CN108103235A - A kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation - Google Patents
A kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation Download PDFInfo
- Publication number
- CN108103235A CN108103235A CN201810139526.6A CN201810139526A CN108103235A CN 108103235 A CN108103235 A CN 108103235A CN 201810139526 A CN201810139526 A CN 201810139526A CN 108103235 A CN108103235 A CN 108103235A
- Authority
- CN
- China
- Prior art keywords
- apple
- snp
- cold
- rootstock
- apple rootstock
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation, which is T G transversion types.Amplimer and SNP genetic chips according to the molecular markers development realize the early stage identification of apple rootstock individual winter resistance character.This SNP marker of the invention and SNP genetic chips can realize the fast and accurately identification of apple rootstock winter resistance, reduce time and the financial cost of apple rootstock hybrid seedling selection and breeding.The present invention provides markup resources for apple rootstock cold-resistant molecular mark, lays a good foundation to cultivate cold-resistant new germ plasm using genetic engineering means, has important theory significance and actual application value.
Description
Technical field
The present invention relates to a kind of SNP of apple rootstock cold hardness evaluation（Single nucleotide polymorphism）Molecular labeling and its draw
Object, a kind of method for further relating to SNP genetic chips and Rapid identification apple rootstock winter resistance belong to Crop Genetic Breeding technology neck
Domain.
Background technology
Since unusual weather conditions cause extreme weather frequency existing, agricultural production is affected greatly, wherein low temperature, which becomes, restricts
One important envirment factor of China's agriculture production benefit.It is to influence plant to be damaged to plants caused by sudden drop in temperature caused by low temperature with abiotic stress such as freeze injuries
Growth and development and the key constraints of breeding., it is necessary to which low-temperature resistance is coerced ability as important finger during plant breeding
Mark, to evaluate, weigh the value of new germ plasm production application and potentiality.In traditional breeding method, physiology is used for Seedling tree more
Phenotypic evaluation under biochemical or environment stress eliminates the individual for not meeting cold-tolerance breeding target, has test condition requirement height, place
The shortcomings such as reason process is numerous and diverse, accuracy is poor, heavy workload, efficiency are low, for the perennial woodies crop such as apple, individual is big, no
It is easily mobile, its winter resistance accurate evaluation is difficult to realize in breeding practice, the cycle for obtaining resistance new varieties is long.
To adapt to low temperature stress, plant is evolved on a molecular scale forms corresponding mechanism, inducing stress related gene
Expression, further regulate and control different sophisticated signal accesses, regulate and control downstream physiological acoustic signals, such as oxygen scavenging activity, osmotic potential
It adjusts, the biological processes such as biomembrane protection resist adverse circumstance.Control site tight by evaluation and screening and winter resistance phenotypic genetic
Close chain molecular genetic marker can realize the height for differentiating Seedling tree winter resistance by molecule labelling method, greatly carry
The work efficiency of Seedling selection in high breeding shortens breeding time.
Now with the development of Plant Genome sequencing, the QTLs mapping investigative technique Fang Xingwei based on genetic map
Chinese mugwort, a new Research approach is provided for the molecular labeling for parsing and developing key phenotypic behind.According to this tactful state
It is inside and outside identified it is multiple to Apple Fruit Quality, the related or chain molecular labeling such as disease resistance, the property downgraded.In these marks
Minority started for the assistant breeding stage, such as in European breeding plan, developed 4 scab resistant marks（3 SSR and 1
SCAR）, 2 mildew-resistance marks（1 SSR and 1 SCAR）, 2 fire-resistance epidemic disease marks（SCAR）, using these marks from 9
25 plants of Resistant variants are filtered out in 1041 plants of offsprings of cross combination, the parent of disease-resistant variety can be cultivated as next step.But
At present on resisting abiotic adverse circumstance（Cold, arid, salt, alkali etc.）Linked marker develops also less, molecule assisted Selection or molecule
Assistant breeding worked also in the stage to relatively lag behind.
Short anvil intensive culture is the main trend of current apple, and excellent dwarfing rootstock is the basis for realizing intensive culture.State
Outer short anvil breeding development is more early, such as Britain is bred as the dwarfing rootstocks such as M systems, MM systems using hybridization technology, to promoting world's apple
Cultivation, which is changed, has played important function.In addition, the U.S., Canada, Japan, Poland, former Soviet Union etc. country using hybridize, grow directly from seeds,
The technologies such as mutagenesis are bred as disease-resistant, the pest-resistant or anti-continuous cropping dwarfing rootstocks such as G systems, MAC systems, O systems, JM systems, B systems.China's stock is educated
Kind carries out later, dwarfing rootstock SH system and GM256 of the breeding achievement predominantly by conventional hybridization incubation.According to current China's apple
Fruit industry development demand, be badly in need of autonomous selection and breeding resistance and it is adaptable, the property downgraded is good, easy breeding, the excellent dwarfing of Comprehensive Traits
Stock.But it is long by the conventional breeding acquisition new varieties cycle at present, and degeneration-resistant new varieties are obtained increasingly by molecule ancillary technique
It is taken seriously, wherein exploitation linked marker is the premise of this work.
The content of the invention
For the deficiency of screening Chill-resistance of Apple Trees novel species cycle length, the present invention provides a kind of apple rootstock cold hardness evaluations
SNP marker, be reached for Chill-resistance of Apple Trees stock marker assisted selection provide mark purpose.
SNP genetic chips the present invention also provides the PCR primer for expanding the SNP marker and containing the primer,
By the primer and genetic chip, apple cold-resistant strain can be quickly filtered out, improves the efficiency of breeding.
The present invention also provides the methods of Rapid identification apple rootstock winter resistance, and this method simple operation is efficient, take
It is short, provide favourable technical support for the cultivation of Chill-resistance of Apple Trees novel species.
The present invention utilizes the stronger apple rootstock of winter resistance " 60-160 "（- 37.42C ° of half lethal low temperature）With not resisting
Cold dwarfing rootstock " M9 "（- 30.05C ° of half lethal low temperature）200 strain of hybrid Population of structure and simplified gene order-checking
（RAD-seq）Technology builds dense genetic map.Evaluate the gradient cooling of map construction group（0~-40 DEG C）Under the conditions of
Branch relative conductivity acquires each strain half lethal low temperature（Lethal Temperature, LT50）.Utilize structure heredity
Collection of illustrative plates carries out the quantitative trait locus of this half lethal low temperature（QTLs）Positioning, identification is stabilized between the acquisition time and property
The strong SNP genetic markers of shape linksystem.According to strain sequencing result, it is positioned at apple reference gene to confirm the SNP genetic markers
No. 4519417 base of the group positive chain direction of rice chromosome is transversion type：T↔G.Apple rootstock winter resistance i.e. of the present invention
The SNP marker of identification（Abbreviation SNP marker, similarly hereinafter）On apple reference gene group rice chromosome, the apple
There are a T/G transversion type mononucleotide is more in No. 4519417 base of the positive chain direction of reference gene group rice chromosome
State property makes a variation.From LT50As a result see, when being TT genotype at No. 4519417 base, the LT of strain50Phenotypic number is low, represents
Semilethal low temperature is lower, and winter resistance is stronger, when being GG genotype, the LT of strain50Phenotypic number is high, represents semilethal low temperature higher,
Winter resistance is weaker, be TG genotype when, semilethal low temperature between GG genotype and TT genotype, winter resistance also between this two
Between person.Therefore, by detecting the genotype at No. 4519417 bases, directly the anti-of strain can be obtained from molecular level
Cold energy.
Further, in order to more easily obtain the genotype at No. 4519417 base by way of amplification, by this
This section of base sequence of each 50bp bases of base physical location upstream and downstream is as SNP marker, the base of the SNP marker
Sequence is：TAACTCTAGGGTTGCAACCAGTGTTTGATAAGATATTTAATAATTGTGCCT/ GTCAGATGAAGCTTAATAAAGCATCTCTTTTCTTGGGCTTCGATGTTTTTA, such as SEQ ID NO:Shown in 1, in the alkali
There are a T/G transversion types single nucleotide polymorphism at 51st bit base of basic sequence to make a variation（T/G allele）, it is 51T
Or 51G.
Further, the present invention also provides for expanding SEQ ID NO:The apple rootstock cold-resistant of base sequence shown in 1
Property identification SNP marker PCR primer, which can be used for competitive ApoE gene to expand, and the primer is such as
Under：
T allele primers（Primer_Allele）：5 ' AAAGAGATGCTTTATTAAGCTTCATCTGAA 3 ', such as SEQ ID
NO:Shown in 2；
G allele primers（Primer_Allele）：5 ' GAGATGCTTTATTAAGCTTCATCTGAC 3 ', such as SEQ ID
NO:Shown in 3；
Universal primer（Primer_Common）：5 ' GGGTTGCAACCAGTGTTTGATAAGATATT 3 ', such as SEQ ID NO:4
It is shown.
Further, fluorescent marker is all carried on above-mentioned T allele primer and G allele primers, but both draw
The fluorescent marker species carried on object is different.Fluorescent marker can be fluorescent marker commonly used in the prior art, such as FAM fluorescence
Mark, HEX fluorescent markers.
The present invention also provides a kind of SNP genetic chips of apple rootstock cold hardness evaluation（Abbreviation SNP genetic chips）, should
The PCR primer of the SNP marker of above-mentioned apple rootstock cold hardness evaluation, totally three kinds of primer are fixed on SNP genetic chips.Profit
The fast and accurately identification of apple rootstock winter resistance can be realized with the SNP genetic chips.
The SNP marker and SNP genetic chips of the present invention can be used in Apple breeding, for screening the apple of cold-resistant
Stock filial generation individual.The use of SNP marker and SNP genetic chips provides a kind of new side of marker assisted selection
Formula, makes the quick screening of Chill-resistance of Apple Trees novel species become possibility.SNP marker of the present invention, apple rootstock cold hardness evaluation
Application of the SNP genetic chips in Apple breeding also within protection domain.
The present invention also provides a kind of method of Rapid identification apple rootstock winter resistance, this method comprises the following steps：
（1）Apple genome DNA is extracted, it is enterprising in the SNP genetic chips of apple rootstock cold hardness evaluation using the DNA as template
Row competitiveness ApoE gene reaction；
（2）After PCR amplification, SNP genetic chips are analyzed, apple anvil is judged according to the genotype of SNP marker
The height of wooden winter resistance.
Further, competitive ApoE gene amplification（KASP is expanded）Flow have phase in the prior art
It closes and records, those skilled in the art can be operated according to the prior art.It is used in the specific embodiment of the invention
KASP amplification reaction systems are 1 microlitre, include 20 nanogram template DNAs, 0.14 microlitre of 3 kinds of primer（T allele primer, G equipotentials
Gene primer and universal primer）Mixture, 0.5 microlitre of Master mix（2x）（LGC companies of Britain）, ddH2It is micro- that O supplies 1
It rises.KASP amplification programs are：95 °C of 15 min of denaturation, 1 Xun Huan；95 °C of 20 s of denaturation, 61 °C of 60 s of annealing, 10 are followed
Ring, annealing temperature is with every 0.6 °C of cooling of Xun Huan；95 °C of 20 s of denaturation, 55 °C of 60 s of annealing, 26 cycle.
In the above method, primer of the T allele primer as detection TT genotype, G allele primer is as detection
The primer of GG genotype is respectively provided with fluorescent marker on both primers.After PCR, quilt is judged according to fluorescence signal is strong and weak
Detect the genotype of sample.
In the above method, chip is analyzed after PCR amplification, obtains genotype.Wherein winter resistance height and genotype
Relation is as follows：The winter resistance of TT genotype>The winter resistance of TG genotype>The winter resistance of GG genotype.According to the genotype of gained,
It can select required novel species.
The present invention utilizes the stronger apple rootstock of winter resistance " 60-160 "（- 37.42C ° of half lethal low temperature）With not resisting
Cold dwarfing rootstock " M9 "（- 30.05C ° of half lethal low temperature）The hybrid Population strain of structure and simplified gene order-checking（RAD-
seq）Technology builds dense genetic map.It is aobvious by having obtained that there is apple rootstock winter resistance to the analysis of genetic map
Write the SNP influenced（Single nucleotide polymorphism）Molecular labeling, amplimer and SNP gene cores according to the molecular markers development
Piece realizes the early stage identification of apple rootstock individual winter resistance character.This SNP marker of the invention and SNP genetic chips
It can realize the fast and accurately identification of apple rootstock winter resistance, reduce time and the economy of apple rootstock hybrid seedling selection and breeding
Cost.The present invention provides markup resources for apple rootstock cold-resistant molecular mark, to be trained using genetic engineering means
It educates cold-resistant new germ plasm to lay a good foundation, there is important theory significance and actual application value.
Description of the drawings
Fig. 1 is " 60-160 × M9 " genetic linkage maps of the invention；
Fig. 2 is 0 DEG C of trial flock body measurement of the present invention, -20 DEG C, -25 DEG C, -30 DEG C, -35 DEG C, branch under -40 DEG C of gradient low temperature
Group's histogram of relative conductivity and half lethal low temperature phenotype；
Fig. 3 is the present invention " 60-160 " × " M9 " groups half lethal low temperature（LT50）The QTL positioning figures of phenotype；
Fig. 4 is the physical location and upstream and downstream sequence chart of apple rootstock cold-resistant sex-kink SNP marker " hk134 " of the present invention；
Fig. 5 is the KASP testing result figures of Different Individual in the present invention " 60-160 " × " M9 " groups；
Fig. 6 is that the present invention converts figure using SNPTyper to the genotyping result of KASP reaction signals；
Fig. 7 is the proof diagram to the genotyping result of experiment group using molecular labeling of the present invention.
Specific embodiment
The present invention is further detailed with reference to specific embodiments and the drawings, so that those skilled in the art's energy
It enough becomes apparent from, completely understand technical scheme.The description below is exemplary only, its content is not limited
It is fixed.
Embodiment 1
The SNP marker of apple rootstock cold hardness evaluation of the present invention is obtained using following methods：
1st, agents useful for same and instrument
Using Plant Genomic DNA Kit（TIANGEN）The genomic DNA of kit extraction experiment individual in population
（gDNA）, the kit is purchased from TIANGEN Biotech (Beijing) Co., Ltd.；Digestion restriction enzymeEcoRⅠPurchased from the U.S.
Sigma-Aldrich companies；Reagent needed for the post processing of digestion sample：Connector, ATP, ligase, flat end enzyme etc. are purchased from the U.S.
Illumina companies；Sequencing is carried out in Beijing Nuo Hezhi sources biological information Science and Technology Ltd., and sequencing uses Illumina
2500 microarray datasets of Hiseq（The U.S.）.
2nd, SNP marker acquisition methods
（1）" 60-160 × M9 " genetic linkage maps are built
With apple cold-resistant stock " 60-160 "（- 37.42C ° of half lethal low temperature）× not cold-resistant stock " M9 "（Low temperature semilethal
- 30.05C ° of temperature）Filial generation is examination material.It is mapping population to randomly select 200 hybridization strains.Utilize plant genome DNA
Extracts kit（Plant Genomic DNA Kit）Carry out the complete genome DNA of parents and strain offspring（gDNA）Extraction.Extraction
After DNA, sequencing library structure operating procedure is described as follows：500ng gDNA samples are taken, utilize restriction enzymeEcoRⅠInto
Row digestion.65 DEG C of preheating 20min of sample, add in the Illumina P1 connectors of 2 μ L 100nM, while add in 1 μ L 100nM's
RATP, 1 μ L10 × NEB buffer solutions, 1 μ L（1000U）T4DNA ligases and 5 μ LH2O, normal-temperature reaction 20min.65 DEG C again
Heat 20min, ultrasonication is into the segment of average about 500bp.By 1.5% agarose gel electrophoresis, recycle 300-700bp's
Segment.
With flat end enzymatic treatment DNA sample.18 DEG C of purification of samples, and the Klenow exo of 15U are utilized in the 3' ends of DNA
In addition adenine.Purification of samples again, adds in 1 μM of P2 connectors, and reaction temperature is 18 DEG C.It purifies again, it is pure to obtain 50 μ L
DNA.Concentration mensuration is carried out to sample after purification, and carries out PCR amplification.Rear electrophoresis recycling segment is expanded, is used for after dilution
Sequencing.RAD sequencing libraries are built, using promise standing grain Illumina Hiseq 2500 microarray datasets in source is caused to be sequenced, plan is sequenced
It is slightly sequenced using pair-end both-ends, sequencing length is 150bp.
RAD is sequenced to obtain initial data, is used for the exploitation being marked after removing connector and low quality sequence.Utilize sequencing
Label distinguishes the sequencing data of different single plants, then carries out cluster analysis for similar sequencing sequence.During cluster
Mismatch is arranged to 5.Give up sequence and support number≤2 or >=100 clustering cluster（To ensure site parting accuracy and prevent
Copy number variation）.Heterozygous sites at least need 5 sequences and support, wherein the support sequence number 3 of secondary good base.Obtain SNP
After point, using mendelian inheritance, the site of no polymorphism is deleted by the site information of parents.Select parting type for
The site of lm × ll, nn × np and hk × hk.
It is screened for building the mark of genetic map by the following conditions：The single plant for lacking the mark is less than 60 plants（About
The 20% of total group, Chi-square Test lm × ll, nn × np type mark of mark meet expected 1:1 segregation ratio, hk × hk types
Mark meets 1:2:1 separation, the significance p of Chi-square Test<0.01.
It screens obtained mark and carries out genetic linkage maps drafting using 4.0 mapping softwares of Jionmap, group's threshold value is divided to set
It is set to LOD=6.Using regression algorithm, parents' collection of illustrative plates is built respectively and integrates collection of illustrative plates.Utilize Kosambi ' s functions calculate heredity away from
From three-wheel is divided to successively increase mark.It during mapping, deletes in the presence of mark that can be chain and multiple group of single plant, to ensure that mark exists
Order in collection of illustrative plates is more accurate.
When linkage group divides group, there are 15 marks to be deleted because any one linkage group cannot be added in.Further across
The Chi-square Test of segregation ratio, 30 marks are rejected because separation partially occurs.During software is drawn, 141 marks with place because connect
Other of lock group mark chain defective tightness or position unstable and delete.In addition, 5 single plants because sequencing amount it is too small so that
They are deleted in the marker site missing typing data more than 20%.Also 13 single plants because there are more Reorganizations also by
It rejects.
Finally, the integration genetic linkage maps completed are by 182 single plants, 2240 marks（939 lm × ll marks
Note, 886 nn × np marks and 415 hk × hk are marked）Composition（See Fig. 1）.Indicia distribution is in 17 linkage groups, according to mark
The physical location of corresponding reference gene group, 17 linkage groups correspond to 17 chromosomes of apple, the corresponding mark of each linkage group
The statistics such as number, genetic distance and mark density are as shown in table 1.The marker number of each linkage group is differed from 88 to 205.It integrates
Collection of illustrative plates overall length is 1396.7cM, and averag density is often to mark 0.62cM.
（2）Genetic group half lethal low temperature is evaluated and quantitative trait locus（QTLs）Positioning
After in late November, 2015 and in late November, 2016 enter rest period, acquisition for mapping " 60-160 " ×
1 year raw branch of " M9 " 182 strains and 2 parents are used for Evaluation of Cold-Resistance.
The raw branch in 1 year of collecting test strain is successively clean with tap water, distilled water flushing, and branch two is closed with paraffin
The clip at end, each stock points 6 parts are put into clean bind up with gauze in polybag, are put in -40 DEG C of refrigerator at manually freezing
Reason.It is control with 0 DEG C if -20 DEG C, -25 DEG C, -30 DEG C, -35 DEG C, -40 DEG C of 5 low temperature gradients.Sample is placed on low temperature to protect
It deposits in case, after being down to purpose temperature, keeps 12h, then be progressively warming up to 0 DEG C.Temperature ramp rate is 2 DEG C/h.After taking-up
8h is placed at 4 DEG C, is used in case measuring.The relative conductivity at a temperature of stock branch is respectively handled is measured, is intended with Logistic equations
It closes, seeks inflection temperature, be the half lethal low temperature (LT of each strain of stock50)。LT50It is the one kind for evaluating plant cold resistance
Efficient quantitative character index, 0 DEG C, -20 DEG C, -25 DEG C, -30 DEG C, -35 DEG C, -40 DEG C of gradient low temperature that each strain of stock measures
Lower branch relative conductivity and group's histogram of half lethal low temperature phenotype are shown in Fig. 2, it can be seen from the figure that respectively
Index shows continuous variation, illustrates the quantitative character controlled by multiple-factor inheritance, meets QTL positioning requirements.
Utilize genetic linkage maps and the LT of mapping population50Phenotypic evaluation is as a result, carry out QTL positioning.Utilize software
MapQTL6.0 detects QTL site by Interval Mapping, and algorithm model uses mixed model.QTL in the range of full-length genome
The conspicuousness threshold value in site is LOD=3.0, p<0.05.Mark positioned at LOD peak values is the mark of site close linkage.Identification
To common location in No. 4 linkage groups（LG4）2 QTL of 43.11-47.75cM：LT2015QTL.2015 and
LT2016QTL.2016, this 2 QTL were stabilized between 2015 and 2,016 two, and LOD peak markers are hk134,
2015 and 2016, which was respectively 3.84 and 4.48, explained that phenotypic variation rate is respectively 19.8% and 23.6%
（See Fig. 3）, it is the molecular labeling with half lethal low temperature close linkage to confirm " hk134 ".
（3）Apple rootstock cold-resistant sex-kink SNP marker is developed and application
According to strain sequencing result, confirm " hk134 " chain SNP marker be positioned at apple reference gene group rice chromosome just
No. 4519417 base of chain direction, SNP are transversion type：T↔G（See Fig. 4）, i.e. it is T/G etc. at No. 4519417 base
Position gene.
According to the corresponding apple genome physical location of chain SNP marker, it is each to download the mark physical location upstream and downstream
50bp bases（See Fig. 4）, as SNP marker, gene order such as SEQ ID NO:Shown in 1, while devise using competing
Striving property ApoE gene（Kompetitive Allele Specific PCR, KASP）Reaction expands the SNP molecules
The PCR primer of mark, totally three kinds of primer, sequence is as follows：
T allele primers（Primer_AlleleFAM）：5 ' AAAGAGATGCTTTATTAAGCTTCATCTGAA 3 ', such as SEQ
ID NO:Shown in 2, which carries FAM fluorescent markers；
G allele primers（Primer_AlleleHEX）：5 ' GAGATGCTTTATTAAGCTTCATCTGAC 3 ', such as SEQ ID
NO:Shown in 3, which carries HEX fluorescent markers；
Universal primer（Primer_Common）：5 ' GGGTTGCAACCAGTGTTTGATAAGATATT 3 ', such as SEQ ID NO:4
It is shown.
Embodiment 2
In order to efficiently, fast and accurately detect SNP marker of the present invention, SNP genetic chips can be made into.The SNP bases
Because being fixed with the PCR primer of above-mentioned amplification SNP marker on chip, genetic chip is obtained by U.S.'s Affymetrix company systems.
The genomic DNA of extraction experiment group, KASP reactions are carried out on SNP genetic chips, expand SNP marker, pass through SNP points
The cold performance of the genotype Rapid identification experiment group of son mark.Concrete operations are as follows：
182 plants " 60-160 " × " M9 " mapping population strains are gathered, using plant genome DNA extracts kit（Plant
Genomic DNA Kit, Beijing Tiangeng company）Extraction experiment Meta-genomic DNA, carries out on the SNP genetic chips of making
KASP reacts.Totally 1 microlitre of KASP amplification reaction systems include 20 nanogram template DNAs, 0.14 microlitre of 3 kinds of primer（T allele
Primer, G allele primer and universal primer）Mixture, 0.5 microlitre of Master mix（2x）（LGC companies of Britain）,
ddH2O supplies 1 microlitre.The reaction system of preparation is injected into genetic chip, sealing inlet and outlet with pipettor.Genetic chip is placed in
It centrifuges on bracket, centrifugal speed 3000rpm, centrifuges 1min, centrifugation is evenly distributed to reacting hole.Then, genetic chip is put into
Tablet PCR instrument（Beijing Bo Aojing allusion quotations Bioisystech Co., Ltd manufactures）On expanded, run amplification program：95 °C of denaturation
15 min, 1 Xun Huan；95 °C of 20 s of denaturation, 61 °C of 60 s of annealing, 10 Xun Huans, annealing temperature is with every 0.6 °C of drop of Xun Huan
Temperature；95 °C of 20 s of denaturation, 55 °C of 60 s of annealing, 26 cycle.After PCR amplification the end of the program, genetic chip is put
Enter brilliant core LuxScan 10K/D micro-array chip scanners（Beijing Bo Aojing allusion quotations Bioisystech Co., Ltd manufactures）, swept
It retouches, generates KASP testing result figures, as shown in figure 5, different colour developings represent different genotype.The fluorescence signal of acquisition is converted into
Digital signal generates the initial data of genetic chip, then parting is carried out by parting software SNPTyper again, according to parting knot
Fruit can in discriminating test group each strain winter resistance height.
Fig. 6 is to convert figure to the genotyping result of KASP reaction signals using SNPTyper, is shown as 3 kinds of genotyping results：GG、
TT and TG, 182 strains for representing to participate in experiment can be divided into above-mentioned 3 kinds of genotype.Determine the marker genetype genotyping result institute
Corresponding phenotype（LT50）, the genotyping result for testing group is verified, as shown in Figure 7.TT shown in figure,
Block diagram corresponding to TG, GG is the tagging chip to the phenotypic number of each genotype after mapping population parting（LT50）Quartile
Number distribution map, the block diagram corresponding to hh, hk, kk are to be obtained by being sequenced corresponding to the genotyping result of the marker site
Phenotypic number quartile distribution map.According to phenotype result corresponding after both genotyping method partings come
It sees, both approaches genotyping result is consistent.Also, gene is carried out to group in the genetic marker site using different classifying methods
Experiment group is divided into the monoid of 3 phenotype significant differences by type parting（Letter a, b, c are illustrated respectively in 5% water on block diagram
Flat upper significant difference）, i.e., high phenotypic number monoid, low phenotypic number monoid and osculant monoid therebetween, wherein, TT/
The LT of hh Genotype Strains50Phenotypic number is low, represents that semilethal low temperature is lower（Winter resistance is strong）, the LT of GG/kk Genotype Strains50
Phenotypic number is high, represents semilethal low temperature higher（Winter resistance is weak）, TG/hk is therebetween.It can thus be seen that using this hair
Bright molecular labeling is completely the same to the genotyping result and sequencing and typing result for testing group, while realizes experimental cross
The fast and accurately identification of group's winter resistance reduces time and the financial cost of apple rootstock hybrid seedling selection and breeding.The present invention point
Son mark provides markup resources for cold-resistant molecular mark, to cultivate cold-resistant using genetic engineering means
New germ plasm lays the foundation, and has important theory significance and actual application value.
Sequence table
<110>Shandong Fruit-tree Inst.
<120>A kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213>Apple (Malus domestica)
<220>
<221> gene
<222> (1)..(.101)
<220>
<221> mutation
<222> (51)..(.51)
<223>N=t or g
<220>
<221> misc_feature
<222> (51)..(51)
<223> n is a, c, g, t or u
<400> 1
taactctagg gttgcaacca gtgtttgata agatatttaa taattgtgcc ntcagatgaa 60
gcttaataaa gcatctcttt tcttgggctt cgatgttttt a 101
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence
<400> 2
aaagagatgc tttattaagc ttcatctgaa 30
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence
<400> 3
gagatgcttt attaagcttc atctgac 27
<210> 4
<211> 29
<212> DNA
<213> Artificial Sequence
<400> 4
gggttgcaac cagtgtttga taagatatt 29
Claims (9)
1. a kind of SNP marker of apple rootstock cold hardness evaluation, it is characterized in that：The SNP marker is located at apple reference
On genome rice chromosome, deposited in No. 4519417 base of the positive chain direction of apple reference gene group rice chromosome
It makes a variation in a T/G transversion types single nucleotide polymorphism.
2. SNP marker according to claim 1, it is characterized in that：Its base sequence such as SEQ ID NO:Shown in 1,
There are a T/G transversion types single nucleotide polymorphism at 51st bit base of the base sequence to make a variation, and is 51T or 51G.
3. for expanding the PCR primer of the SNP marker of the apple rootstock cold hardness evaluation described in claim 2, feature
It is：
T allele primers：5’AAAGAGATGCTTTATTAAGCTTCATCTGAA 3’；
G allele primers：5’GAGATGCTTTATTAAGCTTCATCTGAC 3’；
Universal primer：5’GGGTTGCAACCAGTGTTTGATAAGATATT 3’.
4. PCR primer according to claim 3, it is characterized in that：Equal band on T allele primer and G allele primers
There is fluorescent marker, the fluorescent marker on both primers is different.
5. a kind of SNP genetic chips of apple rootstock cold hardness evaluation, it is characterized in that：Fixation is had the right on the SNP genetic chips
Profit requires the PCR primer of the SNP marker of the apple rootstock cold hardness evaluation described in 3 or 4.
6. the apple anvil described in the SNP marker of the apple rootstock cold hardness evaluation described in claim 1 or 2, claim 5
Application of the SNP genetic chips of wooden cold hardness evaluation in Apple breeding.
7. application according to claim 6, it is characterized in that：The SNP marker of the apple rootstock cold hardness evaluation or
The SNP genetic chips of apple rootstock cold hardness evaluation are used to screen the apple rootstock filial generation individual of cold-resistant.
8. a kind of method of Rapid identification apple rootstock winter resistance, it is characterized in that comprising the following steps：
（1）Apple genome DNA is extracted, using the DNA as template, in the apple rootstock cold hardness evaluation described in claim 5
Competitive ApoE gene reaction is carried out on SNP genetic chips；
（2）After PCR amplification, SNP genetic chips are analyzed, apple anvil is judged according to the genotype of SNP marker
The height of wooden winter resistance.
9. according to the method described in claim 8, it is characterized in that：Winter resistance height and genotype relation is as follows：TT genotype>TG
Genotype>GG genotype.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810139526.6A CN108103235B (en) | 2018-02-11 | 2018-02-11 | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810139526.6A CN108103235B (en) | 2018-02-11 | 2018-02-11 | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108103235A true CN108103235A (en) | 2018-06-01 |
| CN108103235B CN108103235B (en) | 2021-05-18 |
Family
ID=62205613
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810139526.6A Active CN108103235B (en) | 2018-02-11 | 2018-02-11 | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108103235B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055350A (en) * | 2019-05-28 | 2019-07-26 | 山东省果树研究所 | A kind of SNP marker, primer and its application of Apple " ester odor type " Characters Identification |
| CN111739641A (en) * | 2020-06-23 | 2020-10-02 | 杭州和壹医学检验所有限公司 | Gastric cancer risk prediction method and system, computer equipment and readable storage medium |
| CN111996276A (en) * | 2020-08-20 | 2020-11-27 | 中国农业大学 | SNP molecular marker for identifying cold resistance of Hanfu apple hybrid progeny and application thereof |
| CN112322618A (en) * | 2020-12-02 | 2021-02-05 | 辽宁省果树科学研究所 | Molecular marker and application thereof in apple rootstock dwarfing screening |
| CN113549705A (en) * | 2021-07-01 | 2021-10-26 | 山东大丰园农业有限公司 | Pear stock specific molecular marker and screening method and application thereof |
| CN113957167A (en) * | 2021-07-19 | 2022-01-21 | 山东大丰园农业有限公司 | Cherry rootstock specific molecular marker and screening method and application thereof |
| CN114752696A (en) * | 2022-02-21 | 2022-07-15 | 中国农业大学 | Chip for detecting scion and evaluating quality of rootstock as well as preparation method and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040091900A1 (en) * | 2002-06-21 | 2004-05-13 | Guy Charles L. | Materials and methods for providing plants with increased resistance to environmental stress |
| CN102622634A (en) * | 2012-03-31 | 2012-08-01 | 中国农业科学院果树研究所 | Method for preparing bar code identities of apple germplasm resources |
| CN103614373A (en) * | 2013-10-16 | 2014-03-05 | 山东省果树研究所 | Mutation, relevant to precocity fruiting character, in Malus domestica Borkh MdMYB1 genes, and identification method of mutation |
| CN103882142A (en) * | 2014-04-08 | 2014-06-25 | 北京林业大学 | Method for quickly verifying and evaluating applicability of plant reference genes |
| CN104531718A (en) * | 2014-12-19 | 2015-04-22 | 山东农业大学 | Apple V-ATPase subunit gene MdVHA-B1S396A and stress-resistance application thereof |
| WO2015081441A1 (en) * | 2013-12-06 | 2015-06-11 | Suncor Energy Inc. | Methods for increasing resistance of plants to abiotic stresses |
-
2018
- 2018-02-11 CN CN201810139526.6A patent/CN108103235B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040091900A1 (en) * | 2002-06-21 | 2004-05-13 | Guy Charles L. | Materials and methods for providing plants with increased resistance to environmental stress |
| CN102622634A (en) * | 2012-03-31 | 2012-08-01 | 中国农业科学院果树研究所 | Method for preparing bar code identities of apple germplasm resources |
| CN103614373A (en) * | 2013-10-16 | 2014-03-05 | 山东省果树研究所 | Mutation, relevant to precocity fruiting character, in Malus domestica Borkh MdMYB1 genes, and identification method of mutation |
| WO2015081441A1 (en) * | 2013-12-06 | 2015-06-11 | Suncor Energy Inc. | Methods for increasing resistance of plants to abiotic stresses |
| CN103882142A (en) * | 2014-04-08 | 2014-06-25 | 北京林业大学 | Method for quickly verifying and evaluating applicability of plant reference genes |
| CN104531718A (en) * | 2014-12-19 | 2015-04-22 | 山东农业大学 | Apple V-ATPase subunit gene MdVHA-B1S396A and stress-resistance application thereof |
Non-Patent Citations (10)
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055350A (en) * | 2019-05-28 | 2019-07-26 | 山东省果树研究所 | A kind of SNP marker, primer and its application of Apple " ester odor type " Characters Identification |
| CN110055350B (en) * | 2019-05-28 | 2022-05-27 | 山东省果树研究所 | SNP molecular marker and primer for identifying apple fruit ester flavor character and application thereof |
| CN111739641A (en) * | 2020-06-23 | 2020-10-02 | 杭州和壹医学检验所有限公司 | Gastric cancer risk prediction method and system, computer equipment and readable storage medium |
| CN111996276A (en) * | 2020-08-20 | 2020-11-27 | 中国农业大学 | SNP molecular marker for identifying cold resistance of Hanfu apple hybrid progeny and application thereof |
| CN111996276B (en) * | 2020-08-20 | 2021-03-23 | 中国农业大学 | SNP molecular marker for identifying cold resistance of Hanfu apple hybrid progeny and application thereof |
| CN112322618A (en) * | 2020-12-02 | 2021-02-05 | 辽宁省果树科学研究所 | Molecular marker and application thereof in apple rootstock dwarfing screening |
| CN113549705A (en) * | 2021-07-01 | 2021-10-26 | 山东大丰园农业有限公司 | Pear stock specific molecular marker and screening method and application thereof |
| CN113549705B (en) * | 2021-07-01 | 2023-07-25 | 山东大丰园农业有限公司 | Pear stock specific molecular marker and screening method and application thereof |
| CN113957167A (en) * | 2021-07-19 | 2022-01-21 | 山东大丰园农业有限公司 | Cherry rootstock specific molecular marker and screening method and application thereof |
| CN113957167B (en) * | 2021-07-19 | 2022-09-27 | 山东大丰园农业有限公司 | Cherry rootstock specific molecular marker and screening method and application thereof |
| CN114752696A (en) * | 2022-02-21 | 2022-07-15 | 中国农业大学 | Chip for detecting scion and evaluating quality of rootstock as well as preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108103235B (en) | 2021-05-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103235A (en) | A kind of SNP marker, primer and its application of apple rootstock cold hardness evaluation | |
| CN109554493A (en) | The SNP marker and its detection method of a kind of plum blossom weeping branch character close linkage and application | |
| CN111088382B (en) | Corn whole genome SNP chip and application thereof | |
| CN109762812B (en) | Wheat growth potential related SNP and application thereof as target point in identification of wheat growth potential traits | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| CN108998550A (en) | SNP marker and its application for paddy gene parting | |
| CN112289384B (en) | Construction method and application of citrus whole genome KASP marker library | |
| CN110846429A (en) | Corn whole genome InDel chip and application thereof | |
| CN116814673A (en) | Genomic structural variation for regulating and controlling content of soluble solids in tomato fruits, related products and application | |
| CN117683927A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN115679012B (en) | Chilli whole genome SNP-Panel and application thereof | |
| CN105603088B (en) | SNP molecular site for identifying downy mildew resistance QTL on Chinese cabbage A08 chromosome and application thereof | |
| CN108416189B (en) | Crop variety heterosis mode identification method based on molecular marker technology | |
| CN113789407A (en) | SNP molecular marker combination for cyperus esculentus genotyping and application thereof | |
| CN111733278A (en) | Rice sodium and potassium ion absorption QTL (quantitative trait loci) linked SNP (Single nucleotide polymorphism) molecular marker and application thereof | |
| CN117230240B (en) | InDel locus related to soybean seed oil content, molecular marker, primer and application thereof | |
| CN117587159B (en) | Chilli SNP molecular marker combination, SNP chip and application thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof | |
| CN116411127B (en) | Molecular marker primer combination for rapidly identifying mature-period characters of peach fruits and application thereof | |
| CN111850159B (en) | SSR molecular marker identification primer and application thereof | |
| CN108427866B (en) | Crop inbred line group identification method based on molecular marker technology | |
| CN117025786A (en) | Fine wool sheep 50K SNP liquid phase chip based on targeted capturing sequencing and application thereof | |
| CN115141893A (en) | Molecular marker group containing 7 molecular markers and used for predicting dry matter content of kiwi fruit, application and kit thereof | |
| CN115747370A (en) | Non-heading Chinese cabbage KASP molecular marker and application thereof in germplasm resource identification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |