CN113897424A - Kirschner's law verification method for phytoplasma diseases - Google Patents

Abstract

The invention discloses a Koehler's law verification method for phytoplasma diseases, which comprises the following steps: (1) and (3) identification: extracting total DNA of a plant suspected to be infected with the phytoplasma disease, detecting by using a PCR (polymerase chain reaction) technology, sequencing, and determining that the disease belongs to the phytoplasma disease from a molecular level; (2) infection: connecting a plant suspected to be infected with the phytoplasma disease with catharanthus roseus through the dodder, observing the manifestation symptom of the catharanthus roseus, and confirming the infection; (3) tieback: connecting the infected catharanthus roseus with the same healthy plant as the plant in the step (1) through the south dodder seed, observing the expression symptom of the healthy plant, extracting the total DNA of the infected healthy plant, and performing PCR amplification sequencing; (4) and (3) comparison: and (3) carrying out homology comparison on the sequencing result of the step (3) and the sequencing result of the step (1) to finish the verification of the Coriolis rule of the phytoplasma diseases. The invention provides an indirect detection means for phytoplasma diseases, and provides further evidence for identifying phytoplasma diseases.

Description

Kirschner's law verification method for phytoplasma diseases

Technical Field

The invention belongs to the field of microorganisms, and particularly relates to a Koehshi law verification method for phytoplasma diseases.

Background

Phytoplasma (Phytoplasma) was previously called as Mycoplasma-like Organism (MLO for short), is a small class of prokaryotes which are obligate parasitic to phloem of plants and to some hemiptera insect salivary gland cells, have no cell wall and are transmitted by piercing-sucking mouthpart insects such as leafhoppers and plant hoppers, and belongs to the genera tenebrio, mollicutes, acholeracea, Phytoplasma (ca.

In the past decades, since phytoplasmas are difficult to culture in vitro, molecular detection techniques are not developed, and detection of phytoplasmas cannot be performed by conventional bacteriological studies such as morphology and culture shape, early detection of phytoplasmas is usually performed by observing symptoms expressed by host plants or by observing superthin sections of diseased plant tissues.

Koehler's rule:

(1) the presence of a pathogenic microorganism is often associated with the pathogenic plants;

(2) the microorganism can be separated and purified on an isolated or artificial culture medium to obtain pure culture;

(3) inoculating pure culture to healthy plants of the same variety, and generating diseases with the same symptoms;

(4) the plants which are inoculated and diseased are separated into pure cultures, and the characters of the pure cultures are the same as those of the inocula.

Bacterial diseases, fungal diseases and the like can be verified by the Koehler's law, while there is no Kiehler's law that is similar to fungal bacteria for phytoplasma (phytoplasma) diseases.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: at present, the detection of phytoplasma is mainly based on molecular means, and the research provides a verification method similar to the Koehler's rule of fungi and bacteria aiming at the detection of phytoplasma from the biological viewpoint, provides an indirect detection means for phytoplasma diseases and provides further evidence for the identification of phytoplasma diseases.

The technical scheme of the invention is as follows: the Koehshi's law verification method for phytoplasma diseases comprises the following steps:

(1) and (3) identification: extracting total DNA of a plant suspected to be infected with the phytoplasma disease, detecting by using a PCR (polymerase chain reaction) technology, sequencing, and determining that the disease belongs to the phytoplasma disease from a molecular level;

(2) infection: connecting a plant suspected to be infected with the phytoplasma disease with catharanthus roseus through the dodder, observing the manifestation symptom of the catharanthus roseus, and confirming the infection;

(3) tieback: connecting the infected catharanthus roseus with the same healthy plant as the plant in the step (1) through the south dodder seed, observing the expression symptom of the healthy plant, extracting the total DNA of the infected healthy plant, and performing PCR amplification sequencing;

(4) and (3) comparison: and (3) comparing the sequencing result of the step (3) with the sequencing result of the step (1), comparing the homology, and finishing the verification of the Coriolis rule of the phytoplasma diseases.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a 'Kirschner' verification method similar to fungus and bacteria aiming at the detection of phytoplasma from a biological angle, provides an indirect detection means for phytoplasma diseases, and provides further evidence for the identification of phytoplasma diseases.

Drawings

FIG. 1 is a schematic diagram of the authentication method of the present invention.

Detailed Description

The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were all commercially available unless otherwise specified.

Example 1

Firstly, identification: extracting total DNA of a plant suspected to be infected with the phytoplasma disease, detecting by using a PCR (polymerase chain reaction) technology, sequencing and determining that the disease belongs to the phytoplasma disease; (taking willow flower phytoplasma mutabilia disease as an example)

1. Plant total DNA extraction

The DNA extraction is modified by combining with methods for extracting DNA of phytoplasmas such as brilliant fragrance of lacquer, Gao and the like.

(1) Weighing 1.0g plant tissue liquid nitrogen, grinding, taking 0.2g, loading into a 2mL precooled centrifuge tube (about 1/4 volumes of the centrifuge tube), adding 600 μ L of 65 ℃ preheated CTAB buffer (2% CTAB, 100mM Tris-HCl, pH8.0, 1.4M NaCl, 20mM EDTA, pH8.0, 1% PVP-40, 1% beta-mercaptoethanol);

(2) placing in 65 deg.C water bath for 60min, and slightly turning upside down and mixing once every 10 min;

(3) taking out the centrifuge tube after the water bath is finished, cooling to room temperature, adding 600 mu L of chloroform and isoamylol (24:1), shaking up and down, mixing uniformly to milk white, and centrifuging at 12000r/min for 10 min;

(4) sucking the supernatant, transferring to a new centrifuge tube, adding chloroform isoamylol (24:1) with the same volume as the supernatant for secondary extraction, shaking up and down, mixing uniformly, and centrifuging at 12000r/min for 10 min;

(5) sucking supernatant, transferring into a new centrifuge tube, adding equal volume of isopropanol precooled at-20 deg.C, slightly reversing, mixing, and standing at-20 deg.C for 60 min;

(6) centrifuging at 12000r/min for 10min, carefully removing supernatant by pipetting with pipette gun (the pellet can not be pipetted out);

(7) adding 2 times of 95% ethanol and 1/10 volume of 3M sodium acetate into the precipitate, slightly inverting the mixture up and down for several times, mixing the mixture evenly, and then centrifuging the mixture for 10min at 12000 r/min;

(8) carefully removing the liquid in the centrifugal tube with a pipette, adding 1.0mL of 70% ethanol, inverting for several times, centrifuging at 12000r/min for 5min, sucking out the ethanol solution with the pipette, and drying with a blower in an ultraclean bench for 10min (without over-drying);

(9) adding 50uL of sterilized double distilled water, and placing in a water bath kettle at 50 ℃ for water bath for 30min to promote the dissolution of nucleic acid;

(10) taking 1uL of total DNA to detect the DNA concentration in a Thermo ND-2000 micro spectrophotometer, detecting the DNA integrity by agarose gel electrophoresis, uniformly diluting the extracted DNA to the concentration of 50-100 ng/mu L, placing the DNA at-20 ℃ for storage for subsequent PCR amplification, and taking 5 mu L of total DNA to perform agarose gel electrophoresis to detect the integrity.

2 agarose gel electrophoresis

(1) 0.32g of agarose was weighed into a 250mL Erlenmeyer flask, added with 40mL of 1 XTBE buffer, shaken well and placed in a microwave oven for dissolution.

(2) And (3) assembling the washed gel tank and a comb, adding 4 mu L of 1% EB solution into the gel when the temperature of the agarose gel is reduced to about 60 ℃ and the agarose gel is not scalded, shaking up gently, pouring the agarose gel solution into the gel tank, and standing for 30 minutes to completely solidify the agarose gel.

(3) Gently pulling out the comb, putting the gel into the electrophoresis tank, and adding 1 × TBE buffer solution into the electrophoresis tank until the gel is 2-3mm away.

(4) And (3) fully and uniformly mixing the DNA sample to be detected and the 6 multiplied DNA Loading buffer according to the proportion of 5:1, sequentially dropping the mixture into a gel dropping sample hole, and finally dropping 5 mu L of DL2000 DNA Marker.

(5) Covering the electrophoresis tank cover, switching on a power supply, and carrying out electrophoresis for 30min at a voltage of 120V.

(6) And after the electrophoresis is finished, closing the power supply, taking out the gel, placing the gel under a gel imager to observe the electrophoresis result and storing the picture.

3 primer Synthesis

The common primer pair R16mF2/R16mR1(CATGCAAGTCGAACGGA/CTTACCCCCAATCATCGA) and R16F2/R16R2(ACGACTGCTAAGACTGG/TGACGGGCGGTGTGTACAAACCCCG) of the phytoplasma 16S rRNA gene are synthesized by the production.

PCR amplification of 4 willow flower variable leaf phytoplasma 16S rRNA

The phytoplasma 16Sr RNA gene amplification adopts phytoplasma universal primers R16mF2/R16mR1 and R16F2/R16R2 to respectively carry out direct PCR and nested PCR, the healthy total DNA of the bamboo willow is used as a negative control, the Chinese jujube witches' disease DNA is used as a positive control, and the sterile double-distilled water is used as a blank control.

The direct PCR takes plant total DNA as a template and R16mF2/R16mR1 as an amplification primer, and the reaction system is as follows:

10×PCR buffer 2.5μL

2.5mM dNTPs 1μL

R16mF2(10μmol/L)1μL

R16mR1(10μmol/L)1μL

template DNA 1. mu.L

Taq DNA polymerase (5U/. mu.L) 0.5. mu.L

Add ddH₂O to 25. mu.L

The direct PCR reaction conditions were: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30sec, annealing at 55 ℃ for 30sec, extension at 72 ℃ for 2min, 30 cycles, final extension at 72 ℃ for 10min, and heat preservation at 4 ℃.

Nest type PCR (nest-PCR)

After the direct PCR is finished, diluting the PCR product by 30 times, taking 1 mu L as a nested PCR template, taking R16F2/R16R2 as an amplification primer, and adopting the following reaction system and conditions:

10×PCR buffer 2.5μL

2.5mM dNTPs 1μL

R16F2(10μmol/L)1μL

R16R2(10μmol/L)1μL

template DNA 1. mu.L

Taq DNA polymerase (5U/. mu.L) 0.5. mu.L

Add ddH₂O to 25. mu.L

3min at 94 ℃; 94 ℃ for 30 sec; 30sec at 57 ℃; 2min at 72 ℃; 30 cycles; 10min at 72 ℃; storing at 4 ℃.

5 agarose gel electrophoresis detection

The specific steps of agarose gel preparation and electrophoresis detection are detailed in 3.3.2 experimental steps. The nested PCR products were detected by electrophoresis on a 1% agarose gel, and the expected target size band after amplification of the primer pair R16F2/R16R2 was about 1200bp, and the results were recorded by observation and photography.

6 Gene cloning and sequence analysis

Recovery and purification of PCR product gel

The PCR product with positive electrophoresis detection is recovered by using a SanPrep column type glue recovery kit of the company of biological engineering (Shanghai) GmbH, and the specific operation steps refer to the kit specification.

Recovery of product ligation reactions

Connecting a reaction system:

the connection reaction conditions are as follows: 30min at 16 ℃; ligation was performed overnight at 4 ℃.

Transformation of

(1) Taking out DH5 alpha competent cells from a refrigerator at-80 ℃, adding 50 mu L of the cells into a centrifuge tube, adding 5 mu L of the ligation product into the competent cells, gently blowing and uniformly mixing, and standing on ice for 30 min.

(2) The centrifuge tube with the ice bath is placed in a water bath kettle with 42 ℃ which is set in advance for 90 s.

(3) The centrifuge tube was taken out and placed on ice for 5 min.

(4) Adding 300 mu L LB liquid culture medium, mixing uniformly, transferring into a 15mL centrifuge tube, and recovering for 90min to a turbid state at 37 ℃ and 220 r/min.

(5) Opening the aseptic operating table, ultraviolet sterilizing for 30min, sterilizing the coating rod under the flame of alcohol lamp with outer flame, and cooling to room temperature.

(6) 100 mu L of the recovered bacterial liquid is added to LB solid culture medium containing Amp (50 mu g/mL), IPTG (24mg/mL) and X-Gal (20mg/mL), and a coating rod is coated evenly.

(7) And (5) inverting the culture dish, and culturing in an incubator at 37 ℃ for 12-16 h.

(8) 3mL of LB liquid medium and 3. mu.L of Amp were added to a 15mL centrifuge tube, and a white single colony was picked up with a pipette tip of a sterile pipette and placed in the bacterial solution, and cultured overnight at 220r/min at 37 ℃.

Plasmid DNA extraction

The plasmid DNA is extracted by adopting a Sanprep column type plasmid DNA miniprep kit of biological engineering (Shanghai) corporation, and the specific operation steps refer to the kit specification.

Sequencing

Sequencing of recombinant plasmid DNA by the corporation of Weitusheng engineering bioengineering (Shanghai), the sequencing method adopts the Sanger dideoxy method to carry out bidirectional sequencing. (sequence one)

Secondly, infection: connecting a plant suspected to be infected with the phytoplasma disease with catharanthus roseus through the dodder, observing the manifestation symptom of the catharanthus roseus when the plant is infected for 30 days and 60 days respectively, extracting the total DNA of the catharanthus roseus, amplifying by PCR, and sequencing:

cutting diseased and healthy willow branches in a greenhouse for culturing, performing a phytoplasma infection test by taking semen cuscutae as a bridge, repeating the treatment for 3 times, observing the growth condition of catharanthus roseus after the semen cuscutae completely parasitizes on the willow branches and the catharanthus roseus for 30 days and 60 days, extracting DNA, and performing nested PCR detection on the catharanthus roseus infected by the healthy willow branches by taking general primers R16mF2/R16mR1 as a healthy control.

Thirdly, tieback: connecting the infected catharanthus roseus with a healthy plant through the south dodder seed, observing the expression symptom of the healthy plant, extracting the total DNA of the healthy plant, and performing PCR amplification sequencing:

culturing diseased and healthy vinca in a greenhouse, performing a phytoplasma infection test by taking semen cuscutae as a bridge, repeating the treatment for 3 times, observing the growth condition of willow after the semen cuscutae completely parasitizes on willow branches and catharanthus roseus for 30 days and 60 days, extracting DNA, performing nested PCR detection on R16mF2/R16mR1 by taking the willow infected by the healthy vinca as a healthy control, and sequencing (sequence II).

Fourthly, comparison: and comparing the sequencing result (sequence II) of the infected healthy plant with the initially determined sequence (sequence I) of the infected plant, comparing the homology, and finishing the verification of the Coriolis rule of the phytoplasma diseases.

Homology comparison: BLAST comparison is carried out on the first sequence and the second sequence in an ncbi database, and then the homology of the two sequences is determined by using DNAMAN and other software.

Claims (1)

1. The Koehshi method for verifying phytoplasma diseases is characterized by comprising the following steps of:

(1) and (3) identification: extracting total DNA of a plant suspected to be infected with the phytoplasma disease, detecting by using a PCR (polymerase chain reaction) technology, sequencing, and determining that the disease belongs to the phytoplasma disease from a molecular level;

(2) infection: connecting a plant suspected to be infected with the phytoplasma disease with catharanthus roseus through the dodder, observing the manifestation symptom of the catharanthus roseus, and confirming the infection;

(3) tieback: connecting the infected catharanthus roseus with the same healthy plant as the plant in the step (1) through the south dodder seed, observing the expression symptom of the healthy plant, extracting the total DNA of the infected healthy plant, and performing PCR amplification sequencing;

(4) and (3) comparison: and (3) carrying out homology comparison on the sequencing result of the step (3) and the sequencing result of the step (1) to finish the verification of the Coriolis rule of the phytoplasma diseases.

Images