CN104911206A - Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof - Google Patents
Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof Download PDFInfo
- Publication number
- CN104911206A CN104911206A CN201510284666.9A CN201510284666A CN104911206A CN 104911206 A CN104911206 A CN 104911206A CN 201510284666 A CN201510284666 A CN 201510284666A CN 104911206 A CN104911206 A CN 104911206A
- Authority
- CN
- China
- Prior art keywords
- ban
- gfp
- gene
- expression vector
- plant expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for obtaining transgenic alfalfa and a special expression vector thereof. A plant expression vector is a condensed tannin synthetase BAN gene plant expression vector CPB-BAN-GFP with green fluorescent protein (GFP) marker genes and herbicide resistant bar genes, and a construction method of the condensed tannin synthetase BAN gene plant expression vector CPB-BAN-GFP is provided. The beneficial effects are that the BAN genes in the vector are from Onobrychis viciaefolia, and condensed tannin synthetase BAN genes are separated and cloned from the Onobrychis viciaefolia; the bar genes are added to the constructed vector, so that the double-marker genes with a herbicide resisting property and a gene marking function are obtained and the efficiency of screening transgenic plants is greatly improved. Through the transgenic plants transformed through the vector, production cost increase caused by adoption of a large amount of adopted herbicide can be avoided, and the pressure of environmental pollution can be reduced; meanwhile, the content of condensed tannin in forage can be increased and finally new pasture cultivars with the advantages of resisting herbicide and tympany can be cultivated.
Description
Technical field
The present invention relates to a kind of method and the dedicated expression vector therefor CPB-BAN-GFP thereof that obtain transgenic alfalfa.
Background technology
Sainfoin (Onobrychis viciaefolia) is pulse family donkey Macroptilium perennial herb, also known as sainfoin, donkey beans, be good palatability and the good forage be of high nutritive value, be described as " herbage queen " [(1) Bao Guirong, Deng. National University of the Inner Mongol's journal (natural science edition), 2011,6 (25): 640-642; (2) Li Suqun, etc. Acta Prataculture, 1993,6 (2): 52-55.]。Sainfoin is at each growth period, all hoove prophylactic agent can be produced in blade---condensed tannin (CT), it can make soluble protein condense, and after ruminant domestic animal searches for food sainfoin, can prevent protein under the effect of rumen microorganism, the hoove that violent decomposition produces gas and occurs, add the content of rumen bypass protein, [Li Suqun, etc. Acta Prataculture to improve the nutritive value of herbage simultaneously, 1993,6 (2): 52-55.]。Condensed tannin biosynthetic pathway is a comparatively complicated process, multiple enzyme is had to participate in its anabolism, wherein cyanidin(e) reductase enzyme (the Anthocyanidin reductase of BANYULS (BAN) genes encoding, ANR) be key enzyme [the Xie D.Y. in this route of synthesis later stage, et al.Science 2003,299 (5605): 396.], the expression level of regulation and control BAN gene can change the accumulation of CT.BAN gene is first separated in Arabidopis thaliana and verify, in tobacco and Arabidopis thaliana, this gene of overexpression all causes a large amount of accumulation of tannin and the minimizing of cyanidin(e) synthesis, may be influenced each other between cyanidin(e) and tannin route of synthesis in hint plant [De-Yu Xie, et al.Archives of Biochemistry and Biophysics, 2004,422 (1) 91-102].Up-to-date research finds, the overexpression apple MdANR gene inhibition expression of DFR and CHI gene in tobacco, the remarkable decline causing anthocyanidin to synthesize, simultaneously tannin monomer---the content of catechin and l-Epicatechol all significantly increases [Han YP, et al.First published online January 20,2012], this illustrates that MdANR can not only affect tannin route of synthesis upstream gene and express, but also possibility catalysis catechin and l-Epicatechol two route of synthesis simultaneously.
Bar (the bialaphos resistance gene) gene of anti-broad-spectrum herbicide grass fourth phosphine have good antiweed resistance [(1) Meng Lingzhen etc. Xinjiang Agricultural Univ's journal] .2013,36 (4): 265-268; (2) De Block M, et al.EMBO J, 1987,6 (9): 2513-2518; Yang Zhu equality, biotechnology and sustainable agriculture [M]. Shanghai: Shanghai scientific and technical literature press, 2000.], both for insect pest of the plant and a large amount of negative impact using weedicide to bring to plant, the manpower and financial resources that can be reduced in again in agriculture production had dropped into.Bar gene is also one of conventional selectable marker gene, is building up in identical carrier by it and other goal gene, adds certain amount and just can screen transformant containing goal gene in Selective agar medium.Which overcome the limitation of antibiotic-screening, the false transformant that cell produces is little.
Green fluorescent protein (Green fluorescent protein, GFP) be the bioluminescent protein that a class is present in the coelenterates bodies such as jellyfish, hydra and coral, without the need to adding any substrate and cofactor again, at ultraviolet or blue-light excited lower just energy transmitting green fluorescence [Yang Mingyu etc., food and biotechnology journal, 2008,3,27 (2).]。As gene Selection, GFP mainly contains 2 effects in plant: the expression of monitoring gene and the location of protein; And as the molecule marker of transgenic plant, effect [Jim H, Brad A.Technical Focus, 1995,8 (11): 10-11 of GUS can be replaced.]。GFP is used for detecting transgene efficiency as selectable marker gene, after being connected to the promotor of goal gene, just can be detected the expression level of this gene by the fluorescence intensity measuring GFP.As the reporter molecules GFP of transfer-gen plant, maximum advantage is, the direct imaging when not broken garland cells and chemical staining, detects very convenient [Chalfie M, et al.Science, 1994, (263): 802-805.]。
At present, report that clone obtains an ANR gene (the ANR gene of BAN coding from alfalfa " No. 1, middle lucerne " young fruit, i.e. BAN gene), construct the expression vector pCAMBIA1302-MsANR-GFP of MsANR gene, by this expression vector by Agrobacterium-mediated transformation Arabidopis thaliana.Transfer-gen plant is carried out to the content detection of condensed tannin, its content is apparently higher than adjoining tree.([1] Wang Xuemin etc., Chinese Grassland journal .2012, (34), 2:8-15; [2] Dong Jie, in alfalfa condensed tannin route of synthesis, DFR with ANR gene is separated and genetic transformation (Ph D dissertation, 2012)).The expression vector pCAMBIA1302-MsANR-GFP built has GFP marker gene, facilitates screening transgenic plant, and its ANR gene source is in alfalfa.Sainfoin condensed tannin content is far away higher than alfalfa, and this may be relevant with ANR gene expression difference between the two.At present, the construction strategy with the condensed tannin synthetic enzyme BAN gene plant expression vector of GFP marker gene and antiweed bar gene has no relevant report.
Summary of the invention
Object of the present invention is exactly for above-mentioned defect of the prior art, provides a kind of method and the dedicated expression vector therefor CPB-BAN-GFP thereof that obtain transgenic alfalfa.
To achieve these goals, technical scheme provided by the invention is: for obtaining a kind of plant expression vector of transgenic alfalfa, and described plant expression vector is the condensed tannin synthetic enzyme BAN gene plant expression vector CPB-BAN-GFP with green fluorescent protein GFP marker gene and antiweed bar gene.
Second object of the present invention there is provided the construction process of the above-mentioned plant expression vector for obtaining a kind of transgenic alfalfa, comprises the following steps:
1) clone of sainfoin anthocyanin reductase BAN gene:
Gansu sainfoin blade is selected to extract RNA and purifying RNA, reverse transcription synthesis cDNA first chain, pcr amplification BAN gene; The amplified production of recovery is connected to carrier T transformation of E. coli competence; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking; Sequencing result is carried out homogeneous assays; Determine condensed tannin synthetic enzyme BAN gene, obtaining recon is: pMD-BAN;
2) subclone of green fluorescent protein GFP gene:
Single bacterium colony (acquisition of pBI121-Lyz-GFP bacterial strain of picking pBI 121-Lyz-GFP bacterial strain, can see " structure of pBI121-Lyz-GFP expression vector and with the conversion in the alfalfa callus of field ", Chai Yanwen etc., " the biological journal of agrotechnique " 05 phase in 2008), shake bacterium, extract plasmid, pcr amplification GFP gene, transformation of E. coli competence after the GFP object fragment reclaimed is connected with carrier T; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking, and obtaining recon is: pMD-GFP;
3) structure of CPB-BAN-GFP plant expression vector and qualification:
BamH I and Sma I double digestion are carried out to pMD-GFP, cuts GFP gene; Sma I and Sac I double digestion are carried out to pMD-BAN, cuts BAN gene; BamH I and Sac I double digestion are carried out to support C PB, passes through T
4dNA ligase will have carrier and the gene of sticky end, 16 DEG C of connections of spending the night, connect product conversion competence E.coli DH5 α, select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, obtains CPB-BAN-GFP plant expression vector.
3rd object of the present invention there is provided a kind of method obtaining transgenic alfalfa, be that above-mentioned CPB-BAN-GFP plant expression vector is imported in clover by agrobacterium-mediated transformation, obtain having antiweed character and the high transgenic alfalfa of condensed tannin content.
Further, the method of a kind of transgenic alfalfa of above-mentioned acquisition, adopt freeze-thaw method to be converted in the competent cell of agrobacterium tumefaciens lba4404 by plant expression vector CPB-BAN-GFP, coat on the YEB solid medium containing kantlex, Rifampin and Streptomycin sulphate, 28 DEG C of constant temperature culture 2d, the positive single bacterium colony of picking, carries out PCR qualification.
Further, the concrete operations of recombinational agrobacterium transform alfalfa are comprised the following steps by the method for a kind of transgenic alfalfa of above-mentioned acquisition:
A) seed disinfection and culture condition:
Select the seed of mature and plump, tap water soaking at room temperature 4h, with 70% alcohol-pickled 2min in Bechtop, aseptic water washing 3 times, soak 10min with the mercuric chloride of 0.1% again, aseptic water washing 5 times, blots the moisture on seed with aseptic filter paper, be inoculated in MS substratum, cultivate about 7 ~ 10d in 25 DEG C;
B) preparation of acceptor material:
In the culture dish that autoclaving is crossed, put into 2 ~ 3 aseptic filter papers, add appropriate YEB liquid nutrient medium and make it moistening, eugonic alfalfa hypocotyl is cut into the segment of 0.3 ~ 0.5cm;
C) cultivation of bacterial strain:
Single for the bacterial classification transfering loop picking Agrobacterium of preservation bacterium colony method of scoring is inoculated on the YEB solid medium being attached with 50 μ g/mL Kan, 25 μ g/mL Str and 25 μ g/mL Rif, with parafilm film, culture dish is sealed, and be inverted in 28 DEG C of thermostat containers and cultivate 2d, treat that bacterium colony grows to be placed in 4 DEG C of refrigerators to preserve, every first quarter moon subculture once;
D) bacterium solution preparation:
Choosing the good single bacterium colony sterile toothpick of separation from the resistant panel of preserving Agrobacterium is inoculated in the YEB liquid nutrient medium (containing 50 μ g/mL Kan+25 μ g/mL Str+25 μ g/mL Rif) of 5mL, in 28 DEG C, on the constant-temperature table of 220rpm, lucifuge shaking culture is spent the night, m seq, get 500 μ L bacterium liquid in the YEB liquid nutrient medium (containing 50 μ g/mL Kan+25 μ g/mL Str) of 20mL, 28 DEG C, 250rpm shakes bacterium to growing logarithmic phase (OD
600value is about about 0.3 ~ 0.5), collect bacterium liquid, the centrifugal 2min of 10000r/min, abandons supernatant, with the washing of MS liquid nutrient medium, the centrifugal 2min of 10000r/min, then use the resuspended thalline of MS liquid nutrient medium.Be and infect bacteria used thereby liquid;
E) Agrobacterium is infected and Dual culture:
The hypocotyl sheared is immersed in infecting of preparing in bacterium liquid, after infecting 10min, with sterilized water, organization material is cleaned up, blotted by water with aseptic filter paper, 25 DEG C of dark Dual culture 3d, are transferred to light culture 25d in callus induction substratum, proceed to division culture medium, carry out differentiation and regeneration cultivation.
The PCR of transgenosis callus detects:
Transgenic calli STb gene is extracted by CTAB method, as template, with the special primer of BAN gene, pcr amplification BAN gene.PCR reaction system (25 μ L) comprises cDNA 1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP 2 μ L, primer P
1and P
2(10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Response procedures is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 1min, 57 DEG C of annealing 1min, 72 DEG C extend 1.5min, 38 circulations; 72 DEG C extend 10min; 4 DEG C of preservations.PCR primer detects in 1% agarose gel electrophoresis.
P
1：ATGGCCACCAATACGAAGCAATTC；
P
2：TTAGTTCTTCAGGGCCCCCTTAGTC。
The GFP fluoroscopic examination of transgenosis callus:
Get transgenic calli and carry out compressing tablet.Callus is placed in slide glass central authorities, drips clear water, covered, beat gently with pencil stub.After carrying out compressing tablet, under OLYPUSBX 51/BX 52 type fluorescent microscope, use blue-light excited transgenic calli, observe and take a picture.
Transgenosis callus antiweed Resistance Identification:
By the blade inoculation of transfer-gen plant to containing on the MS substratum of different concns (1-5mg/L) PPT weedicide, do resistance screening contrast with the regeneration plant blade of tissue culture acquisition.Observe resistance clone regeneration plant to the resistance of different concns PPT.
Transgenosis callus condensed tannin content detection:
N-butyl alcohol-hydrochloric acid method is adopted to measure the condensed tannin content of transgenic alfalfa callus.
Key problem in technology point of the present invention and wish protection point build the condensed tannin synthetic enzyme BAN gene plant expression vector CPB-BAN-GFP with GFP and antiweed bar gene; the expression vector built is imported in clover by agrobacterium-mediated transformation; convenient, fast when detecting transfer-gen plant; without the need to dyeing; do not destroy cellularstructure; only need ultraviolet or blue-light excited under, come the expression of monitoring gene and the location of protein by the fluorescence intensity measuring GFP.In Selective agar medium, add certain amount weedicide just can screen transformant containing goal gene.Which overcome the limitation of antibiotic-screening, the false transformant that cell produces is little.This expression vector contains antiweed bar gene and condensed tannin synthetic enzyme BAN gene, import alfalfa variety simultaneously, be intended to cultivate the excellent transgenic alfalfa new variety with antiweed and high condensation tannin content, so both can reduce a large amount of use agricultural chemicals pollution on the environment, the content of condensed tannin in herbage can be improved again, further the generation of prevention animal hoove.
Beneficial effect of the present invention is: the present invention is separating clone condensed tannin synthetic enzyme BAN gene from condensed tannin content high plant-sainfoin, build the condensed tannin synthetic enzyme BAN gene plant expression vector CPB-BAN-GFP with green fluorescent protein GFP marker gene and antiweed bar gene, utilize genetic engineering technique, plan anti-herbicide gene and condensed tannin gene imports clover simultaneously, cultivate and there are antiweed character and the higher transgenic alfalfa new variety of condensed tannin content, so both can reduce the use of weedicide, alleviate a large amount of use agricultural chemicals pollution on the environment, the content of condensed tannin in herbage can be improved again, finally cultivate the herbage new variety with antiweed and anti-hoove advantage.
BAN gene source in carrier of the present invention in sainfoin, separating clone condensed tannin synthetic enzyme BAN gene from sainfoin, and build carrier add bar gene, both there is antiweed character, there is again the function of marker gene.Therefore the carrier that the present invention builds possesses double-tagging gene, greatly can improve the efficiency of screening transgenic plant.Antiweed feature will be obtained by the transfer-gen plant of vector of the present invention, and can avoid like this using a large amount of weedicide and the production cost that causes improves, the pressure of environmental pollution can be reduced again.
Accompanying drawing explanation
Fig. 1 is Gansu red bean blade of grass Total RNAs extraction result figure.
Wherein, swimming lane 2,3 is Gansu red bean blade of grass total serum IgE.
Fig. 2 is the PCR qualification result figure (≈ 1kb) of BAN positive colony.
Wherein, swimming lane M is Marker-D, and swimming lane 1,2 is BAN gene.
Fig. 3 is BAN positive colony double digestion (Smal I+Sac I) qualification result figure (≈ 1kb).
Wherein, swimming lane M is DL1000Marker, and swimming lane 2 is BAN positive colony Smal I+Sac I double digestion product.
Fig. 4 is Gansu sainfoin BAN genetic sequence map, as shown in sequence in sequence table 1.
Fig. 5 is GFP delayed plasmid PCR qualification result figure.
Wherein, swimming lane 4 is DL1000Marker, and swimming lane 1,2,3 is GFP gene (≈ 750bp).
Fig. 6 is the delayed plasmid double digestion of GFP (BamH I+Smal I) qualification result figure.
Wherein, swimming lane 1 is DL1000Marker, and swimming lane 2,3 is delayed plasmid double digestion qualification (BamH I+Smal I, ≈ 750bp) of GFP.
Fig. 7 is GFP gene sequencing result figure, as shown in sequence in sequence table 2.
Fig. 8 is restructuring plasmid PCR and double digestion qualification result figure.
Wherein, swimming lane 1,5 is DL2000Marker, swimming lane 2 is BamH I and Smal I double digestion result (714bp), swimming lane 3 is Smal I+Sac I double digestion result (1020bp), swimming lane 4 is BamH I+Sac I double digestion result (1734bp), and swimming lane 6 is pcr amplification product (1020bp), and swimming lane 7 is pcr amplification product (714bp).
Fig. 9 is the PCR qualification result figure that expression vector imports Agrobacterium.
Wherein, swimming lane 1,2,3 is the PCR result (≈ 750bp) of amplification GFP gene, and swimming lane 4,5,6 is the PCR result (≈ 1kb) of amplification BAN gene, and swimming lane 7 is Marker (DL2000, the precious biotech firm in Dalian).
Figure 10 is that the PCR turning BAN gene clover callus detects.
Wherein swimming lane 1,15 is DL2000Marker, and swimming lane 2 is negative control, and swimming lane 3 is water, and swimming lane 4 is positive control, and swimming lane 7 ~ 14 is the PCR result of transgenic alfalfa callus.
Figure 11 is that transgenosis callus GFP gene by fluorescence is expressed.
Figure 12 is vector construction schematic diagram.
Embodiment
Embodiment 1:
1, the extraction of sainfoin total serum IgE:
Be rich in the feature of polyphenol, polysaccharide and secondary metabolite for sainfoin, get the fresh tender tissue of Gansu sainfoin plant, adopt CTAB legal system for RNA crude extract, and be further purified the RNA extracted, find out a kind of extracting method of applicable sainfoin total serum IgE.Present method is combined with RNA to prevent secondary metabolite mainly through adding 4%PVP in Extraction buffer; Add 2% beta-mercaptoethanol to reduce the interference of polyphenol substance; Utilize water-saturated phenol, chloroform, isoamyl alcohol extraction to remove DNA, albumen and the colors such as chlorophyll, anthocyanidin to the interference of RNA, both saved experimental cost, and reduced again the probability of RNA degraded, improve the quality of RNA.By using LiCl selective precipitation RNA, RNA is effectively separated with polysaccharide.Purifying is carried out to the total serum IgE crude extract obtained, decreases the interference of polyphenol, secondary metabolite and pigment, improve concentration and the purity of RNA; Otherwise follow-up post transcription cloning is seriously suppressed, goal gene can not be obtained.
1.1, CTAB method slightly carries total serum IgE:
(1) get 0.1g sainfoin material in the mortar of precooling, add liquid nitrogen freezing grind into powder, and transfer in the centrifuge tube of 1.5ml;
(2) by the Extraction buffer 600 μ L of 65 DEG C of preheatings, join 1.5ml containing in the centrifuge tube of vegetable material, concuss 1min, guarantees the abundant cracking of vegetable material, 65 DEG C of temperature bath 10min, period concussion 2 ~ 3 times; Described RNA Extraction buffer is 2%CTAB (W/V), 4%PVP (W/V), 100mmol/L Tris-HCl (pH 8.0), 25mmol/L EDTA (pH 8.0), 1.4mol/L NaCl, use before add 2% beta-mercaptoethanol (W/V);
(3) the centrifugal 10min of 12000r/min at 4 DEG C; Get supernatant liquor, add 600 μ L water-saturated phenols: chloroform: primary isoamyl alcohol (25:24:1), concussion mixing, place 10min for-20 DEG C; The centrifugal 10min of 12000r/min at 4 DEG C;
(4) be transferred to by supernatant liquor in another new 1.5ml centrifuge tube, repeating step (3) once;
(5) get supernatant liquor, after adding the 10mol/L LiCl mixing of 1/3 volume, place 3h in-20 DEG C of refrigerators, the centrifugal 20min of 12000r/min at 4 DEG C;
(6) supernatant liquor is abandoned, be precipitated and dissolved in 500 μ L DEPC dH2O water, add the 3mol/L NaAC (pH 5.2) of 1/10 volume, the precooling dehydrated alcohol of 2.5 times of volumes is added after abundant dissolving, mixing,-70 DEG C of process 30min, at 4 DEG C, the centrifugal 10min of 12000r/min, abandons supernatant liquor;
(7) with 70% washing with alcohol once, the centrifugal 5min of 12000r/min at 4 DEG C;
(8) repeating step (7) once, sucks residual ethanol as far as possible;
(9) abandon supernatant liquor, after air-dry under being deposited in room temperature, obtain the crude extract of RNA, add 50 μ L DEPC dH
2o dissolves RNA, saves backup in-80 DEG C of refrigerators.
1.2, the purifying of total serum IgE:
(1) total serum IgE crude extract above-mentioned steps prepared adds 450 μ L DEPC dH2O and dissolves, and adds isopyknic water-saturated phenol: chloroform: primary isoamyl alcohol (25:24:1), concussion mixing, the centrifugal 20min of 12000r/min at 4 DEG C;
(2) get supernatant liquor, add the 3mol/L NaAC (pH 5.2) of 1/10 volume, the precooling dehydrated alcohol of 2.5 times of volumes, mixing ,-70 DEG C of process 30min, at 4 DEG C, the centrifugal 20min of 12000r/min, abandons supernatant liquor;
(3) with 70% washing with alcohol twice, the centrifugal 5min of 12000r/min at 4 DEG C;
(4) abandon supernatant liquor, be deposited in Bechtop and after drying, add 50 μ L DEPC dH
2o fully dissolves, and saves backup in-80 DEG C of refrigerators.
1.3, total serum IgE quality examination:
(1) total serum IgE purity and Concentration Testing:
Get 1 μ L RNA sample, measure OD in Merinton micro-spectrophotometer
260, OD
280, OD
260/ OD
280, RNA sample concentration (with 0.1%DEPC water for blank solution returns to zero).If OD
260/ OD
280ratio between 1.8 ~ 2.0, then illustrate that RNA inclusion-free pollutes;
(2) total serum IgE agarose gel electrophoresis detects:
Get 10 μ L RNA solution, after 1% agarose gel electrophoresis (damping fluid is 1 × tbe buffer liquid, voltage 100V) 30min, be placed in gel imaging system and take a picture.
Adopt the sainfoin total serum IgE that the method is extracted, as shown in Figure 1, purity is high, integrity good, and electrophoretic band is clear, OD
260/ OD
280value is between 1.8 ~ 2.0, and its quality can meet the requirement of subsequent molecular completely.
2, the clone of sainfoin anthocyanin reductase (BAN) gene:
2.1, PCR primer design:
Sainfoin condensed tannin synthesis key enzyme anthocyanin reductase gene (BAN) sequence is obtained from ncbi database; utilize DNAMAN software design special primer; in order to the later stage is connected on plant expression vector (support C PB contains bar gene) smoothly; add restriction enzyme site (Smal I and Sac I) and protection base at primer two ends, study for transgene expression.Primer sequence is as follows:
P
3：5'-CG
CCCGGGATGGCCACCAATACGAAGCAATTC-3'
SmalⅠ
P
4：5'-GC
GAGCTCTTAGTTCTTCAGGGCCCCCTTAGTC-3'
SacⅠ
Primer synthesis and sequencing analysis complete by Shanghai Sheng Gong bio-engineering corporation.
2.2, the synthesis of cDNA first chain: carry out according to test kit specification sheets.
2.3, RT-PCR goal gene:
With cDNA first chain of reverse transcription for template, P
3, P
4for primer, amplification BAN gene.PCR reaction system (25 μ L) comprises cDNA 1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP2 μ L, primer P
3and P
4(10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Amplification is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 1min, 57 DEG C of annealing 1min, 72 DEG C extend 1min30s, 38 circulations; 72 DEG C extend 10min, finally in 4 DEG C of preservations.
2.4, the clone of amplified production and the screening of recombinant plasmid:
Transformation of E. coli competence after the object fragment reclaimed is connected with carrier T.Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, as shown in Figure 2,3, send biotech firm to check order.Sequencing result is carried out homology by blast program on NCBI website search, BAN gene order size is 1020bp, as shown in Figure 4.Homology is carried out by blast program in NCBI website search, the homology of cloned sequence and listed sainfoin BAN gene is up to 99.41%.By this recon called after: pMD-BAN.
3, the subclone of green fluorescent protein (GFP) gene:
3.1PCR design of primers:
According to the gene order reported; use DNAMAN software design special primer; in order to the later stage is connected on plant expression vector (CPB) smoothly, add restriction enzyme site (BamH I and Smal I) and protection base at primer two ends, study for transgene expression.Primer sequence is as follows:
P
5：5'-CGC
GGATCCATGAGTAAAGGAGAAGAAC-3'
BamHⅠ
P
6：5'-GCG
CCCGGGTTTGTATAGTTCATCCAT-3'
SmaⅠ
Primer synthesis and sequencing analysis complete by Shanghai Sheng Gong bio-engineering corporation.
3.2, the preparation of GFP plasmid DNA:
Single bacterium colony of pBI121-Lyz-GFP bacterial strain that picking laboratory is preserved, is inoculated in LB liquid nutrient medium, and 37 DEG C of shaken overnight are cultivated, and extract plasmid in a small amount by alkaline lysis, be stored in after 1% agarose gel electrophoresis qualification-20 DEG C for subsequent use.
3.3, the pcr amplification of goal gene:
With pBI121-Lyz-GFP plasmid DNA for template, P
5, P
6for primer, amplification GFP gene.PCR reaction system (25 μ L) comprises cDNA1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP2 μ L, primer P
5and P
6(10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Amplification is: 94 DEG C of denaturation 4min; 95 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 10min, finally in 4 DEG C of preservations.
3.4, the clone of amplified production and the screening of recombinant plasmid:
Transformation of E. coli competence after the object fragment reclaimed is connected with carrier T.Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, as shown in Figure 5,6, send biotech firm to check order, as shown in Figure 7.By this recon called after: pMD-GFP.
4, the structure of CPB-BAN-GFP plant expression vector and qualification:
Vector construction process as shown in figure 12, is carried out BamH I+Sma I double digestion to pMD-GFP, is cut GFP gene; Sma I+Sac I double digestion is carried out to pMD-BAN, cuts BAN gene; BamH I+Sac I double digestion is carried out to support C PB, passes through T
4dNA ligase will have carrier and the gene of sticky end, 16 DEG C of connections of spending the night.Connect product conversion competence E.coli DH5 α, select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, as shown in Figure 8.
5, plant expression vector CPB-BAN-GFP transformation Agrobacterium:
Freeze-thaw method is adopted to be converted in the competent cell of agrobacterium tumefaciens lba4404 by plant expression vector CPB-BAN-GFP (containing bar gene), coat on the YEB solid medium containing kantlex, Rifampin and Streptomycin sulphate, 28 DEG C of constant temperature culture 2d, the positive single bacterium colony of picking, carry out PCR qualification, as shown in Figure 9.
6, recombinational agrobacterium transform alfalfa:
Get containing the Agrobacterium LBA4404 for examination plasmid CPB-BAN-GFP, at the flat lining out of YEB containing 50 μ g/mL Kan, 25 μ g/mL Str and 25 μ g/mL Rif, after 28 DEG C of cultivation 2d, the access of picking list bacterium colony is containing in corresponding antibiotic YEB liquid nutrient medium, and 28 DEG C of shaking culture are spent the night.
Get the hypocotyl of sweet agriculture No. 3 alfalfa aseptic seedling, with the Agrobacterium (OD of above-mentioned activation
600value is 0.4 ~ 0.5) infect 10min, with sterilized water, organization material is cleaned up, with aseptic filter paper, water is blotted, the callus induction substratum containing 50mg/L Kan, 300mg/L Cef is proceeded to after Dual culture 3d, after light culture 25d, proceed to containing 50mg/L Kan+250mg/L Cef+3mg/L PPT division culture medium, carry out differentiation and regeneration cultivation.
Time of infection: 10min;
The Dual culture time: 3d;
Dual culture substratum: MS+2.0mg/L 2,4-D;
Callus induction substratum: MS+2.0mg/L 2,4-D+0.5mg/L KT;
Differentiation culture substratum: MS+2.0mg/L 6-BA+0.5mg/L NAA;
Kan Selective Pressure: 50mg/L.
7, the PCR of transgenic calli detects:
Get callus 0.1g, extract genomic dna, as template, according to BAN gene design specific amplification primer P by CTAB method
1,p
2, amplification BAN gene.PCR reaction system (25 μ L) comprises DNA 1 μ L, 10 × Buffer 2.5 μ L, 10mmol/L dNTP 2 μ L, primer P
1and P
2(10pmol/ μ L) each 1 μ L, 5U/ μ L Taq enzyme 0.5 μ L.Amplification is: 94 DEG C of denaturation 4min; 94 DEG C of sex change 1min, 57 DEG C of annealing 1min, 72 DEG C extend 1min30s, 38 circulations; 72 DEG C extend 10min, finally in 4 DEG C of preservations.PCR primer detects in 1% agarose gel electrophoresis.
After testing, in the callus obtained after screening and culturing, major part is transgenosis callus.As seen from the figure, 8 strains are had to obtain the BAN gene fragment of about 1000bp in the 10 strain kanamycin-resistant callus tissues chosen, as shown in Figure 10.Illustrate that the goal gene transformed has been incorporated in Genomic DNA.
8, the GFP fluoroscopic examination of transgenic calli:
Get transgenic calli and carry out compressing tablet.Callus is placed in slide glass central authorities, drips clear water, covered, beat gently with pencil stub.After carrying out compressing tablet, under OLYPUSBX 51/BX 52 type fluorescent microscope, use blue-light excited transgenic calli, observe and take a picture.
Alfalfa callus after testing containing recombinant plasmid presents green fluorescence under fluorescent microscope, as shown in figure 11, illustrates that GFP gene obtains high expression in alfalfa callus.
9, transgenic calli antiweed Resistance Identification:
Be inoculated into by transgenic calli on the MS substratum containing different concns (1-5mg/L) PPT, the regeneration plant blade obtained with tissue culture does resistance screening contrast.Observe resistance clone regeneration plant to the resistance of different concns PPT.
Bar gene not only as anti-herbicide gene but also can, as marker gene, can be convenient to filter out transformant and non-transformed body.In transformation and selection substratum, add appropriate PPT be beneficial to and filter out transfer-gen plant.This research finds, transgenosis callus is inoculated on the MS substratum containing lower concentration PPT (1mg/L, 2mg/L), more weak on callus impact.When PPT concentration is 3mg/L, part clover callus is suppressed, and brownization occurs.When PPT concentration reach 4,5mg/L time, the alfalfa callus growth of cultivating 20d later is subject to obvious suppression, and along with the prolongation of incubation time, brownization is serious, and callus growth is subject to serious suppression, even dead.Therefore, PPT concentration selects 3mg/L.
10, transgenic calli condensed tannin content detection:
N-butyl alcohol-hydrochloric acid method is adopted to measure transfer-gen plant condensed tannin content.
A) condensed tannin extracts: sample thief 0.5g, liquid nitrogen grinding is powdered, add 3mL pycnogenols extracting solution (70% acetone (v/v) containing 0.5% acetic acid) and be ground to homogenate, shaking table lixiviate 20min, under 5000r/min, centrifugal 10min, gets supernatant liquor, and precipitation 3mL extracting solution cleans 2 times, merge supernatant liquor, and be settled to 10mL; Draw 2mL supernatant liquor add 2mL water and 2mL trichloromethane and after fully shaking up under 5000r/min centrifugal 10min remove chlorophyll (in triplicate); Supernatant liquor is solubility condensed tannin extracting solution, and throw out is insoluble condensed tannin.
B) detection of solubility condensed tannin: get solubility condensed tannin extracting solution 0.5mL, add 3mL95% n-butyl alcohol-hydrochloric acid (95:5, v/v), 95 DEG C of pyrolysis 1h, detects 550nm and 600nm absorption value after the cooling of pyrolysis solution room temperature.
C) detection of insoluble condensed tannin: taking precipitate, adds 3mL95% n-butyl alcohol-hydrochloric acid, 95 DEG C of pyrolysis 1h, and after room temperature cooling, the centrifugal 10min of 5000r/min, detects supernatant liquor 550nm and 600nm absorption value.
Total condensed tannin is counted with solubility condensed tannin and insoluble condensed tannin content sum.
Content=(graticule value * extracting solution cumulative volume * extension rate)/(when fresh weight * measures injection volume * 1000)
Result shows, and the content being integrated with condensed tannin in the alfalfa callus of BAN gene, higher than contrast 20.2%, proves that the heterogenous expression of BAN gene facilitates the accumulation of alfalfa pycnogenols.The BAN gene plant expression vector that further this test of proof builds may be used for the germplasm innovation research improving clover CT content.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Sequence table
<110> Gansu Agriculture University
<120> mono-kind obtains method and the dedicated expression vector therefor CPB-BAN-GFP thereof of transgenic alfalfa
<210> 1
<211> 1020
<212> DNA
<213> Gansu sainfoin BAN gene order
<400> 1
atggccacca atacgaagca attcggaaag aagaaggcat gtgtgattgg tgggactggc 60
tttatggctt ctttgctcat caagcagttg cttcaaaagg gttatgttgt caataccacc 120
gttagagacc cagataatca taagaaaata tctcacctgg tggcacttca aagtttgggg 180
gaattgaata taatgggagc agaactaaca gctgaaaaag attttgatgc ccccatagca 240
ggttgtgaac ttgttttcca acttgccaca cctgtgaact ttgcttcaga agatccagag 300
aatgacatga tcaagcctgc aatcaaaggt gtattgaatg tgttgaaagc atgtgcgaga 360
gcaaaagaag tgaaacgagt cgtcttaaca tcttcagcag ctgctgtgac tataaatgaa 420
ctcaaaggaa ctggtttggt tatggatgaa agcaactggt ctgatataga gttcctgaac 480
actgcaaagc cacctacttg gggatatccc gcctccaaag cactagctga gaaagctgca 540
tggaaatttg ctgaagaaaa taacattgat ctaatcactg tgataccaac tctaacaacc 600
ggtccttctc tcactccaga tatcccatct agtgttggcc tcgccacttc ccttataaca 660
ggcaatgatt tcctcataaa tgctatgaaa ggaatgcagt ttttgtccgg ttcgatatcc 720
atcactcatg tggaggatat ttgccgcgca catatattcc tggcggagaa gcaatcagct 780
tctggaagat acatttgttg tgctcacaat actagtgttc ctgagcttgc aaagtttctc 840
agcaagcgat accctcagta taaaattcca actgaattcg atgattgtcc ggccaaggca 900
aagttaatac tctcatctga taagcttatc aaagaagggt tcagtttcaa gtatggtatt 960
gaagaaattt atgaccagac tgtggagtac ttgaagacta agggggccct gaagaactaa 1020
<210> 2
<211> 732
<212> DNA
<213> GFP gene order
<400> 2
cgcggatcca tgagtaaagg agaagaactt ttcactggag ttgtcccaat tcttgttgaa 60
ttagatggtg atgttaatgg gcacaaattt tctgtcagtg gagagggtga aggtgatgca 120
acatacggaa aacttaccct taaatttatt tgcactactg gaaaactacc tgttccatgg 180
ccaacacttg tcactacttt cacttatggt gttcaatgct tttcaagata cccagatcat 240
atgaaacggc atgacttttt caagagtgcc atgcccgaag gttatgtaca ggaaagaact 300
atatttttca aagatgacgg gaactacaag acatgtgctg aagtcaagtt tgaaggtgat 360
acccttgtta atagaatcga gttaaaaggt attgatttta aagaagatgg aaacattctt 420
ggacacaaat tggaatacaa ctataactca cacaatgtat acatcatggc agacaaacaa 480
aagaatggaa tcaaagttaa cttcaaaatt agacacaaca ttgaagatgg aagcgttcaa 540
ctagcagacc attatcaaca aaatactcca attggcgatg gccctgtcct tttaccagac 600
aaccattacc tgtccacaca atctgccctt tcgaaagatc ccaacgaaaa gagagaccac 660
atggtccttc ttgagtatgt aacagctgct gggattacac atggcatgga tgaactatac 720
aaacccgggc gc 732
Claims (5)
1. for obtaining a kind of plant expression vector of transgenic alfalfa, it is characterized in that, described plant expression vector is the condensed tannin synthetic enzyme BAN gene plant expression vector CPB-BAN-GFP with green fluorescent protein GFP marker gene and antiweed bar gene.
2. the construction process of the plant expression vector for obtaining a kind of transgenic alfalfa according to claim 1, is characterized in that, comprise the following steps:
1) clone of sainfoin anthocyanin reductase BAN gene:
Gansu sainfoin blade is selected to extract RNA and purifying RNA, reverse transcription synthesis cDNA first chain, pcr amplification BAN gene; The amplified production of recovery is connected to carrier T transformation of E. coli competence; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking; Sequencing result is carried out homogeneous assays; Determine condensed tannin synthetic enzyme BAN gene, obtaining recon is: pMD-BAN;
2) subclone of green fluorescent protein GFP gene:
Single bacterium colony of picking pBI121-Lyz-GFP bacterial strain, shakes bacterium, extracts plasmid, pcr amplification GFP gene, transformation of E. coli competence after the GFP object fragment reclaimed being connected with carrier T; Select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, order-checking, and obtaining recon is: pMD-GFP;
3) structure of CPB-BAN-GFP plant expression vector and qualification:
BamH I and Sma I double digestion are carried out to pMD-GFP, cuts GFP gene; Sma I and Sac I double digestion are carried out to pMD-BAN, cuts BAN gene; BamH I and Sac I double digestion are carried out to support C PB, passes through T
4dNA ligase will have carrier and the gene of sticky end, 16 DEG C of connections of spending the night, connect product conversion competence E.coli DH5 α, select positive colony and shake bacterium, adopt and insert inactivation, the screening of delayed plasmid, plasmid PCR amplification, restriction endonuclease map is identified, obtains CPB-BAN-GFP plant expression vector.
3. obtaining a kind of method of transgenic alfalfa, is imported in clover by agrobacterium-mediated transformation by CPB-BAN-GFP plant expression vector according to claim 1, obtains having antiweed character and the high transgenic alfalfa of condensed tannin content.
4. the method for a kind of transgenic alfalfa of acquisition according to claim 3, it is characterized in that, adopt freeze-thaw method to be converted in the competent cell of agrobacterium tumefaciens lba4404 by plant expression vector CPB-BAN-GFP, coat on the YEB solid medium containing kantlex, Rifampin and Streptomycin sulphate, 28 DEG C of constant temperature culture 2d, the positive single bacterium colony of picking, carries out PCR qualification.
5. the method for a kind of transgenic alfalfa of acquisition according to claim 4, is characterized in that, the concrete operations of recombinational agrobacterium transform alfalfa is comprised the following steps:
A) get containing the Agrobacterium LBA4404 for examination plasmid CPB-BAN-GFP, rule 28 DEG C after cultivating 2d, picking list bacterium colony 28 DEG C of shaking culture are spent the night; Get next day in the YEB liquid nutrient medium of 500 μ L bacterium liquid to 20 mL, 28 DEG C, shake bacterium to OD
600value is the growth logarithmic phase of 0.3 ~ 0.5, and collect bacterium liquid, the centrifugal 2min of 10000 r/min, abandons supernatant, with the washing of MS liquid nutrient medium, and the centrifugal 2min of 10000r/min, then use the resuspended thalline of MS liquid nutrient medium, be and infect bacteria used thereby liquid; In described YEB liquid nutrient medium, containing 50 μ g/mL kantlex Kan, 25 μ g/mL Streptomycin sulphate Str and 25 μ g/mL Rifampin Rif;
B) hypocotyl of alfalfa aseptic seedling is got, what step a) obtained infect bacteria used thereby liquid infects 10min, infect and with sterilized water, organization material has been cleaned up, with aseptic filter paper, water is blotted, after Dual culture 3d, proceed to callus induction substratum, after light culture 25d, proceed to division culture medium, after differentiation and seedling emergence, then root induction, hardening, carry out follow-up Molecular Detection and physiological index determining.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510284666.9A CN104911206A (en) | 2015-05-28 | 2015-05-28 | Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510284666.9A CN104911206A (en) | 2015-05-28 | 2015-05-28 | Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104911206A true CN104911206A (en) | 2015-09-16 |
Family
ID=54080646
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510284666.9A Pending CN104911206A (en) | 2015-05-28 | 2015-05-28 | Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104911206A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350537A (en) * | 2016-08-31 | 2017-01-25 | 中国农业科学院北京畜牧兽医研究所 | Method for transforming medicago sativa by aid of galega orientalis gibberellin receptor genes GoGID |
| CN108359675A (en) * | 2018-02-27 | 2018-08-03 | 华中农业大学 | A method of obtaining double selection markers transgenic corns |
| CN108866093A (en) * | 2018-07-04 | 2018-11-23 | 广东三杰牧草生物科技有限公司 | A method of using CRISPR/Cas9 system to alfalfa site-directed point mutation |
| CN110628778A (en) * | 2019-09-18 | 2019-12-31 | 天津农学院 | Gene, protein, vector, recombinant gene engineering bacterium for accelerating fruit maturation and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102124111A (en) * | 2008-06-06 | 2011-07-13 | 格拉斯兰兹技术有限公司 | Novel genes involved in biosynthesis |
-
2015
- 2015-05-28 CN CN201510284666.9A patent/CN104911206A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102124111A (en) * | 2008-06-06 | 2011-07-13 | 格拉斯兰兹技术有限公司 | Novel genes involved in biosynthesis |
Non-Patent Citations (2)
| Title |
|---|
| 陈春艳 等: "‘甘肃红豆草’肌动蛋白基因片段的克隆及序列分析", 《甘肃农业大学学报》 * |
| 马晖玲 等: "苜蓿原生质培养及体细胞杂交技术的应用", 《草业科学》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106350537A (en) * | 2016-08-31 | 2017-01-25 | 中国农业科学院北京畜牧兽医研究所 | Method for transforming medicago sativa by aid of galega orientalis gibberellin receptor genes GoGID |
| CN108359675A (en) * | 2018-02-27 | 2018-08-03 | 华中农业大学 | A method of obtaining double selection markers transgenic corns |
| CN108866093A (en) * | 2018-07-04 | 2018-11-23 | 广东三杰牧草生物科技有限公司 | A method of using CRISPR/Cas9 system to alfalfa site-directed point mutation |
| CN108866093B (en) * | 2018-07-04 | 2021-07-09 | 广东三杰牧草生物科技有限公司 | Method for performing site-directed mutagenesis on alfalfa gene by using CRISPR/Cas9 system |
| CN110628778A (en) * | 2019-09-18 | 2019-12-31 | 天津农学院 | Gene, protein, vector, recombinant gene engineering bacterium for accelerating fruit maturation and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101265294B (en) | Disease-resistant correlated wheat MYB albumen and coding gene | |
| CN112626040B (en) | ZmRBOHB gene and application of encoding protein thereof in resistance to maize ear rot | |
| CN104911206A (en) | Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof | |
| CN113604490B (en) | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof | |
| CN104450740B (en) | A kind of alfalfa MsWRKY33 transcription factor and encoding proteins, preparation method and application | |
| CN104911205A (en) | Method for obtaining transgenic alfalfa and special expression vector CPB-LAR-GFP thereof | |
| CN100389124C (en) | Non-inducing expressing gene engineering strain and structural process and application thereof | |
| CN110358778B (en) | Application of SlDALR2 gene in improving resistance to bacterial leaf spot of tomato | |
| CN112143746A (en) | Gene GmAP5 for improving disease resistance of plants and application thereof | |
| CN107200773A (en) | Come from pathogenic gene MoSNT2 of Pyricularia oryzae and application thereof | |
| CN111205357A (en) | Wheat stripe rust resistance related protein TaWLT14.2 and coding gene and application thereof | |
| CN114941008B (en) | Application of flowering cabbage LRR receptor protein kinase gene BraEFR in downy mildew resistance | |
| CN108103042B (en) | Anti-verticillium wilt related receptor-like protein kinase GhPR5K, coding gene thereof and application thereof | |
| CN112322653B (en) | Agrobacterium-mediated genetic transformation method for Maohua chrysanthemum | |
| CN103509805B (en) | Solanum torvum StoNPR1 gene and applications thereof | |
| CN106480073A (en) | Oryza meyeriana Distributed in Yunnan Province MeXB3 gene and its application | |
| CN102140446A (en) | Application of rape iMyAP gene over-expression in sclerotinia sclerotiorum resistance of rape | |
| CN102417911B (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance | |
| CN102676468B (en) | Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 | |
| CN102703402B (en) | Feruloyl esterase PCFAE1 from Phytophthora capsici Leonian and coding gene and application thereof | |
| CN115215931B (en) | Use of protein IbC H18 related to vine cutting disease and soft rot disease or substance for regulating and controlling expression of protein IbC H18 | |
| CN111471689A (en) | Gene for improving resistance of soybean to cyst nematode disease and application thereof | |
| CN112899291B (en) | ATP synthetase of rice tip nematode and application thereof | |
| CN113584055B (en) | Pepper PNPAL3 gene and application thereof in resisting blast of peppers | |
| CN114805520B (en) | Stress resistance related protein IbGT1, encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150916 |
|
| RJ01 | Rejection of invention patent application after publication |