The specific operation steps are as follows:
this example mainly comprises the following steps, i.e., digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
the Super-GBS is built for 2 autumn moon pears, 3 golden pears, 3 crown pears, 4 early crisp pears, 3 jinfeng pears, 2 new pears No. 7, 3 yulu fragrant pears, 3 fragrant pears, 4 Huajin pears, 3 rich water, 3 JUMBO new highs and 2 lucky pear varieties which are provided by an authority mechanism purchased by the company, and the concrete process is as follows (the using amount of each enzyme digestion reagent of each sample is as follows):
all the components are mixed evenly and then cut for 2h at 37 ℃, and then the temperature is kept for 20min at 75 ℃ to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. And (3) purification:
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. mu.L of 70% ethanol. Finally, the DNA was recovered from the beads using 40. mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification:
mixing all the components, placing in a PCR instrument, performing amplification for 16 cycles under the reaction condition of pre-denaturation at 95 ℃ for 30s, performing annealing at 62 ℃ for 20s, performing extension at 68 ℃ for 15s, performing extension at 68 ℃ for 5min, and storing at 4 ℃.
5. Mixing the libraries:
the library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE 150. The linker and primer sequences used in the library construction process are detailed in Table 8 below.
TABLE 8 construction of linker and primer sequences for Super-GBS sequencing libraries
| Name (R) | Sequence (5 '-3') |
| Common adaptor top | GATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT |
| Common adaptor bot | CGAGATCGGAAGAGCGGGGACTTTAAGC |
| PstI adaptor top | CACGACGCTCTTCCGATCTAACXXXXXXTGCA |
| PstI adaptor bot | YYYYYYAGATCGGAAGAGCGTCGTG |
| Primer1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| Primer2 | CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAA |
6. And (3) analysis:
performing Super-GBS sequencing on 35 samples of 12 pear varieties to obtain 96M high-quality reads. And aligning the high-quality reads to a reference genome, wherein the alignment rate is 77.37-8693 percent, and the average sequencing depth of all samples is 37.52 x. SNP sites are obtained by utilizing GATK (v3.8-1) software, then, at least one SNP site different from other varieties among 12 varieties is screened, 4479 SNP sites are finally obtained, treebest software is adopted for analysis, R package ggtree mapping is utilized, the sites can be used for accurately identifying 12 pear varieties, and the identification result is shown in figure 1.
Example 2
This example provides a part of 4479 SNP markers obtained according to the invention for species identification of 11 pear varieties randomly collected from the variety nursery of Shandong Dafeng Yun agriculture Co., Ltd, while sequencing data of 12 pear seedling samples of known varieties (samples in example 1) were added as controls for testing and validation. The method comprises the following steps:
(1) randomly collecting 1 plant of each of autumn moon pears, golden pears, crown, early shortbread, jinfeng, yulu fragrant pears, bergamot, Huajin, rich water, JUMBO new high and lucky water from a variety garden of agriculture Limited company in Dafeng garden of Shandong, and extracting genome DNA;
(2) constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; all samples were culled for sites that were of the same type. Reserving SNP loci which are coincided with 4479 loci in the table 1, and finally obtaining 4255 SNP loci;
(5) and constructing an evolutionary tree by utilizing 4255 SNP sites finally obtained, and determining the variety of the pear sample in the collected variety garden.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e.digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
the method is characterized in that 1 each of autumn-moon pears, golden pears, crown crowns, early crisps, jinfeng pears, yulu pears, bergamot pears, Huajin, rich water, JUMBO new high and lucky water which are randomly collected from a limited variety garden in agriculture in the Shandong Dafeng garden are subjected to Super-GBS library construction, and the specific process is as follows (the using amount of each sample is as follows):
all the components are mixed evenly and then are subjected to enzyme digestion at 37 ℃ for 2h, and then the temperature is kept at 75 ℃ for 20min to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. And (3) purification:
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. mu.L of 70% ethanol. Finally, the DNA was recovered from the beads using 40. mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification:
mixing all the components, placing in a PCR instrument, performing amplification for 16 cycles under the reaction condition of pre-denaturation at 95 ℃ for 30s, performing annealing at 62 ℃ for 20s, performing extension at 68 ℃ for 15s, performing extension at 68 ℃ for 5min, and storing at 4 ℃.
5. Mixing the libraries:
the library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE 150. The linker and primer sequences used in the library construction process are detailed in Table 8 below in example 1.
6. And (3) analysis:
a total of 27.9M high quality reads were obtained by performing Super-GBS sequencing on 11 pear samples. High quality reads were aligned to the reference genome at rates of 78.25-82.43, with an average sequencing depth of 38.2 for all samples. A large number of SNP sites are obtained by utilizing GATK (v3.8-1) software, the SNP sites are compared with 4479 SNP sites in a table 1, 4255 SNP sites in the 4479 SNP sites are finally obtained, treebest software is adopted for analysis, R package ggtree drawing is utilized, the sites can be used for accurately identifying 12 pear varieties, and identification results are shown in a figure 2.
Example 3
This example provides 4479 SNP sites according to the present invention, screening a few SNP sites, designing corresponding PCR detection primers according to the positions of the genomes of the sites, performing PCR amplification on genomic DNAs of multiple pear varieties randomly collected from the variety gardens of Shandong Dafengyuan agriculture Co Ltd, performing identification of 12 pear varieties by a first-generation sequencing method, and simultaneously adding 12 pear varieties of known varieties as positive controls for testing and verification. The method comprises the following steps:
(1) 2 accurate varieties of autumn and moon pears, golden pears, crown, early crisp, jinfeng pears, No. 7 new pears, Yulu fragrance, bergamot pears, Huajin, rich water, JUMBO new high and lucky water saplings purchased by a standard institution of the company are purchased, and genome DNA is extracted;
(2) randomly collecting 2 seedlings of autumn pear, golden pear, crown, early crisp, jinfeng, No. 7 new pear, Yulu fragrant, bergamot pear, Huajin, rich water, JUMBO Xingao and Happy water from a variety garden of agriculture Limited company in Dafeng garden of Shandong, and extracting genome DNA;
(3) selecting sites from 4479 SNP sites to form a group of SNP site groups which can accurately identify 12 pear varieties, and the group is shown in Table 2;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, as shown in Table 3;
(5) performing PCR amplification by using the universal primers of 12 pear varieties in the table 3;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) referring to the SNP site information, and performing typing interpretation on the pear varieties according to the sequences of the corresponding sites in the sequencing result.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 2, and the sequences of the primers are shown in Table 3. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 12 pear varieties are typed by using one SNP site marker group (shown in table 2) screened from 4479 SNP sites.
4. Analysis of
The sequence comparison identification results show that 48 identification results of 12 pear varieties of autumn moon pear, golden pear, crown, early crisp, jinfeng, new pear No. 7, Yulu fragrance, fragrant pear, Huajin, rich water, JUMBO new high and lucky water are consistent with the actual variety conditions.
Example 4
This example provides 4479 SNP sites according to the present invention, screening a few SNP sites, designing corresponding PCR detection primers according to the positions of the genomes of the sites, performing PCR amplification on genomic DNAs of multiple pear varieties randomly collected from the variety gardens of Shandong Dafengyuan agriculture Co Ltd, performing identification of 12 pear varieties by a first-generation sequencing method, and simultaneously adding 12 pear varieties of known varieties as positive controls for testing and verification. The method comprises the following steps:
(1) 2 seedlings of autumn-moon pears, golden pears, crown, early shortcakes, jinfeng pears, No. 7 new pears, Yulu-xiang pears, Chinese gold, rich water, JUMBO new high and lucky water, which are provided by a standard institution purchased by the company, are accurate in variety, and genome DNA is extracted;
(2) randomly collecting 2 seedlings of autumn pear, golden pear, crown, early crisp, jinfeng, No. 7 new pear, Yulu fragrant, bergamot pear, Huajin, rich water, JUMBO Xingao and Happy water from a variety garden of agriculture Limited company in Dafeng garden of Shandong, and extracting genome DNA;
(3) selecting sites from 4479 SNP sites to form a group of SNP site groups which can accurately identify 12 pear varieties, and the group is shown in Table 4;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, see Table 5;
(5) performing PCR amplification by using the universal primers of 12 pear varieties in the table 5;
(6) performing first generation sequencing on the amplified sequence;
(7) and (4) carrying out typing interpretation on the pear varieties according to the sequences of the corresponding sites in the sequencing results by referring to the SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 4, and the sequences of the primers are shown in Table 5. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 12 pear varieties are typed by using one SNP site marker group (shown in table 4) screened from 4479 SNP sites.
4. Analysis of
The sequence comparison identification result shows that the total 48 identification results of autumn moon pears, golden pears, crown, early crisp, Jinfeng pears, No. 7 new pears, Yulu fragrance, bergamot pears, Huajin, rich water and JUMBO new height and lucky water of 12 pear varieties accord with the actual variety conditions.
Example 5
This example provides 4479 SNP sites according to the present invention, screening a few SNP sites, designing corresponding PCR detection primers according to the positions of the genomes of the sites, performing PCR amplification on genomic DNAs of multiple pear varieties randomly collected from the variety gardens of Shandong Dafengyuan agriculture Co Ltd, performing identification of 12 pear varieties by a first-generation sequencing method, and simultaneously adding 12 pear varieties of known varieties as positive controls for testing and verification. The method comprises the following steps:
(1) 2 seedlings of autumn-moon pears, golden pears, crown, early shortcakes, jinfeng pears, No. 7 new pears, Yulu-xiang pears, Chinese gold, rich water, JUMBO new high and lucky water, which are provided by a standard institution purchased by the company, are accurate in variety, and genome DNA is extracted;
(2) randomly collecting 2 seedlings of autumn pear, golden pear, crown, early crisp, jinfeng, No. 7 new pear, Yulu fragrant, bergamot pear, Huajin, rich water, JUMBO Xingao and Happy water from a variety garden of agriculture Limited company in Dafeng garden of Shandong, and extracting genome DNA;
(3) selecting sites from 4479 SNP sites to form a group of SNP site groups capable of accurately identifying 12 pear varieties, which is shown in Table 6;
(4) designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, see Table 7;
(5) performing PCR amplification by using the universal primers of 12 pear varieties in the table 7;
(6) performing a first-generation sequencing of the amplified sequence;
(7) and (4) carrying out typing interpretation on the pear varieties according to the sequences of the corresponding sites in the sequencing results by referring to the SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed based on the positions of the sites in Table 6, and the primer sequences are shown in Table 7. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30 min. The amplification system is as follows.
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, Inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 12 pear varieties are typed by using one SNP site marker group (shown in Table 6) screened from 4479 SNP sites.
4. Analysis of
The sequence comparison identification result shows that the total 48 identification results of autumn moon pears, golden pears, crown, early crisp, Jinfeng pears, No. 7 new pears, Yulu fragrance, bergamot pears, Huajin, rich water and JUMBO new height and lucky water of 12 pear varieties accord with the actual variety conditions. Other SNP locus marker groups are selected from 4479 SNP loci, and 12 pear varieties of autumn moon pear, golden pear, crown, early crisp, jinfeng, new pear No. 7, jade dew, bergamot pear, Huajin, rich water, JUMBO new high and lucky water can be accurately identified.
Table 14479 SNP sites are as follows:
sequence listing
<110> agriculture Limited in Dafeng Yuan Shandong
<120> pear variety specific molecular marker and screening method and application thereof
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cttccatgca ggctgatcca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctttcccatg gtggctgact 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggaaaagctt ggcgactgag 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aggaaagcac tggccacaaa 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaggccggtc ttaagtgcat 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agtcatgaca agccaagggg 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ccaagcacgt taacaagccc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
atttgtgcac tgcgtttccc 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tgccgaggga attgacgatg 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ccaacaacga cgacctttcg 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
aagtgcttgg tttgagccgt 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gctggttgag aggccattgt 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gcatcctatg ctcgagaccc 20
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gtgtcggcct caaccaaaac 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
acccccacac cctacattct 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gtttatggcg ctgacgttgg 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ccaaccgggt acgctctaag 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tcgtcgtcga agtcatcagc 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cacacccaca tcacacaacc 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
tgttggaaca gatcgccacc 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
gaggcagaat ggatgagcga 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ttatgacgag ggggttgtgc 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
aggtacgtca gaatgtgcgg 20
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
ggctacaacc tcccaacaca 20
Claims (3)
1. The application of the primers for detecting the SNP loci in the table 2 in accurately identifying 12 pear varieties is characterized in that the 12 pear varieties are autumn pears, golden pears, crown, early crisp, jinfeng, new pears No. 7, jade dew, fragrant pears, Huajin, rich water, JUMBO new high and lucky water;
the SNP site information is shown in Table 2, and the primer information is shown in Table 3:
table 2A set of SNP site information capable of accurately identifying 12 pear varieties
SNP site identifying primer information in Table 2 described in Table 3
2. The application of the primers for detecting the SNP loci in the table 4 in accurately identifying 12 pear varieties is characterized in that the 12 pear varieties are autumn pears, golden pears, crown, early crisp, jinfeng, new pears No. 7, jade dew, fragrant pears, Huajin, rich water, JUMBO new high and lucky water;
the SNP site information is shown in Table 4, and the primer information is shown in Table 5:
TABLE 4 set of SNP site information enabling accurate identification of 12 pear varieties
SNP site identifying primer information in Table 4 described in Table 5
3. The application of the primers for detecting the SNP sites in the table 6 in accurately identifying 12 pear varieties is characterized in that the 12 pear varieties are autumn pears, golden pears, crown crowns, early shortbreads, jinfeng pears, new pears No. 7, Yulu pears, fragrant pears, Huajin, rich water, JUMBO new high and lucky water;
the SNP site information is shown in Table 6, and the primer information is shown in Table 7:
table 6A set of SNP site information capable of accurately identifying 12 pear varieties
SNP site identifying primer information in Table 6 shown in Table 7
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110694322.0A CN113355445B (en) | 2021-06-22 | 2021-06-22 | Pear variety specific molecular marker and screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110694322.0A CN113355445B (en) | 2021-06-22 | 2021-06-22 | Pear variety specific molecular marker and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113355445A CN113355445A (en) | 2021-09-07 |
| CN113355445B true CN113355445B (en) | 2022-09-27 |
Family
ID=77535754
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110694322.0A Active CN113355445B (en) | 2021-06-22 | 2021-06-22 | Pear variety specific molecular marker and screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113355445B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104032018B (en) * | 2014-06-18 | 2016-08-17 | 南京农业大学 | The SNP marker primer in a kind of melonidum skin smoothness main effect QTL site and application thereof |
| CN104032021B (en) * | 2014-06-18 | 2016-05-04 | 南京农业大学 | SNP molecular labeling primer and the application thereof in a kind of pear fruit seed amount main effect QTL site |
| CN105506075B (en) * | 2015-12-10 | 2019-09-20 | 湖北省农业科学院果树茶叶研究所 | One kind SNP marker relevant to Pear black spot resistance and application |
-
2021
- 2021-06-22 CN CN202110694322.0A patent/CN113355445B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113355445A (en) | 2021-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108611364A (en) | A kind of preparation method of non-transgenic CRISPR mutant | |
| CN106148353B (en) | Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling | |
| Chhetri et al. | Genome-wide association study of wood anatomical and morphological traits in Populus trichocarpa | |
| CN111560463B (en) | Three gala apple specific molecular markers and screening method and application thereof | |
| CN102703586B (en) | Method for constructing Prunus mume Sieb.et Zucc SSR (simple sequence repeat) genetic map | |
| Ming-Yu et al. | Estimating genetic diversity of rice landraces from Yunnan by SSR assay and its implication for conservation | |
| CN113444827B (en) | Grape variety specific molecular marker and screening method and application thereof | |
| CN109735648B (en) | Method for screening wheat with different thousand grain weights and special kit thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN113355445B (en) | Pear variety specific molecular marker and screening method and application thereof | |
| CN110257546B (en) | New salt-tolerant gene cluster qST12 in rice seedling stage Pokkali And applications | |
| CN110484648B (en) | Indel molecular marker for identifying single cluster inflorescence of capsicum, primer and application | |
| CN108003227A (en) | GAP-associated protein GAP and its encoding gene during a kind of rice early blossoming | |
| CN106566825B (en) | The method for screening rice tissue specifically expressing cis-acting elements and its flanking sequence | |
| CN107190089A (en) | The method that using molecular labeling 3 kinds of strawberry cultivars are carried out with quick discriminating | |
| CN114592086B (en) | SNP molecular marker related to resistance of ring spot virus PRSV and application | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| CN113584206B (en) | Cherry main cultivated variety specific molecular marker and screening method and application thereof | |
| Rai | Rice culture in agriculture: Indian perspective | |
| CN113549705B (en) | Pear stock specific molecular marker and screening method and application thereof | |
| CN113215300B (en) | 7 apple variety specific molecular markers and screening method and application thereof | |
| CN113493819B (en) | Fuji series apple specific molecular marker locus, and screening method and application thereof | |
| CN113930531B (en) | Grape stock specificity molecular marker and screening method and application thereof | |
| CN108642166A (en) | Utilize the unicellular method for carrying out genome haplotype assembling of pear pollen | |
| CN113957167B (en) | Cherry rootstock specific molecular marker and screening method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |