CN114941002B - Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew - Google Patents

Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew Download PDF

Info

Publication number
CN114941002B
CN114941002B CN202210572878.7A CN202210572878A CN114941002B CN 114941002 B CN114941002 B CN 114941002B CN 202210572878 A CN202210572878 A CN 202210572878A CN 114941002 B CN114941002 B CN 114941002B
Authority
CN
China
Prior art keywords
brasot12
cabbage
gene
downy mildew
heart
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210572878.7A
Other languages
Chinese (zh)
Other versions
CN114941002A (en
Inventor
吴廷全
张长远
王瑞
谭德龙
王茹芳
郭金菊
曹海顺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Facility Agriculture Guangdong Academy of Agricultural Science
Original Assignee
Institute of Facility Agriculture Guangdong Academy of Agricultural Science
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Facility Agriculture Guangdong Academy of Agricultural Science filed Critical Institute of Facility Agriculture Guangdong Academy of Agricultural Science
Priority to CN202210572878.7A priority Critical patent/CN114941002B/en
Publication of CN114941002A publication Critical patent/CN114941002A/en
Application granted granted Critical
Publication of CN114941002B publication Critical patent/CN114941002B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
    • C12Y208/02—Sulfotransferases (2.8.2)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an application of cabbage cytoplasmic sulfotransferase gene BraSOT12 in resisting downy mildew, wherein the nucleotide sequence of the cabbage BraSOT12 gene is shown as SEQ ID NO:2, respectively. The invention discovers for the first time that the cabbage heart cytoplasm sulfotransferase gene BraSOT12 can regulate and control the downy mildew resistance of cabbage heart. The invention also provides a product for regulating the downy mildew resistance of cabbage heart, which can achieve the effect of improving the downy mildew resistance of cabbage heart by up-regulating the expression of the BraSOT12 gene in cabbage heart, so that the product can be used for preventing downy mildew of cabbage heart, cultivating transgenic plants resistant to downy mildew of cabbage heart and other related aspects, and has extremely high practical value.

Description

Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew
Technical Field
The invention belongs to the field of plant molecular biology and plant genetic engineering, and particularly relates to an application of a cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew.
Background
Downy mildew of cabbage heart is a cabbage heart obligate parasitic disease caused by parasitic downy mildew (hypalonospora brassicae), which can occur in seedling stage, adult stage, flowering stage to podding stage of cabbage heart and mainly damages leaves, seed pods, flower stalks, stem tops and the like of cabbage heart. The disease usually starts from the lower leaves of the heart of the vegetable, and the disease is a water-soaked chlorosis spot which gradually expands and appears as a tawny polygonal spot limited by the veins. When the weather is wet, white mildew with different densities is generated on the back of the disease spots, and when the disease spots are serious, the disease spots are fused into tablets. In the later stage of disease, the disease spots are cracked, and the disease leaves are dried up and become dark brown. When the stem top and the flower stalk of a seed plant picked from a cabbage heart are infected with diseases, the seed plant is usually fatted and swollen and deformed, commonly called as a dragon head crutch, and the seed pod is infected with the diseases and deformed to different degrees. Downy mildew of cabbage heart is easy to occur at 20-24 ℃ under high humidity conditions (such as winter in south China), and the rainfall is more important than the influence of temperature on the development of diseases. Plants that grow poorly, are densely planted, or have been infected with other viral diseases are more susceptible to downy mildew and often develop more severely.
Therefore, the development or cultivation of disease-resistant cabbage heart varieties is one of the most economic, environment-friendly and effective ways for controlling the downy mildew of cabbage heart, and the excavation of the downy mildew-resistant gene (or protein) is the basis of disease-resistant breeding.
Disclosure of Invention
The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides the application of the cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew, and the inventor finds that the cabbage heart cytoplasm sulfotransferase gene BraSOT12 has an important effect on resisting downy mildew of cabbage heart, can be used for preventing the cabbage downy mildew, preparing products resisting the cabbage downy mildew and cultivating transgenic plants resisting the cabbage downy mildew, and has wide application prospects.
In a first aspect of the invention, the application of a product for regulating the expression of a flowering cabbage BraSOT12 gene in regulating the resistance of crops to downy mildew of flowering cabbage is provided, wherein the nucleotide sequence of the flowering cabbage BraSOT12 gene is shown as SEQ ID NO:1 is shown.
The inventor firstly discovers a cabbage cytoplasmic sulfotransferase gene BraSOT12, and verifies that the gene has a resistance regulation effect on downy mildew of cabbage, the downy mildew-resistant expression quantity of the gene in a downy mildew-resistant cabbage heart material (R128) induced by peronospora parasitica is obviously higher than the downy mildew-induced expression quantity of a downy mildew-sensitive cabbage heart material (S002), the downy mildew of cabbage is inoculated on the downy mildew-resistant cabbage heart leaf over-expressing the BraSOT12 gene, the infected area of the leaf is obviously reduced compared with that of a control, and the infected area of the leaf is obviously increased compared with that of the control by inoculating the downy mildew of cabbage on the downy mildew-resistant cabbage leaf over-expressing the BraSOT12 gene. Thereby demonstrating that the cabbage heart cytoplasm sulfotransferase gene BraSOT12 has an important function on resisting downy mildew of cabbage heart.
According to a first aspect of the present invention, in some embodiments of the present invention, the product has at least one of the functions described in (1) to (5) below;
(1) Up-regulating the BraSOT12 gene expression of the flowering cabbage;
(2) Down-regulating or blocking the expression of the flowering cabbage BraSOT12 gene;
(3) Promoting the secretion of the flowering cabbage BraSOT12 protein;
(4) Inhibiting the secretion of BraSOT12 protein from flowering cabbage;
(5) Target binding to the cabbage BraSOT12 protein receptor or target binding to the cabbage BraSOT12 protein.
In some embodiments of the invention, the amino acid sequence of the flowering cabbage BraSOT12 protein is as set forth in SEQ ID NO:2, respectively.
According to a first aspect of the invention, in some embodiments of the invention, the product comprises any one of the following (1) to (6):
(1) Comprises the amino acid sequence shown in SEQ ID NO: 1;
(2) Comprises the amino acid sequence shown in SEQ ID NO: 1;
(3) A microorganism or cell containing the expression cassette described in (1);
(4) Comprises the amino acid sequence of SEQ ID NO: 3;
(5) Comprises the amino acid sequence shown in SEQ ID NO: 3;
(6) A microorganism or cell comprising the expression cassette described in (4).
In some embodiments of the invention, the crop is a cabbage.
The inventor finds that the BraSOT12 gene can positively regulate the resistance of leaf vegetable downy mildew, particularly for the vegetable heart, experiments prove that the leaf vegetable downy mildew infected area is obviously reduced compared with that of a control by inoculating the leaf vegetable downy mildew on the leaf of the vegetable heart excessively expressing the BraSOT12 gene, and the leaf vegetable infected area is obviously increased compared with that of the control by inoculating the leaf vegetable downy mildew on the leaf of the vegetable heart which silence expresses the BraSOT12 gene. And the parasitic downy mildew in the vegetable core has strong specialization, and the condition of cross species propagation can not occur, so the disease resistance of the vegetable core in the downy mildew resistance can be greatly improved through the product.
In a second aspect of the present invention, there is provided a reagent including any one of the following (1) to (3):
(1) Comprises the amino acid sequence shown in SEQ ID NO: 1;
(2) Comprises the amino acid sequence shown in SEQ ID NO: 1;
(3) A microorganism or cell comprising the expression cassette described in (1).
According to a second aspect of the invention, in some embodiments of the invention, the agent is for increasing the resistance of heart downy mildew of heart.
The inventor finds that the downy mildew resistance of the cabbage can be obviously enhanced by up-regulating the BraSOT12 gene expression level in the cabbage through constructing an overexpression plasmid.
In a third aspect of the present invention, there is provided a method for cultivating a downy mildew resistant cabbage crop, comprising the steps of: up-regulates the expression of the BraSOT12 gene in cabbage heart.
According to a third aspect of the invention, in some embodiments of the invention, the nucleotide sequence of the BraSOT12 gene is as set forth in SEQ ID NO:1 is shown.
In some embodiments of the invention, the crop is a heart of a cabbage.
In some preferred embodiments of the present invention, the method is specifically:
(1) Constructing a BraSOT12 gene overexpression vector;
(2) And (3) transforming the BraSOT12 gene overexpression vector into agrobacterium tumefaciens, screening positive clones, and infecting crops to obtain the plant growth regulator.
In some preferred embodiments of the present invention, the specific construction method in step (1) is: the BraSOT12 gene is constructed into pGWB5 plasmid, and the specific insertion position is between attR1 and attR2 behind the 35S promoter (specifically, ccdB gene in pGWB5 plasmid is replaced by gene recombination exchange), so that the BraSOT12 gene overexpression vector is obtained.
The invention has the beneficial effects that:
1. the invention discovers the application of the cabbage heart cytoplasm sulfotransferase gene BraSOT12 in regulating and controlling the resistance of the cabbage heart to downy mildew for the first time, so that the gene can be used for preventing the cabbage heart downy mildew, preparing products for resisting the cabbage heart downy mildew and cultivating transgenic plants for resisting the cabbage heart downy mildew, and has wide application prospects.
2. The invention provides a product for regulating downy mildew resistance of cabbage heart, which can achieve the effect of improving the downy mildew resistance of cabbage heart by up-regulating the expression of a BraSOT12 gene in cabbage heart, so that the product can be used for preventing downy mildew of cabbage heart, cultivating transgenic plants resistant to downy mildew of cabbage heart and the like, and has extremely high practical value.
Drawings
FIG. 1 is a transcriptional expression analysis diagram of BraSOT12 gene in cabbage heart disease-resistant material R128 and susceptible material S002.
FIG. 2 is a pGWB5 plasmid map.
FIG. 3 is a map of pK7GWIW plasmid.
FIG. 4 shows the transient overexpression of the BraSOT12 gene and the expression of the BraSOT12 gene in cabbage leaves of a blank Control (CK).
FIG. 5 shows BraSOT12 gene silencing and BraSOT12 gene expression in cabbage leaves of blank Control (CK).
FIG. 6 is a resistance identification analysis of cabbage leaves overexpressing the cabbage cytoplasmic sulfotransferase gene BraSOT12 against blank Control (CK) leaves.
FIG. 7 is a resistance identification analysis of cabbage leaves silencing the cabbage cytoplasmic sulfotransferase gene BraSOT12 versus blank Control (CK) leaves.
Detailed Description
In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.
The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.
In the following examples, the vegetable heart materials used were provided by the institute of agricultural new technology, vegetable institute of agricultural sciences, guangdong province. The peronospora brassicae is from peronospora brassicae strains in a puddle experimental place in white cloud area, guangzhou, and is identified and determined to be correct.
BraSOT12 gene transcription expression test in anti-cabbage heart disease and susceptible cabbage heart disease materials
The cabbage BraSOT12 gene is a cytoplasmic sulfotransferase gene, and is found by the inventor in the transcriptome analysis of cabbage resistance and sensitivity materials. In order to determine that the gene can be stably expressed in different varieties of cabbages, the inventor detects the transcription expression level of the cabbage BraSOT12 gene in the cabbage disease-resistant material R128 (collected at the Kyoho Kokukuki 22641institute in 2018, now stored at the facility agriculture institute of Guangdong province agricultural academy) and the susceptible material S002 (collected at the Kyoho Kokuki 22641institute in 2018, now stored at the facility agriculture institute of Guangdong province agricultural academy) before and after the peronospora.
The results are shown in FIG. 1.
It can be found that before the inoculation of peronospora parasitica, the transcriptional expression level of the flowering cabbage BraSOT12 gene is lower in both the flowering cabbage disease-resistant material R128 and the susceptible material S002. After the peronospora parasitica is inoculated for 24 hours, the transcription expression level of the BraSOT12 gene in R128 is rapidly increased to reach 12.47 times before inoculation, while the expression level in S002 is reduced to 0.61 time before inoculation; 24h after inoculation, the expression level of the BraSOT12 gene in R128 was 17 times that of the BraSOT12 gene after S002 inoculation. The flowering cabbage BraSOT12 gene is a potential downy mildew resistance gene.
Construction of BraSOT12 gene overexpression vector and gene silencing vector
Based on the above findings, the inventors further constructed a BraSOT12 gene overexpression vector and a gene silencing vector for further verifying the relationship between the BraSOT12 gene and downy mildew resistance of cabbage.
(1) Construction of BraSOT12 gene overexpression vector:
by adopting a conventional gene recombination method in the field, a CDS full-length sequence of the BraSOT12 gene is constructed into a pGWB5 plasmid (from a topic group in the institute of genetics and developmental biology of China, and a pGWB5 plasmid map is shown in figure 2), and the insertion position is specifically between attR1 and attR2 behind a 35S promoter (specifically, ccdB gene in the pGWB5 plasmid is replaced by gene recombination exchange), so that a BraSOT12 gene overexpression vector pGWB5-BraSOT12 is obtained.
The CDS full-length sequence of the BraSOT12 gene used in the embodiment has the length of 987bp and no intron, and the specific nucleotide sequence is as follows:
5’-ATGTCATCATCATCATCTGTTCCTGATTACTTGAGAGATGAAAATCTGACACAAAAAACAAAAGATCTGATTTCTTCTCTTCCAAGCGAGAAAGGTTGGTTGGTCTGTCAAATGTATCAGTTCCAAGGACGTTGGCACACACAAGCGCTACTAAAAGGAATCTTGACTTGCCAAAAACAATTTGAGGCCAAAGATTCCGACATTATCCTCGTCACCAATCCAAAATCAGGTACCACTTGGTTAAAGGCTCTTGTCTTTGCTCTCATTAACCGACACAAGTTTCCAGTTTATTCTTCTTCTTCTGGTGAGCATCCTCTTCTTGTTACCAATCCGCACTCCCTTGTGCCTTTCTTGGAAGGAGTTTACTACGAATCTCCAGATTTCGATTTCTCCCAGTTGTCTTCTCCAAGACTCATGAACACGCACATATCACATCTTTCGCTGCCCGAGTCCGTTAAAAGCTCGCCTTGTAAGATTGTGTACTGTTGTAGGAAACCTAAGGACATGTTTGTGTCCTTATGGCATTTTGGGAAGAAACTTGCTCCTGAAGAAACCGCTGACTATCCTATTGAAAAAGCAGTGGAAGCGTTTTGTCAAGGGAAATTTATAGGTGGACCCTTTTGGGATCATGTGTTGGAGTATTGGTATGCGAGTCTCGAGAACCCGAACAAGGTCTTGTTTGTTTCTTATGAGGAGCTCAAGAAGAAAACCGGAGACACGATCAAGAGAATAGCTGAATTCTTGGGATGTGGTTTTGTTGGAGAAGAAGAAGTTAGAGCGATTGTGAAGTTGTGTAGCTTTGAGAGCTTAAGTAGTTTGGAAGTTAATAGGGAAGGGAAGTTGCCAAGTGGAATGGAGACCAGAGCTTTCTTTAGAAAAGGAGAGGTTGGAGGATGGAGAGATACTTTGACTGAGTCCTTGGCTGAGGTGATAGATAGAACCATTGAAGAGAAGTTTCAAGGTTCCGGTCTCAAATTTTCTTGCTGA-3’(SEQ ID NO：1)。
the amino acid sequence of the encoded protein is as follows:
MSSSSSVPDYLRDENLTQKTKDLISSLPSEKGWLVCQMYQFQGRWHTQALLKGILTCQKQFEAKDSDIILVTNPKSGTTWLKALVFALINRHKFPVYSSSSGEHPLLVTNPHSLVPFLEGVYYESPDFDFSQLSSPRLMNTHISHLSLPESVKSSPCKIVYCCRKPKDMFVSLWHFGKKLAPEETADYPIEKAVEAFCQGKFIGGPFWDHVLEYWYASLENPNKVLFVSYEELKKKTGDTIKRIAEFLGCGFVGEEEVRAIVKLCSFESLSSLEVNREGKLPSGMETRAFFRKGEVGGWRDTLTESLAEVIDRTIEEKFQGSGLKFSC(SEQ ID NO：2)。
(2) Construction of BraSOT12 gene silencing vector:
by adopting a conventional gene recombination method in the field, a fragment with the length of 165bp (CDS 823-987 bp) of a CDS non-conserved segment of a BraSOT12 gene and a complementary fragment thereof are constructed between attR1 and attR2 (which are purchased from Shanghai Yuanmu Biotechnology Co., ltd., and the map of the pK7GWIW plasmid is shown in figure 3) of which the specific insertion position is 35S behind a promoter (specifically, the ccdB gene in the pK7GWIW plasmid is replaced by gene recombination exchange), so that a BraSOT12 gene silencing vector pK7GWIW-BraSOT12 is obtained.
The specific nucleotide sequence of the fragment of the CDS non-conserved segment of the BraSOT12 gene used in the embodiment, which has the length of 165bp (CDS 823-987 bp), is as follows:
5’-GTTAATAGGGAAGGGAAGTTGCCAAGTGGAATGGAGACCAGAGCTTTCTTTAGAAAAGGAGAGGTTGGAGGATGGAGAGATACTTTGACTGAGTCCTTGGCTGAGGTGATAGATAGAACCATTGAAGAGAAGTTTCAAGGTTCCGGTCTCAAATTTTCTTGCTGA-3’(SEQ ID NO：3)。
construction of transient over-expression/gene silencing cabbage heart leaf gene expression model
The specific construction method comprises the following steps:
(1) Agrobacterium GV3101 was transformed with BraSOT12 gene overexpression vector pGWB5-BraSOT12 and BraSOT12 gene silencing vector pK7GWIW-BraSOT12, respectively, constructed in the above examples, and then cultured in an inverted state for 48h on a medium with corresponding resistance.
(2) The positive single clones were picked up and added to 4mL LB medium containing the corresponding antibiotic and rifampicin, and shaken at 180rpm at 28 ℃ for 24h.
(3) The bacterial liquid is taken and added into a fresh LB culture medium containing corresponding antibiotics and rifampicin according to the volume ratio of 1.
(4) Centrifuging at 3000rpm for 5min, collecting thallus, and suspending with suspension (containing 10mM MES buffer and 10mM MgCl at final concentration) 2 Mixed solution of (4) and adjusted to an OD600 value of about 0.4.
(5) Add acetosyringone to a final concentration of 200mM and let stand at room temperature for 3h.
(6) A needle hole is respectively pricked at two sides of the main leaf vein of the leaf of the cabbage heart seedling for the test by using a syringe needle. And sucking the equivalent amount of the bacteria solution after standing by using a 1mL syringe, and injecting the bacteria solution into the needle hole on the back of the cabbage leaf (the front of the cabbage leaf is blocked by a hand).
(7) Culturing the injected cabbage heart seedling (two leaves and one heart) in the dark for 12h, and culturing at 22 deg.C for 3 days.
(8) Get 10 4 Peronospora Frondosa spore solution with concentration per mL is dripped into the injection needle hole of the leaf of the seedling of the cabbage heart, and cultured for 7 days under the conditions of 12h (20 ℃) in the day and 12h (14 ℃) at night.
(9) And collecting the leaf of the cabbage seedling, and detecting the gene expression level.
Blank Control (CK) was set.
The specific detection method comprises the following steps:
a. the leaf tissue was ground in liquid nitrogen, 1mL of TRIzol (Invitrogen TRIzol) was added per 100mg of the tissue, and homogenization was performed with a homogenizer.
b. The homogenate was left at room temperature (15-30 ℃) for 5 minutes to completely separate the nucleic acid-protein complex.
c. 0.2mL of chloroform was added to 1mL of TRIzol, and the mixture was vigorously shaken for 15 seconds and left at room temperature for 3 minutes. Centrifuging at 2-8 deg.C 10000 Xg for 15 min.
d. The aqueous phase was transferred to a new tube, and RNA in the aqueous phase was precipitated with isopropanol, 0.5mL of which was added to 1mL of TRIzol, and the mixture was left at room temperature for 10 minutes. Centrifuging at 2-8 deg.C 10000 Xg for 10 min, retaining precipitate, and removing supernatant.
e. The RNA pellet was washed with 75% ethanol, 1mL TRIzol plus 1mL 75% ethanol. Centrifuge at 7000 Xg for 5min at 2-8 ℃ and discard the supernatant.
f. Drying at room temperature or vacuum-drying RNA precipitate, air drying for about 5-10 min, adding 25-200 μ L RNase-free water, sucking with a gun head for several times, standing at 55-60 deg.C for 10 min to dissolve RNA, and storing at-70 deg.C.
g. The EF1 alpha gene is used as an internal reference gene, and the ratio of the expression quantity of the target gene to the expression quantity of the internal reference gene is used as the relative expression quantity of the gene. Wherein, the BraSOT12 gene expression amplification primer is F:5'-CGTTAATAGGGAAGGGAAGTTGCC-3' (SEQ ID NO: 4), R:5'-TCAGCAAGAAAATTTGAGACCGG-3' (SEQ ID NO: 5); the EF1 alpha gene expression amplification primer is as follows: f:5'-ACTCCTCCCACATTGCTGTTA-3' (SEQ ID NO: 6), R:5'-CCTCAAGAACTTGGGCTCCTT-3' (SEQ ID NO: 7).
The results are shown in FIGS. 4 and 5.
It was found that the expression level of BraSOT12 gene in BraSOT12 transiently overexpressed leaves of cabbage was significantly higher than that of untreated Control (CK) both before and after inoculation with peronospora parasitica (fig. 4). While the expression level of the BraSOT12 gene in BraSOT12 gene-silenced cabbage heart leaves was significantly less than that of the untreated Control (CK) 24h after inoculation with downy mildew (FIG. 5). The results show that the cabbage heart leaf model with the BraSOT12 gene transient overexpression and the gene silencing is successfully constructed.
Disease resistance experiment of leaf of flowering cabbage
Taking the cabbage leaf model with transient overexpression and gene silencing of the BraSOT12 gene constructed in the embodiment, inoculating downy mildew according to the method in the embodiment, culturing for 7 days, and judging the resistance function of the target gene to downy mildew according to the size of lesion spots of the cabbage leaf after culture. Wherein, the BraSOT12 gene transient overexpression model is based on the cabbage heart disease-resistant material S002, and the BraSOT12 gene silencing model is based on the cabbage heart disease-resistant material R128. The corresponding untreated cabbage heart (untreated cabbage heart susceptible material S002 and cabbage heart resistant material R128) was used as a blank Control (CK). Each set 30 samples.
The areas of the 30 leaf lesions in each group are counted, averaged, and the significance analysis and comparison between different groups are performed, the detection method is the same as that of the above example, and the experimental results are shown in fig. 6 and 7.
As a result, it was found that transient overexpression of the BraSOT12 gene (via pGWB5-BraSOT 12) in heart leaves significantly increased the resistance of heart leaves to downy mildew compared to the Control (CK), whereas transient silencing of the BraSOT12 gene (pK 7GWIW-BraSOT 12) in heart leaves significantly decreased the resistance of heart leaves to downy mildew compared to the Control (CK). The above results demonstrate that regulation of resistance to downy mildew of cabbage heart can be achieved by regulating the BraSOT12 gene.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such modifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> institute of agriculture and research for agriculture and sciences of Guangdong province academy of agricultural sciences
Application of <120> cabbage cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew
<130>
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 987
<212> DNA
<213> BraSOT12
<400> 1
atgtcatcat catcatctgt tcctgattac ttgagagatg aaaatctgac acaaaaaaca 60
aaagatctga tttcttctct tccaagcgag aaaggttggt tggtctgtca aatgtatcag 120
ttccaaggac gttggcacac acaagcgcta ctaaaaggaa tcttgacttg ccaaaaacaa 180
tttgaggcca aagattccga cattatcctc gtcaccaatc caaaatcagg taccacttgg 240
ttaaaggctc ttgtctttgc tctcattaac cgacacaagt ttccagttta ttcttcttct 300
tctggtgagc atcctcttct tgttaccaat ccgcactccc ttgtgccttt cttggaagga 360
gtttactacg aatctccaga tttcgatttc tcccagttgt cttctccaag actcatgaac 420
acgcacatat cacatctttc gctgcccgag tccgttaaaa gctcgccttg taagattgtg 480
tactgttgta ggaaacctaa ggacatgttt gtgtccttat ggcattttgg gaagaaactt 540
gctcctgaag aaaccgctga ctatcctatt gaaaaagcag tggaagcgtt ttgtcaaggg 600
aaatttatag gtggaccctt ttgggatcat gtgttggagt attggtatgc gagtctcgag 660
aacccgaaca aggtcttgtt tgtttcttat gaggagctca agaagaaaac cggagacacg 720
atcaagagaa tagctgaatt cttgggatgt ggttttgttg gagaagaaga agttagagcg 780
attgtgaagt tgtgtagctt tgagagctta agtagtttgg aagttaatag ggaagggaag 840
ttgccaagtg gaatggagac cagagctttc tttagaaaag gagaggttgg aggatggaga 900
gatactttga ctgagtcctt ggctgaggtg atagatagaa ccattgaaga gaagtttcaa 960
ggttccggtc tcaaattttc ttgctga 987
<210> 2
<211> 328
<212> PRT
<213> BraSOT12
<400> 2
Met Ser Ser Ser Ser Ser Val Pro Asp Tyr Leu Arg Asp Glu Asn Leu
1 5 10 15
Thr Gln Lys Thr Lys Asp Leu Ile Ser Ser Leu Pro Ser Glu Lys Gly
20 25 30
Trp Leu Val Cys Gln Met Tyr Gln Phe Gln Gly Arg Trp His Thr Gln
35 40 45
Ala Leu Leu Lys Gly Ile Leu Thr Cys Gln Lys Gln Phe Glu Ala Lys
50 55 60
Asp Ser Asp Ile Ile Leu Val Thr Asn Pro Lys Ser Gly Thr Thr Trp
65 70 75 80
Leu Lys Ala Leu Val Phe Ala Leu Ile Asn Arg His Lys Phe Pro Val
85 90 95
Tyr Ser Ser Ser Ser Gly Glu His Pro Leu Leu Val Thr Asn Pro His
100 105 110
Ser Leu Val Pro Phe Leu Glu Gly Val Tyr Tyr Glu Ser Pro Asp Phe
115 120 125
Asp Phe Ser Gln Leu Ser Ser Pro Arg Leu Met Asn Thr His Ile Ser
130 135 140
His Leu Ser Leu Pro Glu Ser Val Lys Ser Ser Pro Cys Lys Ile Val
145 150 155 160
Tyr Cys Cys Arg Lys Pro Lys Asp Met Phe Val Ser Leu Trp His Phe
165 170 175
Gly Lys Lys Leu Ala Pro Glu Glu Thr Ala Asp Tyr Pro Ile Glu Lys
180 185 190
Ala Val Glu Ala Phe Cys Gln Gly Lys Phe Ile Gly Gly Pro Phe Trp
195 200 205
Asp His Val Leu Glu Tyr Trp Tyr Ala Ser Leu Glu Asn Pro Asn Lys
210 215 220
Val Leu Phe Val Ser Tyr Glu Glu Leu Lys Lys Lys Thr Gly Asp Thr
225 230 235 240
Ile Lys Arg Ile Ala Glu Phe Leu Gly Cys Gly Phe Val Gly Glu Glu
245 250 255
Glu Val Arg Ala Ile Val Lys Leu Cys Ser Phe Glu Ser Leu Ser Ser
260 265 270
Leu Glu Val Asn Arg Glu Gly Lys Leu Pro Ser Gly Met Glu Thr Arg
275 280 285
Ala Phe Phe Arg Lys Gly Glu Val Gly Gly Trp Arg Asp Thr Leu Thr
290 295 300
Glu Ser Leu Ala Glu Val Ile Asp Arg Thr Ile Glu Glu Lys Phe Gln
305 310 315 320
Gly Ser Gly Leu Lys Phe Ser Cys
325
<210> 3
<211> 165
<212> DNA
<213> BraSOT12
<400> 3
gttaataggg aagggaagtt gccaagtgga atggagacca gagctttctt tagaaaagga 60
gaggttggag gatggagaga tactttgact gagtccttgg ctgaggtgat agatagaacc 120
attgaagaga agtttcaagg ttccggtctc aaattttctt gctga 165
<210> 4
<211> 24
<212> DNA
<213> Artificial sequence
<400> 4
cgttaatagg gaagggaagt tgcc 24
<210> 5
<211> 23
<212> DNA
<213> Artificial sequence
<400> 5
tcagcaagaa aatttgagac cgg 23
<210> 6
<211> 21
<212> DNA
<213> Artificial sequence
<400> 6
actcctccca cattgctgtt a 21
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence
<400> 7
cctcaagaac ttgggctcct t 21

Claims (3)

1. Over-expression of flowering cabbageBraSOT12Application of gene vector in regulating and controlling cabbage downy mildew resistance of cabbage crops, and cabbageBraSOT12The nucleotide sequence of the gene is shown as SEQ ID NO:1 is shown.
2. Containing over-expressed Chinese flowering cabbageBraSOT12Application of microorganism or cell of gene vector in regulating and controlling cabbage downy mildew resistance of cabbage crops, and cabbageBraSOT12The nucleotide sequence of the gene is shown as SEQ ID NO:1 is shown.
3. A method for cultivating crops resistant to downy mildew of cabbage heart comprises the following steps: by overexpressing flowering cabbageBraSOT12The vector of the gene up-regulates the flowering cabbageBraSOT12Expression of a gene, saidBraSOT12The nucleotide sequence of the gene is shown as SEQ ID NO:1 is shown.
CN202210572878.7A 2022-05-25 2022-05-25 Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew Active CN114941002B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210572878.7A CN114941002B (en) 2022-05-25 2022-05-25 Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210572878.7A CN114941002B (en) 2022-05-25 2022-05-25 Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew

Publications (2)

Publication Number Publication Date
CN114941002A CN114941002A (en) 2022-08-26
CN114941002B true CN114941002B (en) 2023-03-24

Family

ID=82908486

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210572878.7A Active CN114941002B (en) 2022-05-25 2022-05-25 Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew

Country Status (1)

Country Link
CN (1) CN114941002B (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111254148B (en) * 2018-11-30 2023-03-24 东北农业大学 Cultivation method and application of soybean mosaic virus resistant gene GmST1 and GmST1 transgenic soybeans
WO2020193712A1 (en) * 2019-03-26 2020-10-01 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Brassica plant resistant to downy mildew

Also Published As

Publication number Publication date
CN114941002A (en) 2022-08-26

Similar Documents

Publication Publication Date Title
CN114934054B (en) Application of cabbage heart latex protein gene BraMLP1 in downy mildew resistance
CN110819607A (en) Application of CsLYK gene and coding protein thereof in improving citrus canker resistance
CN110468142B (en) Negative regulatory factor AtRTP5 gene and application thereof in phytophthora infestans resistance
CN110317250B (en) Application of MYB6 gene and encoding protein thereof in regulation and control of verticillium wilt resistance of plants
WO2018205732A1 (en) Gene bgiosga015651 for regulating rice resistance to plant hoppers and use thereof
CN107523574A (en) Regulating cell programmed cell death and the rice uneven class sizes gene SPL35 of disease resistance and its application
CN117844780B (en) Resistance of CaPTPMKP gene to phytophthora melonis and phytophthora capsici and application thereof
CN110468150B (en) Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment
CN114941008B (en) Application of flowering cabbage LRR receptor protein kinase gene BraEFR in downy mildew resistance
CN114807174A (en) Genetic locus for reversely regulating and controlling rice blast germ resistance and application thereof
CN109134633B (en) Rice blast resistant protein and gene, isolated nucleic acid and application thereof
CN110713994B (en) Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof
CN107253980B (en) Application of OsGRF7 gene in rice plant type regulation
CN112175987B (en) Application of cucumber light-harvesting chlorophyll a/b binding protein CsPS1 in resisting melon epidemic disease
CN117430678B (en) Immune induced resistance protein from wheat stripe rust and related biological material and application thereof
CN111635455B (en) Plant disease-resistant related protein and application thereof
CN114941002B (en) Application of cabbage heart cytoplasm sulfotransferase gene BraSOT12 in resisting downy mildew
CN104945492B (en) Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application
CN108559753B (en) Application of wheat stripe rust PSTG _17694 gene in stripe rust prevention and treatment and stripe rust resistant wheat cultivation method
CN108034662B (en) Application of wheat stripe rust PSTG _06025 gene in stripe rust prevention and treatment and cultivation method of stripe rust resistant wheat
CN103172716A (en) Heat-resistant plant gene and application thereof
CN113637059A (en) Application of GhTLP19 protein in regulation and control of cotton verticillium wilt-resistant bacteria and method for regulating and controlling cotton verticillium wilt-resistant bacteria
CN114644702B (en) Tango protein, related biological material and plant breeding method
CN118325962B (en) Resistance of CaPGR gene to cucumber epidemic disease and application thereof
CN118028351B (en) Resistance of CaPP C gene to phytophthora melonis and phytophthora capsici and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant