CN104911205A - Method for obtaining transgenic alfalfa and special expression vector CPB-LAR-GFP thereof - Google Patents

Abstract

The invention discloses a method for obtaining transgenic alfalfa and a special expression vector thereof. A plant expression vector is a condensed tannin synthetase LAR gene plant expression vector CPB-LAR-GFP with a green fluorescent protein (GFP) marker gene and a herbicide resistant bar gene, and a construction method of the plant expression vector is provided. The beneficial effects are that a condensed tannin synthetase LAR gene is separated and cloned from onobrychis viciaefolia with a high condensed tannin content, and a double-marker selecting plant expression vector CPB-LAR-GFP with the green fluorescent protein (GFP) marker gene and the herbicide resistant bar gene is constructed. Through a genetic transformation method, the herbicide resistant gene and the condensed tannin gene are introduced into the alfalfa at the same time. Therefore, the amount of adopted herbicide can be reduced, pollution of a large amount of adopted pesticide to environment is reduced, the content of the condensed tannin in forage can be improved, and finally new pasture cultivars with the advantages of resisting herbicide and tympany are cultivated.

Description

A kind of method and dedicated expression vector therefor CPB-LAR-GFP thereof obtaining transgenic alfalfa

Technical field

The present invention relates to the method and dedicated expression vector therefor CPB-LAR-GFP thereof that obtain transgenic alfalfa.

Background technology

Sainfoin (Onobrychis viciaefolia) is per nnial herb, and its over-ground part crude protein and aminoacids content enrich, the crude fat containing some amount, multivitamin and mineral substance and other chemical substances.Seed production and the grass yield of sainfoin are high, and seed production ability is better, and nutritive substance enriches comprehensively, palatability excellent [Chen Baoshu. Chinese grassland, 1983, (2): 36-45.].Gansu sainfoin (Onobrychis viciifolia cv.Gansu) be by common sainfoin and Caucasia sainfoin freely hybridize repeatedly that Single-plant selection in the plant of mass pollination cultivates [Chen Baoshu. sainfoin [M]. Lanzhou: Gansu science tech publishing house, 1992.].Seed selection object is for China's Arid&semi-arid area sets up artificial pasture.Its grass yield is close or exceed precocity, fast-growing, disease and insect resistance, high yield, drought-enduring alfalfa cultivars.

Soluble protein content height is the major cause [Howarth R E, et al.Journal of Agricultural and Food Chemistry, 1977,25 (1): 175-179.] that clover causes domestic animal hoove.Condensed tannin can generate with soluble protein effect and precipitate, and avoids causing hoove, but alfalfa blade is not containing condensed tannin, only exists on a small quantity in seed coat.Sainfoin each growth period blade can production high density condensed tannin [Wu Zili etc. Chinese Grassland journal, 1993, (5): 25-27.].Domestic animal is feeding have the sainfoin of macromole condensed tannin after can not suffer from hoove, generally believe that sainfoin solves alfalfa at genetic resources new and innovative ways and forage grass Land use systems to cause the desirable herbage of the pathogenetic one of livestock tympanites [(1) McMahon L R, et al.Canadian Journal of Plant Science, 2000,80:469 – 485; (2) Wang Yuping etc. meadow journal, 2000,8 (2): 126-131.].At genetic resources innovation direction, qualification and separating condensed tannin synthase gene from sainfoin, and then utilize genetic engineering technique by this channel genes in clover, can yet be regarded as one and improve the effective way of alfalfa quality and palatability.

Condensed tannin route of synthesis completes primarily of public phenylpropyl alcohol alkane approach, core classes flavones-anthocyanidin approach, condensed tannin specialized pathway, wherein its accumulation of condensed tannin specialized pathway final decision [Xie DY, et al.Science, 2003,299 (5605): 396-399.].Two key enzymes are had to be leucocyanidin reductase enzyme (Leucoanthocyanidin reductase respectively in the special constructive ways of condensed tannin, and anthocyanin reductase (Anthocyanidin reductase LAR), ANR) [(1) Xie DY, et al.Science, 2003,299 (5605): 396-399; (2) Bogs J, et al.Plant Physiology, 2005,139 (2): 652-663.].LAR and ANR is that the generation of tannin provides two different approach and different precursor substances, but the former substrate leucocyanidin is again the substrate that the anthocyanidin synthesized through anthocyanidin synthetic enzyme becomes the latter, LAR is particularly important [Yuan L in the special route of synthesis of condensed tannin, et al.Journal of Experiment Botany, 2012,63 (7): 2513-2524.].Some researchs confirm the expression of LAR gene and the accumulation positive correlation [Paolocci F, et al.Plant physiology, 2007,143 (1): 504-516.] of condensed tannin.The expression level of regulation and control LAR gene can change the accumulation of CT.The LAR gene of cloning the earliest is from leguminous plants---Longhairy Antenoron Herb (Desmodium uncinatum), the albumen of this genes encoding catalysis can produce catechin, demonstrating LAR is rate-limiting enzyme [Tanner GJ in tannin route of synthesis, et al.Journal of Biology Chemistry, 2003,278:31647-31656.].In the Hybrid Poplar (P.trichocarpa × P.Deltoides) infecting leaf rust, in tannin route of synthesis, the transcriptional level of key gene LAR obviously increases, tannin content significantly raises [Miranda M, et al.Molecular Plant-Microbe Interactions, 2007,20:816-831].

Bar (the bialaphos resistance gene) gene of anti-broad-spectrum herbicide grass fourth phosphine have good antiweed resistance [(1) Meng Lingzhen etc. Xinjiang Agricultural Univ journal .2013,36 (4): 265-268; (2) De Block M, et al.EMBO J, 1987,6 (9): 2513-2518; Yang Zhu equality, biotechnology and sustainable agriculture [M]. Shanghai: Shanghai scientific and technical literature press, 2000.], both for insect pest of the plant and a large amount of negative impact using weedicide to bring to plant, the manpower and financial resources that can be reduced in again in agriculture production had dropped into.Bar gene is also one of conventional selectable marker gene, is building up in identical carrier by it and other goal gene, adds certain amount and just can screen transformant containing goal gene in Selective agar medium.Which overcome the limitation of antibiotic-screening, the false transformant that cell produces is little.

Green fluorescent protein (Green fluorescent protein, GFP) be the bioluminescent protein that a class is present in the coelenterates bodies such as jellyfish, hydra and coral, without the need to adding any substrate and cofactor again, ultraviolet or blue-light excited lower just can transmitting green fluorescence [Yang Mingyu etc. food and biotechnology journal, 2008,27 (2): 98-102.].As gene Selection, GFP mainly contains 2 effects in plant: the expression of monitoring gene and the location of protein; And as the molecule marker of transgenic plant, the effect [Jim H, Brad A.Technical Focus, 1995,8 (11): 10-11.] of GUS can be replaced.GFP is used for detecting transgene efficiency as selectable marker gene, after being connected to the promotor of goal gene, just can be detected the expression level of this gene by the fluorescence intensity measuring GFP.As the reporter molecules GFP of transfer-gen plant, maximum advantage is, the direct imaging when not broken garland cells and chemical staining, detects very convenient [Chalfie M, et al.Science, 1994, (263): 802-805.]。

Summary of the invention

Object of the present invention is exactly for above-mentioned defect of the prior art, provides the method and dedicated expression vector therefor CPB-LAR-GFP thereof that obtain transgenic alfalfa.

To achieve these goals, technical scheme provided by the invention is: for obtaining a kind of plant expression vector of transgenic alfalfa, and described plant expression vector is the condensed tannin synthetic enzyme LAR gene plant expression vector CPB-LAR-GFP with green fluorescent protein GFP marker gene and antiweed bar gene.

Second object of the present invention there is provided the construction process of the above-mentioned plant expression vector for obtaining a kind of transgenic alfalfa, comprises the following steps:

1) clone of sainfoin leucocyanidin reductase enzyme LAR gene:

Gansu sainfoin blade is selected to extract RNA and purifying RNA, reverse transcription synthesis cDNA first chain, pcr amplification LAR gene; The amplified production of recovery is connected to carrier T transformation of E. coli competence; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking; Sequencing result is compared; Determine condensed tannin synthetic enzyme LAR gene, obtaining recon is: pMD-LAR;

2) subclone of green fluorescent protein GFP gene:

Single bacterium colony (acquisition of pBI121-Lyz-GFP bacterial strain of picking pBI121-Lyz-GFP bacterial strain, can see " structure of pBI121-Lyz-GFP expression vector and with the conversion in the alfalfa callus of field ", Chai Yanwen etc., " the biological journal of agrotechnique " 05 phase in 2008), shake bacterium, extract plasmid, pcr amplification GFP gene, transformation of E. coli competence after the GFP object fragment reclaimed is connected with carrier T; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking, and obtaining recon is: pMD-GFP;

3) structure of CPB-LAR-GFP plant expression vector and qualification:

BamH I and Sma I double digestion are carried out to pMD-GFP, cuts GFP gene; Sma I and Sac I double digestion are carried out to pMD-LAR, cuts LAR gene; BamH I and Sac I double digestion are carried out to support C PB, carrier and the gene of sticky end will be had by T4DNA ligase enzyme, 16 DEG C of connections of spending the night, connect product conversion competence E.coli DH5 α, select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, obtains CPB-LAR-GFP plant expression vector.

3rd object of the present invention there is provided a kind of method obtaining transgenic alfalfa, be that above-mentioned CPB-LAR-GFP plant expression vector is imported in clover by agrobacterium-mediated transformation, obtain having antiweed character and the high transgenic alfalfa of condensed tannin content.

Further, the method of a kind of transgenic alfalfa of above-mentioned acquisition, adopt freeze-thaw method to be converted in the competent cell of agrobacterium tumefaciens lba4404 by plant expression vector CPB-LAR-GFP, coat on the YEB solid medium containing kantlex, Rifampin and Streptomycin sulphate, 28 DEG C of constant temperature culture 2d, the positive single bacterium colony of picking, carries out PCR qualification.

Further, the concrete operations of recombinational agrobacterium transform alfalfa are comprised the following steps by the method for a kind of transgenic alfalfa of above-mentioned acquisition:

A) get containing the Agrobacterium LBA4404 for examination plasmid CPB-LAR-GFP, YEB plate culture medium containing 50mg/L kantlex and 20mg/L Rifampin is rule, after 28 DEG C of cultivation 2d, the access of picking list bacterium colony is containing in corresponding antibiotic YEB liquid nutrient medium, 28 DEG C of shaking culture are spent the night, obtain activating Agrobacterium, the OD600 value of described activation Agrobacterium is 0.3 ~ 0.5;

B) hypocotyl of clip alfalfa aseptic seedling, the activation Agrobacterium using step a) to obtain infects 10min, infect and with sterilized water, organization material has been cleaned up, with aseptic filter paper, water is blotted, inducing culture is proceeded to after Dual culture 3d, after light culture 25d, proceed to division culture medium, carry out differentiation and regeneration cultivation.。

Key problem in technology point of the present invention and wish protection point build the condensed tannin synthetic enzyme LAR gene plant expression vector CPB-LAR-GFP with GFP and antiweed bar gene; the expression vector built is imported in clover by agrobacterium-mediated transformation; convenient, fast when detecting transfer-gen plant; without the need to dyeing; do not destroy cellularstructure; only need ultraviolet or blue-light excited under, come the expression of monitoring gene and the location of protein by the fluorescence intensity measuring GFP.In Selective agar medium, add certain amount weedicide just can screen transformant containing goal gene.Which overcome the limitation of antibiotic-screening, the false transformant that cell produces is little.This expression vector contains antiweed bar gene and condensed tannin synthetic enzyme LAR gene, import alfalfa variety simultaneously, be intended to cultivate the excellent transgenic alfalfa new variety with antiweed and high condensation tannin content, so both can reduce a large amount of use agricultural chemicals pollution on the environment, the content of condensed tannin in herbage can be improved again, further the generation of prevention animal hoove.

Beneficial effect of the present invention is: the present invention is intended to separating clone condensed tannin synthetic enzyme LAR gene from condensed tannin content high plant-sainfoin, and the double-tagging building Carrying Green Fluorescent Protein GFP and antiweed bar gene selects plant expression vector CPB-LAR-GFP.Pass through genetic transformation, anti-herbicide gene and condensed tannin gene are imported clover simultaneously, so both can reduce the use of weedicide, alleviate a large amount of use agricultural chemicals pollution on the environment, the content of condensed tannin in herbage can be improved again, finally cultivate the herbage new variety with antiweed and anti-hoove advantage.

LAR gene source in carrier of the present invention in sainfoin, separating clone condensed tannin synthetic enzyme LAR gene from sainfoin, and build carrier add bar gene, both there is antiweed character, there is again the function of marker gene.Therefore the carrier that the present invention builds possesses double-tagging gene, greatly can improve the efficiency of screening transgenic plant.Antiweed feature will be obtained by the transfer-gen plant of vector of the present invention, and can avoid like this using a large amount of weedicide and the production cost that causes improves, the pressure of environmental pollution can be reduced again.

Accompanying drawing explanation

Fig. 1 is the total serum IgE of Gansu sainfoin Different Organs.

Wherein, swimming lane 1 is flower bud total serum IgE, and swimming lane 2 is stem total serum IgE, and swimming lane 3 is leaf total serum IgE, and swimming lane 4 is flower total serum IgE, and swimming lane 5 is pod total serum IgE.

Fig. 2 is the PCR qualification result figure (≈ 1kb) of LAR positive colony.

Wherein, swimming lane M is DL1000Marker, and swimming lane 1,2 is positive colony PCR primer.

Fig. 3 is LAR positive colony double digestion (Smal I+Sac I) qualification result figure (≈ 1kb).

Wherein, swimming lane M is DL1000Marker, and swimming lane 1,2 is positive colony Smal I and Sac I double digestion product.

Fig. 4 is Gansu sainfoin LAR genetic sequence map, as shown in sequence in sequence table 1.

Fig. 5 is GFP delayed plasmid PCR qualification result figure.

Wherein, swimming lane 4 is DL1000Marker, and swimming lane 1,2,3 is GFP gene (≈ 750bp).

Fig. 6 is the delayed plasmid double digestion of GFP (BamH I+Smal I) qualification result figure.

Wherein, swimming lane 1 is DL1000Marker, and swimming lane 2,3 is delayed plasmid double digestion qualification (BamH I+Smal I, ≈ 750bp) of GFP.

Fig. 7 is GFP gene sequencing result figure, as shown in sequence in sequence table 2.

Fig. 8 is restructuring plasmid PCR and double digestion qualification result figure.

Wherein, swimming lane 1,5 is DL2000Marker, swimming lane 2 is recombinant plasmid double digestion result (BamH I+Sac I, 714bp), and swimming lane 3 is recombinant plasmid double digestion (Smal I+Smal I, 1089bp), swimming lane 4 is recombinant plasmid double digestion result (BamH I+Sac I, 1803bp), and swimming lane 6 is restructuring plasmid PCR result (1089bp), swimming lane 7 is restructuring plasmid PCR result (714bp), and swimming lane 8 is DL1000Marker.

Fig. 9 is the PCR qualification result figure that expression vector imports Agrobacterium.

Wherein, swimming lane 1 is DL2000Marker; Swimming lane 2,5 is recombinational agrobacterium PCR result (1089bp); Swimming lane 3,6 is the PCR result (714bp) of recombinational agrobacterium; Swimming lane 4,7 is DL1000Marker.

Figure 10 is that the PCR turning LAR gene clover callus detects.

Wherein swimming lane 1,15 is DL1000Marker, and swimming lane 2 is negative control, and swimming lane 3 is water, and swimming lane 4 is positive control, swimming lane 5,6, and 8,9,11 ~ 13 is the PCR result of transgenic alfalfa callus.

Figure 11 is that transgenosis callus GFP gene by fluorescence is expressed.

Figure 12 is vector construction schematic diagram.

Embodiment

Embodiment 1:

1, the extraction of sainfoin total serum IgE:

Be rich in the feature of polyphenol, polysaccharide and secondary metabolite for sainfoin, get the fresh tender tissue of Gansu sainfoin plant, adopt CTAB legal system for RNA crude extract, and be further purified the RNA extracted, find out a kind of extracting method of applicable sainfoin total serum IgE.Present method is combined with RNA to prevent secondary metabolite mainly through adding 4%PVP in Extraction buffer; Add 2% beta-mercaptoethanol to reduce the interference of polyphenol substance; Utilize water-saturated phenol: chloroform: isoamyl alcohol extraction removes DNA, albumen and the colors such as chlorophyll, anthocyanidin to the interference of RNA, both saves experimental cost, reduces again the probability of RNA degraded, improves the quality of RNA.By using LiCl selective precipitation RNA, RNA is effectively separated with polysaccharide.Purifying is carried out to the total serum IgE crude extract obtained, decreases the interference of polyphenol, secondary metabolite and pigment, improve concentration and the purity of RNA; Otherwise follow-up post transcription cloning is seriously suppressed, goal gene can not be obtained.

1.1 CTAB methods slightly carry total serum IgE:

(1) get 0.1g Gansu sainfoin material in the mortar of precooling, add liquid nitrogen freezing grind into powder, and transfer in the centrifuge tube of 1.5ml;

(2) the Extraction buffer 600 μ L of 65 DEG C of preheatings [RNA Extraction buffer is 2%CTAB (W/V), 4%PVP (W/V), 100mmol/L Tris-Cl (pH 8.0), 25mmol/LEDTA (pH 8.0), 1.4mol/LNaCl, add 2% beta-mercaptoethanol (W/V) before use] is joined 1.5ml containing in the centrifuge tube of vegetable material, concuss 1min, guarantee the abundant cracking of vegetable material, 65 DEG C of temperature bath 10min, period concussion 2 ~ 3 times;

(3) the centrifugal 10min of 12000r/min at 4 DEG C; Get supernatant liquor, add 600 μ L water-saturated phenols: chloroform: primary isoamyl alcohol (25:24:1), concussion mixing, place 10min for-20 DEG C; The centrifugal 10min of 12000r/min at 4 DEG C;

(4) be transferred to by supernatant liquor in another new 1.5ml centrifuge tube, repeating step (3) once;

(5) get supernatant liquor, after adding the 10mol/L LiCl mixing of 1/3 volume, place 3h, the centrifugal 20min of 12000r/min at 4 DEG C for-20 DEG C;

(6) supernatant liquor is abandoned, be precipitated and dissolved in 500 μ L DEPC dH2O water, add the 3mol/L NaAC (pH 5.2) of 1/10 volume, the precooling dehydrated alcohol of 2.5 times of volumes is added after abundant dissolving, mixing,-70 DEG C of process 30min, at 4 DEG C, the centrifugal 10min of 12000r/min, abandons supernatant liquor;

(7) with 70% washing with alcohol once, the centrifugal 5min of 12000r/min at 4 DEG C;

(8) repeating step (7) once, sucks residual ethanol as far as possible;

(9) abandon supernatant liquor, after air-dry under being deposited in room temperature, obtain the crude extract of RNA, add 50 μ L DEPC dH ₂o dissolves RNA, saves backup in-80 DEG C.

The purifying of 1.2 total serum IgE:

(1) 1 pipe merged into by total serum IgE crude extract 2 pipe above-mentioned steps prepared, and then adds 900 μ L 0.1%DEPC dH ₂o dissolves, and adds isopyknic water-saturated phenol: chloroform: primary isoamyl alcohol (25:24:1), concussion mixing, the centrifugal 20min of 12000r/min at 4 DEG C;

(2) get supernatant liquor, add the 3mol/L NaAC (pH 5.2) of 1/10 volume, the precooling dehydrated alcohol of 2.5 times of volumes, mixing ,-70 DEG C of process 30min, at 4 DEG C, the centrifugal 20min of 12000r/min, abandons supernatant liquor;

(3) with 70% washing with alcohol twice, the centrifugal 5min of 12000r/min at 4 DEG C;

(4) abandon supernatant liquor, after precipitation drying, add 50 μ L 0.1%DEPC dH ₂o fully dissolves, and saves backup in-80 DEG C.

1.3 total serum IgE quality examinations:

(1) total serum IgE purity and Concentration Testing:

Get 1 μ L RNA sample, measure OD in Merinton micro-spectrophotometer ₂₆₀, OD ₂₈₀, OD ₂₆₀/ OD ₂₈₀, RNA sample concentration (with 0.1%DEPC water for blank solution returns to zero).If OD ₂₆₀/ OD ₂₈₀ratio between 1.8 ~ 2.0, then illustrate that RNA inclusion-free pollutes.

(2) total serum IgE agarose gel electrophoresis detects:

Get 10 μ L RNA solution, after 1% agarose gel electrophoresis (damping fluid is 1 × tbe buffer liquid, voltage 100V) 30min, be placed in gel imaging system and take a picture.

Adopt the sainfoin total serum IgE that the method is extracted, as shown in Figure 1, purity is high, integrity good, and electrophoretic band is clear, OD ₂₆₀/ OD ₂₈₀value is between 1.8 ~ 2.0, and its quality can meet the requirement of subsequent molecular completely.

2, the clone of Gansu sainfoin leucocyanidin reductase enzyme (LAR) gene:

2.1 PCR primer designs:

Sainfoin condensed tannin synthesis key enzyme leucocyanidin reductase gene (LAR) sequence is obtained from ncbi database; utilize DNAMAN software design special primer; in order to the later stage is connected on plant expression vector (support C PB contains bar gene) smoothly; add restriction enzyme site (Smal I and Sac I) and protection base at primer two ends, study for transgene expression.Primer sequence is as follows:

P ₁：5'-CG CCCGGGATGGCGACTTCCCCAGCCAATATC-3'

Smal Ⅰ

P ₂：5'-GC GAGCTCTCAACAGGAAGCTGTTATTGGGACTG-3'

Sac Ⅰ

Primer synthesis and sequencing analysis complete by Shanghai Sheng Gong bio-engineering corporation.

The synthesis of 2.2 cDNA first chains: carry out according to test kit specification sheets.

2.3 RT-PCR goal gene:

With cDNA first chain of reverse transcription for template, P ₁, P ₂for primer, amplification LAR gene.PCR reaction system (25 μ L) comprises cDNA 1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP 2 μ L, primer P ₁and P ₂(10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Amplification is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 1min, 57 DEG C of annealing 1min, 72 DEG C extend 1min30s, 38 circulations; 72 DEG C extend 10min, finally in 4 DEG C of preservations.

The clone of 2.4 amplified productions and the screening of recombinant plasmid:

Transformation of E. coli competence after the object fragment reclaimed is connected with carrier T.Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, as shown in Figure 2,3, send biotech firm to check order.Sequencing result is carried out BLAST compare of analysis on NCBI website, and it and sainfoin LAR gene (accession number: HM152981) have the similarity of 98.34%.Its open reading frame is 1089bp, as shown in Figure 4, comprises 362 amino acid encoding region and a terminator codon (TAG).By this recon called after: pMD-LAR.The Gansu sainfoin LAR gene of clone is registered at GenBank, and accession number is KP013623.

3, the subclone of green fluorescent protein (GFP) gene:

3.1 PCR primer designs:

According to the gene order reported; use DNAMAN software design special primer; in order to the later stage is connected on plant expression vector (CPB) smoothly, add restriction enzyme site (BamH I and Smal I) and protection base at primer two ends, study for transgene expression.Primer sequence is as follows:

P ₃：5'-CGC GGATCCATGAGTAAAGGAGAAGAAC-3'

BamH Ⅰ

P ₄：5'-GCG CCCGGGTTTGTATAGTTCATCCAT-3'

Sma Ⅰ

Primer synthesis and sequencing analysis complete by Shanghai Sheng Gong bio-engineering corporation.

The preparation of 3.2 GFP plasmid DNA:

Single bacterium colony of pBI121-Lyz-GFP bacterial strain that picking laboratory is preserved, is inoculated in LB liquid nutrient medium, and 37 DEG C of shaken overnight are cultivated, and extract plasmid in a small amount by alkaline lysis, be stored in after 1% agarose gel electrophoresis qualification-20 DEG C for subsequent use.

The pcr amplification of 3.3 goal gene:

With pBI121-Lyz-GFP plasmid DNA for template, P ₃, P ₄for primer, amplification GFP gene.PCR reaction system (25 μ L) comprises cDNA1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP2 μ L, primer P1 and P2 (10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Amplification is: 94 DEG C of denaturation 4min; 95 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 10min, finally in 4 DEG C of preservations.

The clone of 3.4 amplified productions and the screening of recombinant plasmid:

Transformation of E. coli competence after the object fragment reclaimed is connected with carrier T.Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, as shown in Figure 5,6, send biotech firm to check order, as shown in Figure 7.By this recon called after: pMD-GFP.

4, the structure of CPB-LAR-GFP plant expression vector and qualification:

BamH I+Sma I double digestion is carried out to pMD-GFP, cuts GFP gene; Sma I+Sac I double digestion is carried out to pMD-LAR, cuts LAR gene; BamH I+Sac I double digestion is carried out to support C PB, passes through T ₄dNA ligase will have carrier and the gene of sticky end, 16 DEG C of connections of spending the night.Connect product conversion competence E.coli DH5 α, select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, as shown in Figure 8.

5, plant expression vector CPB-LAR-GFP transformation Agrobacterium:

Freeze-thaw method is adopted to be converted in the competent cell of agrobacterium tumefaciens lba4404 by plant expression vector CPB-LAR-GFP (containing bar gene), coat on the YEB solid medium containing kantlex, Rifampin and Streptomycin sulphate, 28 DEG C of constant temperature culture 2d, the positive single bacterium colony of picking, carry out PCR qualification, as shown in Figure 9.

6, recombinational agrobacterium transform alfalfa:

Get containing the Agrobacterium LBA4404 for examination plasmid CPB-LAR-GFP, YEB plate culture medium containing 50 μ g/mL Kan, 25 μ g/mL Str and 25 μ g/mL Rif is rule, after 28 DEG C of cultivation 2d, the access of picking list bacterium colony is containing in corresponding antibiotic YEB liquid nutrient medium, and 28 DEG C of shaking culture are spent the night.The hypocotyl of clip and field clover aseptic seedling, with the Agrobacterium (OD of above-mentioned activation ₆₀₀value is 0.3 ~ 0.5) infect 10min, with sterilized water, organization material is cleaned up, with aseptic filter paper, water is blotted, the callus induction substratum containing 50mg/L Kan, 300mg/L Cef is proceeded to after Dual culture 3d, after light culture 25d, proceed to containing 50mg/L Kan+250mg/L Cef+3mg/L PPT division culture medium, carry out differentiation and regeneration cultivation.

Time of infection: 10min;

The Dual culture time: 3d;

Dual culture base: MS+2,4-D 2.0mg/L;

Callus inducing medium: MS+2,4-D 2.0mg/L+KT 0.5mg/L;

Division culture medium: MS+NAA 0.4mg/L;

Kan screens pressure: 75mg/L;

7, the PCR of transgenic calli detects:

Get callus 0.1g, extract genomic dna, as template, according to LAR gene design specific amplification primer P by CTAB method _5,p ₆, amplification LAR gene.P ₅：ATGGCGACTTCCCCAGCCAATATC；P ₆：TCAACAGGAAGCTGTTATTGGGACTG。PCR reaction system (25 μ L) comprises DNA 1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP 2 μ L, primer P ₅and P ₆(10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Amplification is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 1min, 57 DEG C of annealing 1min, 72 DEG C extend 1min30s, 38 circulations; 72 DEG C extend 10min, finally in 4 DEG C of preservations.PCR primer detects in 1% agarose gel electrophoresis.

After testing, in the callus obtained after screening and culturing, major part is transgenosis callus.As shown in Figure 10,7 strains are had to obtain the LAR gene fragment of about 1000bp in the 10 strain kanamycin-resistant callus tissues chosen.Illustrate that the goal gene transformed has been incorporated in Genomic DNA.

8, the GFP fluoroscopic examination of transgenic calli:

Get transgenic calli and carry out compressing tablet.Callus is placed in slide glass central authorities, drips clear water, covered, beat gently with pencil stub.After carrying out compressing tablet, under OLYPUSBX 51/BX 52 type fluorescent microscope, use blue-light excited transgenic calli, observe and take a picture.

Alfalfa callus after testing containing recombinant plasmid presents green fluorescence under fluorescent microscope, as shown in figure 11, illustrates that GFP gene obtains high expression in alfalfa callus.

9, transgenic calli antiweed Resistance Identification:

Be inoculated into by transgenic calli on the MS substratum containing different concns (1-5mg/L) PPT, the regeneration plant blade obtained with tissue culture does resistance screening contrast.Observe resistance clone regeneration plant to the resistance of different concns PPT.

Bar gene not only as anti-herbicide gene but also can, as marker gene, can be convenient to filter out transformant and non-transformed body.In transformation and selection substratum, add appropriate PPT be beneficial to and filter out transfer-gen plant.This research finds, transgenosis callus is inoculated on the MS substratum containing lower concentration PPT (1mg/L, 2mg/L), more weak on callus impact.When PPT concentration is 3mg/L, part clover callus is suppressed, and brownization occurs.When PPT concentration reach 4,5mg/L time, the alfalfa callus growth of cultivating 20d later is subject to obvious suppression, and along with the prolongation of incubation time, brownization is serious, and callus growth is subject to serious suppression, even dead.Therefore, PPT concentration selects 3mg/L.

10, transgenic calli condensed tannin content detection:

Vanillin-perchloric acid is adopted to measure transgenic calli condensed tannin content, with unconverted callus in contrast.

A) condensed tannin extracts: sample thief 0.5g, liquid nitrogen grinding is powdered, add 3mL pycnogenols extracting solution (70% acetone (v/v) containing 0.5% acetic acid) and be ground to homogenate, shaking table lixiviate 20min, under 5000r/min, centrifugal 10min, gets supernatant liquor, and precipitation 3mL extracting solution cleans 2 times, merge supernatant liquor, and be settled to 10mL; Draw 2mL supernatant liquor add 2mL water and 2mL trichloromethane and after fully shaking up under 5000r/min centrifugal 10min remove chlorophyll (in triplicate); Supernatant liquor is solubility condensed tannin extracting solution, and throw out is insoluble condensed tannin.

B) detection of solubility condensed tannin: get solubility condensed tannin extracting solution 0.5mL, add 3mL95% n-butyl alcohol-hydrochloric acid (95:5, v/v), 95 DEG C of pyrolysis 1h, detects 550nm and 600nm absorption value after the cooling of pyrolysis solution room temperature.

C) detection of insoluble condensed tannin: taking precipitate, adds 3mL95% n-butyl alcohol-hydrochloric acid, 95 DEG C of pyrolysis 1h, and after room temperature cooling, the centrifugal 10min of 5000r/min, detects supernatant liquor 550nm and 600nm absorption value.

Total condensed tannin is counted with solubility condensed tannin and insoluble condensed tannin content sum.

Content=(graticule value * extracting solution cumulative volume * extension rate)/(when fresh weight * measures injection volume * 1000)

Result shows, and the content being integrated with condensed tannin in the alfalfa callus of LAR gene, higher than contrast 22.2%, proves that the heterogenous expression of LAR gene facilitates the accumulation of alfalfa pycnogenols.The LAR gene plant expression vector that further this test of proof builds may be used for the germplasm innovation research improving clover CT content.

Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.

Sequence table

<110> Gansu Agriculture University

<120> mono-kind obtains method and the dedicated expression vector therefor CPB-LAR-GFP thereof of transgenic alfalfa

 

<210> 1

<211> 1089

<212> DNA

<213> Gansu sainfoin LAR gene order

 

<400> 1

atggcgactt ccccagccaa tatccccccc accttgaaag gccgtgttct tatcgtcggc 60

 

gcaaccggtt tcatgggcaa gtttgtggcg gaggcaagtc tttcctccgg acatgtccca 120

 

tttttacttc tccgtcctgg acctatcatc tcttcaaagg cttccattat taaagccttt 180

 

caagataaag gtgcaagagt tatttacggc gtggtaaata ataaagagtt gatggaaaag 240

 

attcttaagg agtatgagat agacattgtt atctctgcta ttggagctga gagcttaatg 300

 

gatcagctaa cactggtgga ggcgatgaaa tctgttaaga gtataaagag gtttttgcca 360

 

tcagaatttg gacacgatgt ggacagggca gatccagttg agccaggtct agcaatgtac 420

 

aaagagaagc gtttggttag gcgtgttatt gaacaatctg gtgtaccata cacctacatc 480

 

tgttgcaatt ccattgcttc ttggccctac tatgacaatt gtcatccatc acagcttcct 540

 

ccacccttgg atcagttgca catttacggt gacggcactg tccaagcata ttttattgat 600

 

ggctatgata ttggtaagtt cacaatgaag gtcgttgatg atgtcagaac aattaacaaa 660

 

aatgttcatt tccgtcctcc tagcaactgc tacagcatga atggccttgc ttctttgtgg 720

 

gaaaagaaac ttggtcgtaa aatcccaaga gttaccgtct ctgaagatga tcttttagga 780

 

atagctgcag aaaattgcat accagaaagt attgtggcat ctataaccca tgatatcttc 840

 

atcaatggtt gtcaagttaa attccacata gatggaattc atgatgttga gattggcact 900

 

ctgtatcctg gagaagaatt caggagtttg gaggattgct ttggggactt tgttcacatg 960

 

gcaattgaca acaacattaa taataatcat aaaggggaaa atggaggagg agttactact 1020

 

actactactg ctactgcagg cacaaaaaag ccgttggtag aagcagtccc aataacagct 1080

 

tcctgttga 1089

 

<210> 2

<211> 732

<212> DNA

<213> GFP gene order

 

<400> 2

cgcggatcca tgagtaaagg agaagaactt ttcactggag ttgtcccaat tcttgttgaa 60

 

ttagatggtg atgttaatgg gcacaaattt tctgtcagtg gagagggtga aggtgatgca 120

 

acatacggaa aacttaccct taaatttatt tgcactactg gaaaactacc tgttccatgg 180

 

ccaacacttg tcactacttt cacttatggt gttcaatgct tttcaagata cccagatcat 240

 

atgaaacggc atgacttttt caagagtgcc atgcccgaag gttatgtaca ggaaagaact 300

 

atatttttca aagatgacgg gaactacaag acatgtgctg aagtcaagtt tgaaggtgat 360

 

acccttgtta atagaatcga gttaaaaggt attgatttta aagaagatgg aaacattctt 420

 

ggacacaaat tggaatacaa ctataactca cacaatgtat acatcatggc agacaaacaa 480

 

aagaatggaa tcaaagttaa cttcaaaatt agacacaaca ttgaagatgg aagcgttcaa 540

 

ctagcagacc attatcaaca aaatactcca attggcgatg gccctgtcct tttaccagac 600

 

aaccattacc tgtccacaca atctgccctt tcgaaagatc ccaacgaaaa gagagaccac 660

 

atggtccttc ttgagtatgt aacagctgct gggattacac atggcatgga tgaactatac 720

 

aaacccgggc gc 732

Claims (5)

1. for obtaining a kind of plant expression vector of transgenic alfalfa, it is characterized in that, described plant expression vector is the condensed tannin synthetic enzyme LAR gene plant expression vector CPB-LAR-GFP with green fluorescent protein GFP marker gene and antiweed bar gene.

2. the construction process of the plant expression vector for obtaining a kind of transgenic alfalfa according to claim 1, is characterized in that, comprise the following steps:

1) clone of sainfoin leucocyanidin reductase enzyme LAR gene:

Gansu sainfoin blade is selected to extract RNA and purifying RNA, reverse transcription synthesis cDNA first chain, pcr amplification LAR gene; The amplified production of recovery is connected to carrier T transformation of E. coli competence; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking; Sequencing result is compared; Determine condensed tannin synthetic enzyme LAR gene, obtaining recon is: pMD-LAR;

2) subclone of green fluorescent protein GFP gene:

Single bacterium colony of picking pBI121-Lyz-GFP bacterial strain, shakes bacterium, extracts plasmid, pcr amplification GFP gene, transformation of E. coli competence after the GFP object fragment reclaimed being connected with carrier T; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking, and obtaining recon is: pMD-GFP;

3) structure of CPB-LAR-GFP plant expression vector and qualification:

BamH I and Sma I double digestion are carried out to pMD-GFP, cuts GFP gene; Sma I and Sac I double digestion are carried out to pMD-LAR, cuts LAR gene; BamH I and Sac I double digestion are carried out to support C PB, carrier and the gene of sticky end will be had by T4 DNA ligase, 16 DEG C of connections of spending the night, connect product conversion competence E.coli DH5 α, select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, obtains CPB-LAR-GFP plant expression vector.

3. obtaining a kind of method of transgenic alfalfa, is imported in clover by agrobacterium-mediated transformation by CPB-LAR-GFP plant expression vector according to claim 1, obtains having antiweed character and the high transgenic alfalfa of condensed tannin content.

4. the method for a kind of transgenic alfalfa of acquisition according to claim 3, it is characterized in that, adopt freeze-thaw method to be converted in the competent cell of agrobacterium tumefaciens lba4404 by plant expression vector CPB-LAR-GFP, coat on the YEB solid medium containing kantlex, Rifampin and Streptomycin sulphate, 28 DEG C of constant temperature culture 2d, the positive single bacterium colony of picking, carries out PCR qualification.

5. the method for a kind of transgenic alfalfa of acquisition according to claim 4, is characterized in that, the concrete operations of recombinational agrobacterium transform alfalfa is comprised the following steps:

A) get containing the Agrobacterium LBA4404 for examination plasmid CPB-LAR-GFP, rule 28 DEG C after cultivating 2d, picking list bacterium colony 28 DEG C of shaking culture are spent the night, and get next day in the YEB liquid nutrient medium of 500 μ L bacterium liquid to 20 mL, 28 DEG C, shake bacterium to OD ₆₀₀value is the growth logarithmic phase of 0.3 ~ 0.5, collect bacterium liquid, the centrifugal 2min of 10000 r/min, abandon supernatant, with the washing of MS liquid nutrient medium, the centrifugal 2min of 10000r/min, then use the resuspended thalline of MS liquid nutrient medium, be and infect bacteria used thereby liquid, containing 50 μ g/mL kantlex Kan, 25 μ g/mL Streptomycin sulphate Str and 25 μ g/mL Rifampin Rif in described YEB liquid nutrient medium;

B) hypocotyl of clip alfalfa aseptic seedling, the activation Agrobacterium obtained by step a) infects 10min, infect and with sterilized water, organization material has been cleaned up, with aseptic filter paper, water is blotted, after Dual culture 3d, proceed to inducing culture, after light culture 25d, proceed to division culture medium, after differentiation and seedling emergence, then root induction, hardening, carry out follow-up Molecular Detection and physiological index determining.