CN113584206B - Cherry main cultivated variety specific molecular marker and screening method and application thereof - Google Patents
Cherry main cultivated variety specific molecular marker and screening method and application thereof Download PDFInfo
- Publication number
- CN113584206B CN113584206B CN202110894426.6A CN202110894426A CN113584206B CN 113584206 B CN113584206 B CN 113584206B CN 202110894426 A CN202110894426 A CN 202110894426A CN 113584206 B CN113584206 B CN 113584206B
- Authority
- CN
- China
- Prior art keywords
- cherry
- snp
- varieties
- artificial sequence
- sequencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a 19 cherry variety specific molecular marker and a screening method and application thereof, comprising the following steps: (1) taking leaves to extract genome DNA; (2) Constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified; (3) After filtering sequencing data, obtaining SNP loci by using GATK, and filtering the SNP to improve the accuracy of the SNP; (4) Screening at least one locus different from other varieties in 19 cherry varieties according to the typing result of each variety; (5) According to the screening strategy, 3751 SNP sites are screened, and thousands of SNP site marker groups capable of efficiently identifying 19 cherry varieties can be combined according to the types of varieties which can be distinguished by each site in the SNP sites; (6) Two simple, convenient, rapid and reliable methods for identifying 19 cherry varieties are developed based on the locus markers, and a technical basis is laid for accurately controlling the cherry varieties from the source.
Description
Technical Field
The invention relates to 19 cherry variety specific molecular markers and a screening method and application thereof, belonging to the technical field of biology.
Background
Cherry (Cerasus spp.) is a plant of the genus Prunus (Prunus) of the family Rosaceae (Rosaceae) Prunoideae (Prunoideae) family. There are only 4 kinds of cherries cultivated in the world, namely cherries (Cerasus pseudocerasus g.don), prunus Cerasus (Cerasus avium (l.), moench.), prunus Cerasus (Cerasus vulgaris mill.), and prunus Cerasus (Cerasus tomesus wilsonis wal.). Among them, cherries, sweet cherries and tart cherries play an important role in production.
Historically, cherries in China have been cultivated in courtyards and are limited to the type of small soft-flesh cherries of the country of origin. The introduction of European sweet cherries and European sour cherries in 1871, the small-scale commercial cultivation from the 30s in 20 th century, the introduction of a large amount of European sweet cherry varieties suitable for fresh eating from European and American countries in the end of the 70 s in 20 th century, and the large-scale establishment of commercial orchards in the traditional production areas of sweet cherries. After the 80 s in the 20 th century, the commercial cultivation of sweet cherries is rapidly expanded, so that the sweet cherries become one of the fastest-developing fruit trees in China in nearly 20 years, and because the sweet cherries have the advantages of early marketing, high yield per unit area and large market demand, the sweet cherries are classified as important tree species for fruit tree production in all suitable cultivation areas. In the cherry cultivation varieties in China, fresh cherry cultivation is mainly used, the cultivation area accounts for more than 95%, and the yield accounts for more than 90%.
At present, sweet cherry gardens which are dispersedly operated by farmers as units are still abundant in cherry production in China, along with transformation upgrading of agriculture and updating of orchards in China, the variety updating of the cherry gardens is more urgent, and the demand for pursuing new and excellent fruits is larger and larger.
The 19 cherry varieties adopted by the invention are main varieties for orchard planting and market sale in China at present, and accurate identification and identification are the basis of seedling breeding, so that the loss of enterprises and planters caused by variety mixing is reduced, and the technical guarantee is provided for the links of breeding, selling and planting of the cherry varieties.
Disclosure of Invention
The invention provides a screening method of specific molecular markers of 19 cherry varieties, 3751 variety specific SNP markers are screened by the method, two simple, convenient, rapid and reliable methods for identifying the 19 cherry varieties are developed based on the markers, and a technical basis is laid for accurately controlling the cherry varieties from the source.
In order to solve the technical problems, the invention adopts the following technical scheme:
firstly, the invention provides a method for screening specific molecular markers of 19 cherry varieties by using a simplified genome sequencing technology Super-GBS, which comprises the following steps:
(1) Extracting genomic DNA from a sample of Samite, sweet Heart, meizao, ferro Watt, yanyang, black gold, benten, damming star, fildy Watt, kodia, canadian cherry, topaz, high sand, american cherry, red damask, red lantern, masshhada, fermi and Filta having a known and accurate variety;
(2) Constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) Filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) Filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the loci with consistent typing in all samples;
(5) Screening all sites which have completely consistent individual typing, have no individual deletion at the consistent typing sites and are different from other varieties in each variety according to the typing result of each variety; finally, 3751 SNP sites are screened, and the details are shown in Table 1;
(6) And (3) constructing an evolutionary tree and clustering analysis by using 3751 SNP sites or part of SNP sites.
Secondly, the invention provides a method for identifying 19 cherry varieties by using a PCR method, which comprises the following steps:
(1) Screening several SNP loci from the SNP loci in the table 1 to form a locus group capable of identifying 19 cherry varieties;
(2) Designing a specific PCR amplification primer according to the genome position of the locus;
(3) Extracting genome DNA of 19 cherry varieties;
(4) Carrying out SNP marker locus group screening according to the SNP marker locus group screening method of claim 2, wherein three selected locus groups and specific primers corresponding to the loci are shown in tables 2 to 7;
table 2A set of SNP site information capable of accurately identifying 19 cherry varieties
TABLE 3 SNP site identifying primer information in Table 2
Table 4 enables accurate identification of a set of SNP site information of 19 cherry varieties
TABLE 5 SNP site identifying primer information in Table 4
Table 6A set of SNP site information capable of accurately identifying 19 cherry varieties
TABLE 7 SNP site identifying primer information in Table 6
(5) Carrying out PCR amplification by using a primer capable of amplifying the SNP locus;
(6) Carrying out first-generation sequencing on the obtained PCR product;
(7) And analyzing and identifying the cherry variety according to the sequencing information and the SNP site information.
The invention has the beneficial effects that: the tissue culture seedlings, the grafted seedlings and the finished seedlings of 19 cherry varieties can be accurately distinguished, the control of breeding enterprises on the varieties is ensured, and the economic loss caused by errors in the breeding process is reduced.
Drawings
The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.
FIG. 1 is a diagram showing that an evolutionary tree is constructed by using 3751 specific SNP markers (SNP markers are shown in Table 1) of 19 cherry varieties including Samite, sweet heart, meizao, ferro tile, yangyang, heijin, benten, star, fildywa, kodia, canada cherry, topaz, american cherry, hongkui, malihard, red lantern, fermi and Filta which are screened, and the 19 cherry varieties can be accurately distinguished.
FIG. 2 is a diagram showing that the Super-GBS method is used for sequencing cherry samples and screening SNP, the finally screened SNP sites coincide with more than 90% of 3751 determined effective SNP sites, and 19 cherry varieties can be accurately distinguished by classifying the 19 cherry varieties by using the coincident sites.
In fig. 1 and 2 of the present invention, the varieties corresponding to the sample numbers are shown in the following table:
Detailed Description
Example 1
This example provides a method for screening 19 species-specific SNP molecular markers for cherry varieties, including Summit, sweet heart, meizao, ferro tile, yangyang, heijin, benten, dalmatian, fildywa, kodia, canada cherry, topaz, gaosha, american cherry, hongying, mashihada, red lantern, fermi and Vertata, using simplified genome sequencing technology Super-GBS, comprising the steps of:
(1) Extracting genomic DNA from samples of 3 sagitt, 4 sweet hearts, 3 Mezao, 4 Fisher-Tropsch, 4 Yanyang, 2 Heijin, 3 benten, 5 star, 6 Fildywa, 3 Codisia, 2 Canadian cherries, 3 topaz, 2 Gaosha, 2 American cherries, 4 Honghua, 5 Mashihadan, 2 red lamps, 4 Fermi-na and 5 Fista cherries of known varieties;
(2) Constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing machine sequencing on the library after the library is qualified by quality inspection;
(3) Filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) Filtering the SNP under the following conditions: the SNP sequencing depth is not less than 4; (iii) eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; removing the sites with consistent typing in all samples;
(5) Screening all individual genotypes in each variety according to the typing result of each variety, wherein the typing consistent sites have no individual deletion and are different from at least one variety site in other 18 cherry varieties, and finally screening 3751 SNP sites;
(6) And constructing an evolutionary tree and clustering analysis on a total of 66 samples of 19 cherries by using the screened 3751 SNP sites.
The specific operation steps are as follows:
this example mainly comprises the following steps, i.e., digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
the exact variety of 3 Samite, 4 sweet hearts, 3 Mezao, 4 Fisova, 4 Yanyang, 2 Heijin, 3 Benten, 5 damnacanthus, 6 Fischery, 3 Codiya, 2 Canadian cherries, 3 topaz, 2 Gaosha, 2 American cherry, 4 Honghua, 5 Mash Hayard, 2 Red lantern, 4 Fermi and 5 Fista cherry varieties, which were purchased by the Standard agency of the same company, were subjected to Super-GBS library construction, in which the following procedure (the amount of enzyme digestion reagent used for each sample) was as follows:
DEPC water: 21.4 mu L;10 × CutSmart buffer:3 mu L of the solution; pstI-HF (4 units): 0.2 mu L; mspI (8 units): 0.4 mu L;
DNA(50ng/μL)：5μL。
all the components are mixed evenly and then cut for 2h at 37 ℃, and then the temperature is kept for 20min at 75 ℃ to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the enzyme cutting fragment are connected in a 40 mu L system.
DEPC water: 13 mu L of the solution; 10 XT 4 ligase buffer:4 mu L of the solution; pstI Adaptor (0.1 μ M): 1 mu L of the solution; common adaptor (10 μ M): 1.5 mu L; t4 DNA ligase (400U/. Mu.L): 0.5 mu L; and (3) enzyme digestion products: 20 μ L.
All the components are mixed evenly and then are cut for 2h at 22 ℃, and then the temperature is kept at 65 ℃ for 20min to inactivate the enzyme.
3. Purification of
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. Mu.L of 70% ethanol. Finally, the DNA was recovered from the magnetic beads using 40. Mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification of
DEPC water: 16 mu L of the solution; taq5 × Master Mix:5 mu L of the solution; primer 1 (10 μ M): 0.5 mu L; primer 2 (10 μ M): 0.5 mu L; purified ligation product: 3 μ L.
All the components are mixed uniformly and then placed in a PCR instrument, the reaction condition is pre-denaturation at 95 ℃ for 30s, amplification is carried out for 16 cycles, each cycle comprises denaturation at 95 ℃ for 30s, annealing at 62 ℃ for 20s, extension at 68 ℃ for 15s, and finally extension at 68 ℃ for 5min and storage at 4 ℃.
5. Mixed warehouse
The library concentration was determined for each sample using Qubit, with samples at concentrations greater than 5 ng/. Mu.l used for pool-mix sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE150. The linker and primer sequences used in the library construction process are detailed in Table 8 below.
TABLE 8 construction of linker and primer sequences for Super-GBS sequencing libraries
| Name (R) | Sequence (5 '-3') |
| Common adaptor top | GATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT |
| Common adaptor bot | CGAGATCGGAAGAGCGGGGACTTTAAGC |
| PstI adaptor top | CACGACGCTCTTCCGATCTAACXXXXXXTGCA |
| PstI adaptor bot | YYYYYYAGATCGGAAGAGCGTCGTG |
| Primer1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
| Primer2 | CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAA |
6. Analysis of
And performing Super-GBS sequencing on 66 samples of 19 cherry varieties to obtain 176M high-quality reads. High quality reads were aligned to the reference genome at 77.86% -86.37% and the average sequencing depth for all samples was 38.32 x. Obtaining SNP sites by using GATK (v 3.8-1) software, then screening at least one SNP site different from other varieties among 19 varieties to finally obtain 3751 SNP sites, analyzing by treebest software, drawing by using R package ggtree, wherein the sites can be used for accurately identifying 19 cherry varieties, and the identification result is shown in figure 1.
Example 2
This example provides random collection of 1 each of 19 cherry varieties for variety identification in the variety nursery of Shandong Dafeng Yuan agriculture Co., ltd, and simultaneous addition of sequencing data of 19 cherry samples of known varieties (samples in example 1) as controls for testing and verification according to the method of the present invention. The method comprises the following steps:
(1) Randomly collecting 1 strain of each of samite, sweet heart, meizao, ferova, yangyang, black gold, benten, star, feldlva, kodia, canadian cherry, topaz, gaosha, american cherry, red silk, mashihara, red lantern, fermi and feltade from a variety garden of agriculture ltd in the great garden of Shandong, and extracting genomic DNA;
(2) Constructing a library according to a simplified genome sequencing technology Super-GBS method, and performing on-machine sequencing after the quality of the library is qualified;
(3) Filtering sequencing data, and then obtaining SNP loci by using GATK;
(4) Filtering the SNP under the following conditions: the SNP sequencing depth is not lower than 4; eliminating sites with MAF less than 0.01; eliminating the sites with SNP typing deletion rate higher than 20%; all samples were culled for sites that were of the same type. The SNP sites coinciding with 3751 sites in Table 1 were retained, and 3582 SNP sites were finally obtained.
(5) And constructing an evolutionary tree according to the screened 3582 SNP sites, and determining the cherry sample variety collected by the variety garden.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e.digestion, ligation, purification, amplification, pooling and analysis.
1. Enzyme digestion:
Supper-GBS construction was carried out on 1 each of Samite, sweet heart, meizao, ferro tile, yanyang, black gold, benten, star, fildy tile, kodia, canada cherry, topaz, high sand, american cherry, hongming, masihard, red Lamp, fermi and Filta randomly collected from the variety nursery of agriculture Limited, dafeng Yuan, shandong, and the following (the amount of each sample used):
DEPC water: 21.4 mu L;10 × CutSmart buffer:3 mu L of the solution; pstI-HF (4 units): 0.2 mu L; mspI (8 units): 0.4 mu L; DNA (50 ng/. Mu.L): 5 μ L.
All the components are mixed evenly and then are subjected to enzyme digestion at 37 ℃ for 2h, and then the temperature is kept at 75 ℃ for 20min to inactivate the enzyme.
2. Connecting:
the adapter, barcode and the digestion fragment were ligated in a 40. Mu.L system.
DEPC water: 13 mu L of the solution; 10 × T4 ligase buffer:4 mu L of the solution; pstI Adaptor (0.1 μ M): 1 mu L of the solution; common adaptor (10 μ M): 1.5 mu L; t4 DNA ligase (400U/. Mu.L): 0.5 mu L; and (3) enzyme digestion product: 20 μ L.
All the components are mixed evenly and then are cut by enzyme for 2h at the temperature of 22 ℃, and then the temperature is kept for 20min at the temperature of 65 ℃ to inactivate the enzyme.
3. Purification of
35 μ L of the ligation product was added to 0.7-fold volume of Sera-Mag beads (GE Healthcare Life Sciences) and allowed to stand at room temperature for 5min to remove small fragments of 300bp or less. The magnetic beads were recovered from the supernatant and eluted 3 times with 200. Mu.L of 70% ethanol. Finally, the DNA was recovered from the magnetic beads using 40. Mu.l of 10mM Tris.HCl (pH 8.0).
4. Amplification of
DEPC water: 16 mu L of the solution; taq5 × Master Mix:5 mu L of the solution; primer 1 (10 μ M): 0.5 mu L; primer 2 (10 μ M): 0.5 mu L; purified ligation product: 3 μ L.
All the components are mixed uniformly and then placed in a PCR instrument, the reaction condition is pre-denaturation at 95 ℃ for 30s, amplification is carried out for 16 cycles, each cycle comprises denaturation at 95 ℃ for 30s, annealing at 62 ℃ for 20s, extension at 68 ℃ for 15s, and finally extension at 68 ℃ for 5min and storage at 4 ℃.
5. Mixed warehouse
The library concentration of each sample was determined using Qubit, samples at concentrations greater than 5 ng/. Mu.l were used for pool sequencing. Primers and small fragments in the library are removed by adding 0.7-fold volume of Sera-Mag beads, and then mixed sample sequencing is carried out according to the sequencing quantity requirement, wherein the sequencing platform is Illumina Nova PE150. The linker and primer sequences used in the library construction process are detailed in Table 8 of example 1.
6. And selecting SNP sites which are overlapped with the sequencing result according to the SNP site information in the table 1, and finally obtaining 3582 SNP sites.
7. Analysis of
A total of 47.4M high quality reads were obtained by Super-GBS sequencing of 19 samples. High quality reads were aligned to the reference genome at 76.85-84.63 alignment and the average sequencing depth for all samples was 37.46. A large number of SNP sites are obtained by utilizing GATK (v 3.8-1) software, and are compared with 3751 SNP sites in the table 1, 3582 SNP sites in the 3751 SNP sites are finally obtained, treebest software is adopted for analysis, R package ggtree drawing is utilized, the sites can be used for accurately identifying 19 cherry varieties, and identification results are shown in the figure 2.
Example 3
The embodiment provides a PCR detection primer corresponding to the SNP site design, 19 cherry genomic DNAs randomly collected from the variety garden of Shandong Dafeng Yuan agriculture Limited company are subjected to PCR amplification, 19 cherry varieties are identified by a sequencing method, and 19 cherry varieties of known varieties are added as positive controls for testing and verification. The method comprises the following steps:
(1) 2 strains of each of Samite, sweet heart, mezao, ferro tile, yangyang, black gold, benten, dating, fildywa, kodiya, canadian cherry, topaz, kao cherry, american cherry, red damask, malihard, red Lamp, fermi and Filta, each of which is accurate in variety and provided by a standards body purchased by this company, were extracted;
(2) Randomly collecting 2 plants of 19 cherry varieties from a variety garden of agriculture Limited company in Dafeng garden in Shandong, and extracting genome DNA;
(3) Selecting a group of SNP loci which can accurately identify 19 cherry varieties from 3751 SNP loci, and showing in table 2;
(4) Designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, as shown in Table 3;
(5) Performing PCR amplification by using the universal primers of 19 cherry varieties in the table 3;
(6) Performing first generation sequencing on the amplified sequence;
(7) And (4) referring to the SNP site information, and performing typing interpretation on the cherry variety according to the sequence of the corresponding site in the sequencing result.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the position of the site in Table 2, and the primer sequences are shown in Table 3. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30min. The amplification system is as follows.
DNA：2μL；Taq2×Master Mix：25μL；Primer F(10μM)：1μL；Primer R(10μM)：1μL；ddH 2 O：21μL。
2. Sequencing
The obtained PCR amplification product was detected by 1% agarose gel electrophoresis, and a sample in which a specific amplification band was obtained at a predetermined position was sent to Shanghai Biotech Ltd for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 19 cherry varieties are typed by using one SNP site marker group (shown in a table 2) screened from 3751 sites of the invention.
4. Analysis of
The sequence alignment identification results show that 76 identification results of 19 cherry varieties, samite, sweet heart, mezao, ferro tile, yangyang, heijin, benten, star, fildywa, codiya, canada cherry, topaz, katsuwonus, american cherry, hongkui, masihard, red lantern, fermi and Filta, are consistent with the actual variety conditions.
Example 4
The embodiment provides a PCR detection primer corresponding to the SNP site design, PCR amplification is carried out on 19 cherry variety genomic DNAs randomly collected from a variety garden of Shandong Dafeng Yuan agriculture Limited company, 19 cherry varieties are identified by a sequencing method, and 19 cherry varieties of known varieties are added as positive controls for testing and verification. The method comprises the following steps:
(1) 2 strains of each of Samite, sweet heart, mezao, ferro tile, yangyang, black gold, benten, dating, fildywa, kodiya, canadian cherry, topaz, kao cherry, american cherry, red damask, malihard, red Lamp, fermi and Filta, each of which is accurate in variety and provided by a standards body purchased by this company, were extracted;
(2) Randomly collecting 2 plants of 19 cherry varieties from a variety garden of agriculture Limited company in Dafeng garden in Shandong, and extracting genome DNA;
(3) Selecting a group of SNP loci which can accurately identify 19 cherry varieties from 3751 SNP loci, and showing in table 4;
(4) Designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, see Table 5;
(5) Performing PCR amplification by using the universal primers of 19 cherry varieties in the table 5;
(6) Performing a first-generation sequencing of the amplified sequence;
(7) And (4) carrying out typing interpretation on the cherry variety according to the sequence of the corresponding site in the sequencing result by referring to the SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed according to the positions of the sites in Table 4, and the sequences of the primers are shown in Table 5. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30min. The amplification system is as follows.
DNA：2μL；Taq2×Master Mix：25μL；Primer F(10μM)：1μL；Primer R(10μM)：1μL；ddH 2 O：21μL。
2. Sequencing
The obtained PCR amplification product was detected by 1% agarose gel electrophoresis, and a sample in which a specific amplification band was obtained at a predetermined position was sent to Shanghai Biotech Ltd for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 19 cherry varieties are typed by using one SNP site marker group (shown in table 4) screened from 3751 sites of the invention.
4. Analysis of
The results of sequence alignment and identification found that 76 identification results of 19 cherry varieties, samite, sweet Heart, megay, ferro Watt, yangyang, heijin, benten, great star, fildywa, kodia, canadian cherry, topha, american cherry, red damask, masshihada, red light, fermi and Filta, were consistent with the actual variety.
Example 5
The embodiment provides a PCR detection primer corresponding to the SNP site design, PCR amplification is carried out on genome DNA of 19 cherry varieties randomly collected by a variety garden of Shandong Dafeng garden agriculture Limited company, 19 cherry varieties are identified by a sequencing method, and 19 cherry varieties of known varieties are added as positive controls for test and verification. The method comprises the following steps:
(1) 2 strains of each of Samite, sweet heart, mezao, ferro tile, yangyang, black gold, benten, dating, fildywa, kodiya, canadian cherry, topaz, kao cherry, american cherry, red damask, malihard, red Lamp, fermi and Filta, each of which is accurate in variety and provided by a standards body purchased by this company, were extracted;
(2) Randomly collecting 2 plants of 19 cherry varieties from a variety garden of agriculture Limited company in Dafeng garden in Shandong, and extracting genome DNA;
(3) Selecting a group of SNP loci which can accurately identify 19 cherry varieties from 3751 SNP loci, and showing in table 6;
(4) Designing upstream and downstream primers for PCR amplification according to the genomic position of the selected SNP locus, see Table 7;
(5) Performing PCR amplification by using the general primers of the 19 cherry varieties in the table 7;
(6) Performing a first-generation sequencing of the amplified sequence;
(7) And (4) carrying out typing interpretation on the cherry variety according to the sequence of the corresponding site in the sequencing result by referring to the SNP site information.
The specific operation steps are as follows:
this example comprises mainly the following steps, i.e. PCR, sequencing, alignment and analysis.
1. PCR amplification
PCR amplification primers were designed based on the position of the sites in Table 6, and the primer sequences are shown in Table 7. The amplification conditions were 94 ℃ for 3min,94 ℃ for 30sec,55 ℃ for 45sec,72 ℃ for 45sec,37 cycles, 72 ℃ for 7min, and 12 ℃ for 30min. The amplification system is as follows.
DNA：2μL；Taq2×Master Mix：25μL；Primer F(10μM)：1μL；Primer R(10μM)：1μL；ddH 2 O：21μL。
2. Sequencing
The obtained PCR amplification product is detected by using 1% agarose gel electrophoresis, and a sample of which a specific amplification band is obtained at a predicted position is sent to Shanghai Biometrics, inc. for sequencing.
3. Sequence alignment
The sequencing result is subjected to sequence comparison by using DNMAN software or SnapGene, and 19 cherry varieties are typed by using one SNP site marker group (shown in Table 6) screened from 3751 sites of the invention.
4. Analysis of
The results of sequence alignment and identification found that 76 identification results of 19 cherry varieties, samite, sweet Heart, megay, ferro Watt, yangyang, heijin, benten, great star, fildywa, kodia, canadian cherry, topha, american cherry, red damask, masshihada, red light, fermi and Filta, were consistent with the actual variety.
By selecting other SNP site marker groups from 3751 SNP sites, 19 cherry varieties including Samite, sweet heart, meizao, ferro tile, yangyang, heijin, benten, great star, fildy tile, kodia, canada cherry, topaz, high sand, american cherry, hongyen, masihard, red lantern, fermi and Filta can be identified accurately.
Table 1 of the invention is as follows:
wherein, the numeral references 1 to 19 respectively represent: samite, kodia, canada cherry, topaz, high sand, american cherry, damask, mashihara, red lantern, fermi, filtar, sweet heart, mezao, ferro tile, yangyang, black gold, benton, star, and Fildy tile.
Table 1 specific SNP marker loci of 19 cherry varieties
Sequence listing
<110> agriculture Co Ltd in Dafeng Yuan Shandong
<120> cherry main cultivar specific molecular marker and screening method and application thereof
<160> 38
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggcctcacct tcaacatcca 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aactcgtcgt tgactcggac 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccgtgatgat acgcttcgga 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gccattgctc aagggtttgg 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acactctttc cccgctttca 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gagggagagc ttcagtccca 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gcattttatg gggtggtgcc 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tcggagacct ggttactgct 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
caagcacgta gttcgccttt 20
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gccctattga gtgttttggg c 21
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ggcctgatcc gatgaccaaa 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
atggcaaggg gcaaatgagt 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ggggagcagc actaacagag 20
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
acaaagcgct acggagctta 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
ttccacagct ggcatgttca 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
agctaacgat ggttgccaca 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
tagccacacg acttgcatca 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
accaacaaga atccgtgggg 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
ggcaccccat agtacgtgag 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
aagctaccct tcacgaaccg 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ggctctacgg ctaagcacat 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
cgcctctcta atgcaccagt 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
agcgacgatg ccataaccaa 20
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
gtcgctctcc gtccagaaaa 20
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
acggcttcta cacaatcggg 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
caccatcttc aagttgccgc 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
tggggaatta ggtccgttcc 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
atgcagcatt tgaccacgtc 20
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
tgcaagctcg cttaccttca 20
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
ttggggccat gtttgcaatg 20
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
atgccccact tctgcaatga 20
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
cttgtgacat gcaccgcatt 20
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
ttagggctgt gaagacctgc 20
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
tcaagcacaa cctgatcgca 20
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
gcaggaccta attgcaccct 20
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
ggccgttgaa accacacttc 20
<210> 37
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
attcttttgt cggctcgggt 20
<210> 38
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
ggtcggttgt tgtgattgcc 20
Claims (1)
1. The application of the primers for detecting the SNP sites in the table 2 in accurately identifying 19 cherry varieties is characterized in that the 19 cherry varieties are Samite, sweet heart, mezao, ferro tile, yangyang, black gold, benten, star, fildy tile, codia, canada cherry, topaz, high sand, american cherry, honghui, masihard, red light, fermi and Vertata; the SNP site information is shown in Table 2, and the primer information is shown in Table 3:
table 2A set of SNP site information capable of accurately identifying 19 cherry varieties
SNP site identifying primer information in Table 2 described in Table 3
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110894426.6A CN113584206B (en) | 2021-08-05 | 2021-08-05 | Cherry main cultivated variety specific molecular marker and screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110894426.6A CN113584206B (en) | 2021-08-05 | 2021-08-05 | Cherry main cultivated variety specific molecular marker and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113584206A CN113584206A (en) | 2021-11-02 |
| CN113584206B true CN113584206B (en) | 2023-04-14 |
Family
ID=78255179
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110894426.6A Active CN113584206B (en) | 2021-08-05 | 2021-08-05 | Cherry main cultivated variety specific molecular marker and screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113584206B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9944940B2 (en) * | 2015-06-11 | 2018-04-17 | The United States Of America, As Represented By The Secretary Of Agriculture | Effect of PpeGID1c on vegetative growth of fruit trees |
| US20180094304A1 (en) * | 2016-08-08 | 2018-04-05 | Vinome | Use of genetic profiling for prediction of wine taste preferences and wine selection |
| CN106957914B (en) * | 2017-04-08 | 2020-12-01 | 中国农业科学院郑州果树研究所 | Identification method of cherry variety |
-
2021
- 2021-08-05 CN CN202110894426.6A patent/CN113584206B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113584206A (en) | 2021-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755482B (en) | SSR molecular marker III for identifying progeny plants of Gala apples and application thereof | |
| CN111560463B (en) | Three gala apple specific molecular markers and screening method and application thereof | |
| Ming-Yu et al. | Estimating genetic diversity of rice landraces from Yunnan by SSR assay and its implication for conservation | |
| CN113046467A (en) | SNP loci significantly associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN113444827B (en) | Grape variety specific molecular marker and screening method and application thereof | |
| CN113584206B (en) | Cherry main cultivated variety specific molecular marker and screening method and application thereof | |
| CN112695125A (en) | Katelia SSR molecular marker primer composition and application thereof | |
| CN113549705B (en) | Pear stock specific molecular marker and screening method and application thereof | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN111876477B (en) | Molecular marker primer combination for identifying sex characters of holly plants and application thereof | |
| CN113215300B (en) | 7 apple variety specific molecular markers and screening method and application thereof | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| CN113957167B (en) | Cherry rootstock specific molecular marker and screening method and application thereof | |
| CN113355392B (en) | Apple rootstock specific molecular marker locus, and screening method and application thereof | |
| CN113493819B (en) | Fuji series apple specific molecular marker locus, and screening method and application thereof | |
| CN113930531B (en) | Grape stock specificity molecular marker and screening method and application thereof | |
| CN113355445B (en) | Pear variety specific molecular marker and screening method and application thereof | |
| CN112831593B (en) | SNP molecular marker primer for variety identification of red peach trees in early summer and identification and application method thereof | |
| CN115181814B (en) | Molecular marker primer combination for rapidly identifying blueberry fruit size and application thereof | |
| Gurmessa et al. | Genetic diversity in Pima (Gossypium barbadense L.) and advanced interspecific hybrids (Gossypium hirsutum x Gossypium barbadense) of cotton germplasm in Ethiopia | |
| CN112725515B (en) | Iris florida ground color SNP molecular marker primer composition and application thereof | |
| CN113322341A (en) | Blueberry variety specific molecular marker locus as well as screening method and application thereof | |
| CN118086549A (en) | SNP (Single nucleotide polymorphism) marker for screening oil tea fruit quantity, screening method, kit and application | |
| CN115838791A (en) | Molecular marker linked with kiwi fruit sex QTL and application | |
| CN117363788A (en) | SNP molecular marker closely linked with grape split gene and obtaining method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |