CN102676468B - Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 - Google Patents
Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 Download PDFInfo
- Publication number
- CN102676468B CN102676468B CN201210164062.7A CN201210164062A CN102676468B CN 102676468 B CN102676468 B CN 102676468B CN 201210164062 A CN201210164062 A CN 201210164062A CN 102676468 B CN102676468 B CN 102676468B
- Authority
- CN
- China
- Prior art keywords
- pcfae2
- sequence
- feruloyl esterase
- protein
- pepper
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and a coding gene and application of the feruloyl esterase PCFAE2. The feruloyl esterase PCFAE2 is protein represented by a), b) or c): a) protein composed of amino acid sequences shown at positions of 21-569 of a second sequence in a sequence list; b) protein composed of amino acid sequences shown in the second sequence in the sequence list; and c) protein which is obtained by subjecting the amino acid sequences shown in the second sequence in the sequence list or the amino acid sequences shown at the positions of 21-569 of the second sequence to substitution and/or deletion and/or addition of one or several amino acid residues, is associated to pathogenicity of the phytophthora capsici leonian and derives from the a). The feruloyl esterase PCFAE2, the coding gene and the application lay a technical foundation for further development on phytophthora capsici leonian molecule detection technique and prevention and research of various plant diseases resulting from the phytophthora capsici leonian.
Description
Technical field
The present invention relates to a kind of feruloyl esterase and encoding gene thereof and application, particularly from feruloyl esterase PCFAE2 and encoding gene and the application of phytophthora blight of pepper.
Background technology
Phytophthora blight of pepper (Phytophthora capsici Leonian) belongs to Mycophyta, Mastigomycotina, Oomycete, Peronosporales.Phytophthora blight of pepper is the pathogenic bacterium that a kind of host range is wide, except infecting capsicum, also infects other crop.The reports such as Zhou Qiming infect 21 kinds of cultivated plants of 9 section and weeds; The test-results such as Ren Guangchi think that this bacterium can endanger eggplant, cucumber, tomato, cowpea, Kidney bean, Chinese cabbage, wild cabbage, radish, Radix Dauci Sativae, peach, apricot, apple etc.A little less than green onion, garlic invasiveness, citrus and potato haulm, leaf are not infected.Virulence to capsicum is the strongest.
Capsicum epidemic disease is by the caused a kind of soil-borne disease of phytophthora blight of pepper (Phytophthora capsici Leonian), can propagate through number of ways such as rainwater, soil, air-flows, except causing the dead seedling of big area, also can cause that blade is withered, there is necrotic plaque in fruit rot, cane, and the multiple symptom such as dead of wilting.First Chinese is reported in Jiangsu and the generation of this disease is after this had successively relevant report the forties in 20th century, and shows as the trend increasing the weight of year by year.Since the eighties, capsicum epidemic disease generally occurs throughout the country, and Xinjiang, Beijing, Heilungkiang, Guizhou, Shanghai, Qinghai, Yunnan, Shaanxi, Gansu, Guangdong and the Yangtze valley are particularly serious.Capsicum epidemic disease is the upper a kind of worldwide destructive disease distributed more widely of pepper cultivation and production, and this disease disease cycle is short, and epidemic rate is fast, gives to produce and brings serious financial loss.The control of carrying out the plurality of plant diseases that the Isolation and Identification of phytophthora blight of pepper Disease-causing gene causes phytophthora blight of pepper in a deep going way has important practice significance with research.
Summary of the invention
An object of the present invention is to provide a kind of feruloyl esterase.
Feruloyl esterase provided by the present invention, name is called PCFAE2, derives from phytophthora blight of pepper (Phytophthora capsici) SD33, be following a) or b) or protein c):
A) protein that the aminoacid sequence shown in sequence 2 21-569 positions forms in sequence table;
B) protein that the aminoacid sequence shown in sequence 2 forms in sequence table;
C) by aminoacid sequence shown in the aminoacid sequence shown in sequence in sequence table 2 or sequence 2 21-569 positions through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to Phytophthora capsici bacteria pathogenic by a) derivative protein.
Wherein, in sequence table, sequence 2 is comprised of 569 amino-acid residues, and 1-20 amino acids forms signal peptide.A) described protein is the maturation protein of feruloyl esterase, and b) described protein is the precursor protein of feruloyl esterase.
Albumen in above-mentioned in order to make (a) is convenient to purifying, and the N-terminal of the protein that can form at the aminoacid sequence shown in sequence in sequence table 2 or C-terminal connect label as shown in table 1.
The sequence of table 1 label
| Label | Residue | Sequence |
| Poly-Arg | 5-6(is generally 5) | RRRRR |
| Poly-His | 2-10(is generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
PCFAE2 in above-mentioned (b) can first synthesize its encoding gene, then carries out biological expression and obtain.The encoding gene of PCFAE2 in above-mentioned (b) can be by lacking sequence in sequence table 1 codon of one or several amino-acid residue in the DNA sequence dna shown in 5 ' end the 1st to 1710 bit bases, and/or carry out the missense mutation of one or several base pair, and/or the encoding sequence that connects the label shown in table 1 at its 5 ' end and/or 3 ' end obtains.
The nucleic acid molecule of coding feruloyl esterase PCFAE2 also belongs to protection scope of the present invention.
Wherein, described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.
Described nucleic acid molecule specifically can be following 1) or 2) or 3) shown in gene:
1) its encoding sequence is the DNA molecular of the 61-1710 position Nucleotide of sequence 1 in sequence table;
2) its encoding sequence is the DNA molecular of the 1-1710 position Nucleotide of sequence 1 in sequence table;
3) under stringent condition with 1) or 2) DNA molecular of albumen described in the DNA molecule hybridize that limits and coding claim 1;
4) with 1) or 2) DNA molecular that limits has the DNA molecular of albumen described in more than 90% homology and coding claim 1.
Above-mentioned stringent condition can be with 6 * SSC, the solution of 0.5% SDS, and at 65 ℃, hybridization, then uses 2 * SSC, 0.1% SDS and 1 * SSC, 0.1% SDS respectively washes film once.
Wherein, the sequence 1 in sequence table is comprised of 1710 Nucleotide, the protein shown in sequence 2 in code sequence list.
Following 1) any biomaterial-4) also belongs to protection scope of the present invention:
1) expression cassette of the nucleic acid molecule that contains coding feruloyl esterase PCFAE2;
2) recombinant expression vector of the nucleic acid molecule that contains coding feruloyl esterase PCFAE2;
3) recombinant microorganism of the nucleic acid molecule that contains coding feruloyl esterase PCFAE2;
4) transgenic cell line of the nucleic acid molecule that contains coding feruloyl esterase PCFAE2.
In above-mentioned biomaterial, 1) expression cassette of the described nucleic acid molecule that contains coding feruloyl esterase PCFAE2, refer to the DNA that can express feruloyl esterase PCFAE2 in host cell, this DNA not only can comprise the promotor that starts feruloyl esterase PCFAE2 genetic transcription, also can comprise and stop the terminator that feruloyl esterase PCFAE2 transcribes.Further, described in, contain feruloyl esterase PCFAE2 expression cassette and also can comprise enhancer sequence.2) recombinant expression vector of the described nucleic acid molecule that contains coding feruloyl esterase PCFAE2 specifically can be in the multiple clone site of carrier pGR106 and inserts the recombinant expression vector that feruloyl esterase PCFAE2 encoding gene obtains.3) described recombinant microorganism specifically can be yeast, bacterium, algae and fungi.4) described transgenic cell line does not comprise the reproductive material of plant.
Another object of the present invention is to provide a kind of method of preparing feruloyl esterase PCFAE2.
The method of preparing feruloyl esterase PCFAE2 provided by the present invention, comprises feruloyl esterase PCFAE2 encoding gene is expressed to the step that obtains feruloyl esterase in biomass cells; Described biomass cells can be microorganism cells, vegetable cell or non-human animal's cell.
A further object of the present invention is to provide a kind of method of preparing the recombinant microorganism of expressing feruloyl esterase PCFAE2.
The method of the recombinant microorganism of feruloyl esterase PCFAE2 is expressed in preparation provided by the present invention, comprises the encoding gene of feruloyl esterase PCFAE2 is imported to host microorganism cell, obtains expressing the step of the recombinant microorganism of feruloyl esterase PCFAE2.
Wherein, described recombinant microorganism specifically can be yeast, bacterium, algae and fungi.
The nucleic acid molecule total length of amplification coding feruloyl esterase PCFAE2 or the primer pair of its arbitrary fragment also belong to protection scope of the present invention.
Feruloyl esterase PCFAE2 is in the application as in feruloyl esterase, and the application of the biomaterial of the nucleic acid molecule of coding feruloyl esterase PCFAE2 or the nucleic acid molecule that contains coding feruloyl esterase PCFAE2 in preparing feruloyl esterase also belongs to protection scope of the present invention.
The application of feruloyl esterase PCFAE2 in regulation and control Phytophthora capsici bacteria pathogenic also belongs to protection scope of the present invention.Wherein, described regulation and control Phytophthora capsici bacteria pathogenic comprises the steps: the expression of feruloyl esterase PCFAE2, or the transcribing of the encoding gene of regulation and control feruloyl esterase PCFAE2.The expression of described regulation and control feruloyl esterase PCFAE2 specifically can be the expression level of raising feruloyl esterase PCFAE2 to improve Phytophthora capsici bacteria pathogenic, or the expression level that reduces feruloyl esterase PCFAE2 is to reduce Phytophthora capsici bacteria pathogenic.
Following method of take the evaluation phytophthora blight of pepper sterilant that feruloyl esterase PCFAE2 or its encoding gene be target spot also belongs to protection scope of the present invention.
The method that this identifies phytophthora blight of pepper sterilant, comprise following a)-e) in arbitrary step:
A) identify whether described material to be detected suppresses the expression of feruloyl esterase PCFAE2, as described in determinand mass-energy suppress the expression of feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is candidate; As described in test substance can not suppress to weigh the expression of feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is non-candidate;
B) identify whether described material to be detected reduces the expression level of feruloyl esterase PCFAE2, as described in determinand mass-energy reduce the expression level of feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is candidate; As described in test substance can not reduce the expression level of feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is non-candidate;
C) identify whether described material to be detected suppresses the transcribing of encoding gene of feruloyl esterase PCFAE2, as described in determinand mass-energy the transcribing of encoding gene of suppressing feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is candidate; As described in test substance the transcribing of encoding gene that can not suppress feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is non-candidate;
D) identify whether described material to be detected reduces the transcriptional level of the encoding gene of feruloyl esterase PCFAE2, as as described in determinand mass-energy reduce the transcriptional level of the encoding gene of feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is candidate; As described in test substance can not reduce the transcriptional level of the encoding gene of feruloyl esterase PCFAE2, the phytophthora blight of pepper sterilant that described test substance is non-candidate;
E) identify whether described material to be detected makes feruloyl esterase PCFAE2 inactivation, as described in determinand mass-energy make feruloyl esterase PCFAE2 inactivation, the phytophthora blight of pepper sterilant that described test substance is candidate; As described in test substance can not make feruloyl esterase PCFAE2 inactivation, the phytophthora blight of pepper sterilant that described test substance is non-candidate.
Have following 1)-5) in the application in preparing phytophthora blight of pepper sterilant of the material of at least one function also belong to protection scope of the present invention:
1) suppress the expression of feruloyl esterase PCFAE2;
2) encoding gene of inhibition feruloyl esterase PCFAE2 transcribes;
3) reduce the expression level of feruloyl esterase PCFAE2;
4) reduce the transcriptional level of the encoding gene of feruloyl esterase PCFAE2;
5) make feruloyl esterase PCFAE2 inactivation.
Experimental results show that, feruloyl esterase PCFAE2 gene has effectively participated in the process that phytophthora blight of pepper infects host and causes the capsicum epidemic disease course of disease to occur, be an important Disease-causing gene of phytophthora blight of pepper, the present invention provides technical foundation for control and the research of the plurality of plant diseases that further development Phytophthora capsici germ molecular detection technology, phytophthora blight of pepper cause.
Accompanying drawing explanation
Fig. 1 is PCFAE2 transient expression photo in Pepper Leaves.
In figure, A: restructuring Agrobacterium pGR106-PCFAE2/GV3101; B: restructuring Agrobacterium pGR106/GV3101; C: distilled water.
Fig. 2 is PCFAE2 transient expression photo in tobacco leaf.
In figure, A: restructuring Agrobacterium pGR106-PCFAE2/GV3101; B: restructuring Agrobacterium pGR106/GV3101; C: distilled water.
Fig. 3 is the relative expression quantity of PCFAE2 in pHAM34-antiPCFAE2 transformant.
In figure, A is pHAM34-antiPCFAE2 transformant, and B is SD33, and C is pHAM34 transformant.
Fig. 4 is the relative expression quantity of PCFAE2 in pHAM34-PCFAE2 transformant.
In figure, A is pHAM34-PCFAE2 transformant, and B is SD33, and C is pHAM34 transformant.
Fig. 5 is the pathogenic effect of pHAM34-antiPCFAE2 transformant to Pepper Leaves.
In figure, A is pHAM34-antiPCFAE2 transformant; B is SD33; C is pHAM34 transformant; D is sterilized water.
Fig. 6 is the pathogenic effect of pHAM34-PCFAE2 transformant to Pepper Leaves
In figure, A is pHAM34-PCFAE2 transformant; B is SD33; C is pHAM34 transformant; D is sterilized water.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
The clone of embodiment 1, feruloyl esterase PCFAE2 gene and PCFAE2's is pathogenic
1.PCFAE2 gene clone
The primer of design clone Phytophthora capsici feruloyl esterase PCFAE2 gene:
18721-FP:ATGAAAATCTCCTACGCACCCTTC；18721-RP:TTATGGCTCCATCACGGGATTG。
With Phytophthora capsici bacterial strain SD33(Shandong Agricultural University) (J.Phytopathol 157:585-591, 2009) genomic dna is as template, with above-mentioned primer, carry out pcr amplification, after amplified production is reclaimed respectively with pGEM-T Easy Vector(Promega) be connected, and transform bacillus coli DH 5 alpha, by blue hickie, screen, the enzyme of plasmid DNA is cut evaluation and screening and is gone out positive colony, the plasmid that extracts positive colony checks order, sequencing result shows, the nucleotide sequence of this PCR product is the sequence 1 in sequence table, the protein Phytophthora capsici feruloyl esterase PCFAE2 of sequence 2 in code sequence list.Wherein, in sequence table, sequence 1 is comprised of 1710 deoxynucleotides, and in sequence table, sequence 2 is comprised of 569 amino-acid residues.
2. Phytophthora capsici feruloyl esterase PCFAE2's is pathogenic
2.1 Phytophthora capsici feruloyl esterase PCFAE2 gene transient expressions are pathogenic
2.1.1 Phytophthora capsici feruloyl esterase PCFAE2 transient expression vector construction
For by clone PCFAE2 gene transient expression in Agrobacterium, according to PVX carrier pGR106, select Not I and two restriction enzyme sites of Cla I, the mature protein coding sequence of PCFAE2 (sequence of amplification is the 61-1710 position of sequence 1) is connected into the sequence 4 in carrier pGR106(sequence table).Building the required primer sequence of PVX carrier is: P-18721-FP:CC
aTCGATgACGATTGCGTTGACGCTACTGGA; P-18721-RP:ATAAGAAT
gCGGCCGCtTATGGCTCCATCACGG.Wherein, the recognition site that is restriction enzyme with the base of underscore.
Using Phytophthora capsici bacterial strain SD33 genomic dna as template, with above-mentioned primer, carry out pcr amplification, with Not I and Cla I double digestion PCR product, then be inserted between the Not I and Cla I site of pGR106, by the recombinant vectors called after pGR106-PCFAE2 through sequence verification 61-1710 position Nucleotide of insertion sequence 1 between the Not of pGR106 I and Cla I site.Utilize freeze-thaw method that pGR106-PCFAE2 is proceeded to the agrobacterium tumefaciens GV3101 Agrobacterium pGR106-PCFAE2/GV3101 that obtains recombinating.By the same way pGR106 is proceeded to agrobacterium tumefaciens GV3101 and obtain recombinating Agrobacterium pGR106/GV3101 as empty carrier control strain simultaneously.
2.1.2 transformation of tobacco and capsicum
By Agrobacterium pGR106-PCFAE2/GV3101 and the restructuring Agrobacterium pGR106/GV3101 liquid medium within (being the substratum that 50mg/ml obtains to adding kantlex and the Rifampin final concentration to the two in LB liquid nutrient medium) respectively of recombinating; at 28 ℃, 24h is cultivated in 200rpm concussion; Then centrifugal collection thalline is at equal-volume MMA (10mmol/L MgCl
2, 10mmol/L MES(2-N-morpholinyl ethyl sulfonic acid) and 100mmol/L AS(Syringylethanone) in continue inducing culture 3h.No. 6 Hot Pepper Seedlings of middle green pepper and this uncured tobacco seedling of thalline inoculation 5-6 leaf phase after induction, with needle-less 5ml asepsis injector, restructuring Agrobacterium pGR106-PCFAE2/GV3101 and restructuring Agrobacterium pGR106/GV3101 suspension are pressed into respectively in blade to all blades of inoculation except cotyledon.With distilled water (ddH
2o) process in contrast.Each is processed and repeats 3 times, and after inoculating, plant (22 ℃, 75% atmospheric moisture, dark) in incubator is cultivated 2 days, proceeds to phytotron and cultivates, inoculation rear every day of observed and recorded symptom variation.
The result Agrobacterium pGR106-PCFAE2/GV3101 transient expression in capsicum body that shows to recombinate, at the 3rd day inoculation blade, start to occur changing, the Pepper Leaves inoculation position of restructuring Agrobacterium pGR106-PCFAE2/GV3101 inoculation starts to occur yellow, these yellow parts increase the weight of gradually, form point-like brown necrotic spot at the 15th day; Along with the time changes these blade brown spots and becomes gradually greatly in flakes, leaf color becomes dark unglazed by emerald green, until finally come off gradually.As the distilled water of negative control and restructuring Agrobacterium pGR106/GV3101 inoculation blade until the observation period finishes inoculation position slightly turns to be yellow, but leaf growth is not affected (Fig. 1).Illustrate that PCFAE2 gene has pathogenic.
Restructuring Agrobacterium pGR106-PCFAE2/GV3101 transient expression symptom in Ben Shi cigarette (Nicotiana benthamiana) blade body occurs more late, in inoculation, after 7 days, occurs variable color chlorisis phenomenon.Temporal evolution, inoculation position leaf tissue color chlorisis, blade is shrinkage slightly, and anaphase blade inoculating surfaces becomes transparent, produces downright bad when serious.DdH as negative control
2o and restructuring Agrobacterium pGR106/GV3101 inoculation blade be symptom slightly, does not affect leaf growth (Fig. 2).Illustrate that PCFAE2 gene has pathogenic.
2.2 Phytophthora capsici feruloyl esterase PCFAE2 stable gene overexpressions and reticent express pathogenic
2.2.1 PCFAE2 stablizes over-express vector and reticent expression vector establishment
According to the sequence 3 in silent carrier pHAM34(sequence table) and restriction enzyme site, select Sma I restriction enzyme site design primer:
S-18721-FP：TCC
CCCGGGATGAAAATCTCCTACGCACCCTTC；S-18721-RP：TCC
CCCGGGTTATGGCTCCATCACGGGATTG。Wherein, the recognition site that is restriction enzyme with the base of underscore.
Using Phytophthora capsici bacterial strain SD33 genomic dna as template, with above-mentioned primer, carry out pcr amplification, with Sma I enzyme, cut PCR product, the pHAM34 then cutting with Sma I enzyme is connected, and will connect product cloning to escherichia coli jm109 competent cell.Through bacterium colony PCR and enzyme, cut the order-checking of checking Hou Song company, the recombinant vectors called after pHAM34-PCFAE2(over-express vector by process sequence verification at DNA fragmentation shown in the 1-1710 position of the Sma of pHAM34 I site insertion sequence 1); To pass through sequence verification at the reticent conversion carrier of the recombinant vectors called after pHAM34-antiPCFAE2(of DNA fragmentation shown in the reverse complementary sequence of the 1-1710 position of the Sma of pHAM34 I site insertion sequence 1).
2.2.2 transform phytophthora blight of pepper and prepared expression transformant and reticent transformant
By pHAM34-antiPCFAE2 and helper plasmid pHspNpt(Shandong Agricultural University) (Yonglin Wang, Daolong Dou, Xiaoli Wang, Aining Li, Yuting Sheng, Chenlei Hua, Binyan Cheng, Xiaoren Chen, Xiaobo Zheng, Yuanchao Wang.The PsCZF1 gene encoding a C2H2 zinc finger protein is required for growth, development and pathogenesis in Phytophthora sojae.Microbial Pathogenesis.2009, 47:78 – 86) transform Phytophthora capsici bacterial strain SD33, pHAM34-PCFAE2 and helper plasmid pHspNpt are transformed to Phytophthora capsici bacterial strain SD33, with pHAM34 and helper plasmid pHspNpt, transform Phytophthora capsici bacterial strain SD33 in contrast simultaneously, picking transformant, be placed in the V8 vegetable juice culture that contains G418 resistance screening and culturing again.The transformant growing is proceeded in liquid V8 vegetable juice culture to 28 ℃ of standing cultivations 3 days, obtain proceeding to pHAM34-antiPCFAE2 restructuring phytophthora blight of pepper (called after pHAM34-antiPCFAE2/SD33), proceed to the restructuring phytophthora blight of pepper (called after pHAM34-PCFAE2/SD33) of pHAM34-PCFAE2 and proceed to the restructuring phytophthora blight of pepper (called after pHAM34/SD33) of pHAM34, collect mycelia, extract transformant RNA.After reverse transcription, carry out quantitative fluorescent PCR Molecular.
PCR reaction is used primer to be:
PCFAE2 gene primer: 18721 qRT-FP:CCTGGACGCCAACAACGAAC; 18721 qRT-RP:GATACGAGGATCGCTCATCAGACC.
Actin gene primer: Actin-FP:ACTGCACGTTCCAGACGATC; Actin-RP:CCACCACCTTGATCTTCATG.Quantitative fluorescent PCR reaction system: 2.5 * SuperRealPreMix12.5 μ L, forward primer (10 μ M) 0.75 μ L, reverse primer (10 μ M) 0.75 μ L, cDNA template 2.5 μ L, RNase-free ddH
2o to 25 μ L.
Quantitative fluorescent PCR reaction conditions: 95 ℃ of sex change 10sec, 59 ℃ of annealing 20sec, 68 ℃ are extended 30sec, carry out altogether 45 circulations, prepare solubility curve for last 65-95 ℃.
Phytophthora capsici β-actin gene of take is internal reference, and each sample is done three repetitions, with 2
-△ △ Ctmethod is carried out differential expression relative quantitative assay to sample gene.△ △ Ct=(C
t target– C
t actin)
sample to be tested– (C
t target– C
t actin)
calibration samplein this research, select each gene to be expressed as calibration sample in wild-type SD33, pHAM34 transformant (pHAM34/SD33), pHAM34-antiPCFAE2 transformant (pHAM34-antiPCFAE2/SD33) and pHAM34-PCFAE2 transformant (pHAM34-PCFAE2/SD33) are respectively sample to be tested.
Result shows, in pHAM34-antiPCFAE2 transformant, the expression amount of PCFAE2 is 0.11 times of wild-type SD33; In pHAM34-PCFAE2 transformant, the expression amount of PCFAE2 is 16.90 times of wild-type SD33; In pHAM34 transformant, identical (Fig. 3 and Fig. 4) of the expression amount of PCFAE2 and wild-type SD33.
2.2.3 the biological character analysis of Phytophthora capsici PCFAE2 gene overexpression transformant and reticent transformant
To obtain cross expression transformant and reticent transformant carries out biological character analysis, comprise pathogenic, sporocyst form and quantity, zoospore output, the growth velocity variation of bacterial strain etc.
(1) colonial morphology is observed and growth rate measurment: by Phytophthora capsici wild type strain SD33, restructuring phytophthora blight of pepper pHAM34/SD33, restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 and restructuring phytophthora blight of pepper pHAM34-antiPCFAE2/SD33 cultivate on 10%V8 vegetable juice culture with the bacterium piece that punch tool is got 0.5mm size respectively, continuously switching twice, and then the onesize mycelia piece of above-mentioned bacterial strains is received and on 10%V8 vegetables juice solid plate, treated to measure for the 4th day colony radius.Each each bacterial strain of experiment repeats for three times, repeats experiment totally for 3 times, then asks its mean value calculation mycelial growth rate.
(2) mycelia and sporocyst are measured: Phytophthora capsici wild type strain SD33, restructuring phytophthora blight of pepper pHAM34/SD33, restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 and restructuring phytophthora blight of pepper pHAM34-antiPCFAE2/SD33 are respectively on 10%V8 vegetable juice culture, cultivate 5-7d for 28 ℃, picking mycelia on slide glass, sporocyst output, spore germination and mycelia morphologic observation.The zoospore of induction is examined under a microscope to form and kept a record simultaneously.
(3) acquisition of zoospore and sprouting: by Phytophthora capsici wild type strain SD33, restructuring phytophthora blight of pepper pHAM34/SD33, restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 and restructuring phytophthora blight of pepper pHAM34-antiPCFAE2/SD33 cultivate three days respectively in 10%V8 vegetables juice liquid nutrient medium, and then rinse and stimulate generation sporocyst with 20ml aqua sterilisa, then cold stimulation produces zoospore.Draw liquid in the 2 μ l culture dish number of microscopy zoospore under the microscope.By zoospore liquid spiral vibration 30s, mix with equal-volume aqua sterilisa.Draw 50 μ l and drip on slide glass 25 ℃ of moisturizings and cultivate 2h, observe the sprouting situation of the spore that stops, calculate the spore that stops of sprouting and account for and stop spore and sprout the ratio of the spore summation of stopping.Measure under the microscope the length that forms germ tube after sprouting.Each bacterial strain of all experiments repeats for three times, then asks its mean value.
Experimental result shows that PCFAE2 does not exert an influence to these biological characters such as germination rate of colonial morphology, mycelial growth rate, sporocyst form and quantity, zoospore output and the spore that stops.Because PCFAE2 does stage expression mutually in host's cause of disease, be changed significantly, this may imply that this gene plays an important role in infecting the process of sending out.Zoospore in 10% V8 liquid nutrient medium 25 ℃ hatch, after static 2 hours, Phytophthora capsici wild type strain SD33, restructuring phytophthora blight of pepper pHAM34/SD33 germination rate is between 45.7%-57.2%, and the stop average germination rate of spore of restructuring phytophthora blight of pepper pHAM34-antiPCFAE2/SD33 and restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 is respectively 49.3%, 52.8%.
2.2.5.3 Pathogenicity
2.2.5.3.1 zoospore induction
(1) by Phytophthora capsici wild type strain SD33, restructuring phytophthora blight of pepper pHAM34/SD33, restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 and restructuring phytophthora blight of pepper pHAM34-antiPCFAE2/SD33 transfer to respectively on 10%V8 vegetable juice culture and cultivate 4 days, from colony edge picking mycelia piece move to new 10%V8 vegetable juice culture continue to cultivate 4 days standby;
(2) picking colony edge mycelia piece is cultivated to 10%V8 vegetable juice culture, 25 ℃ of dark culturing 5-6 days;
(3) add aqua sterilisa (being advisable with submergence mycelia just), every 1 day, change water until produce zoospore; Collect zoospore and regulate zoospore concentration to 1 * 10
5individual/ml, the zoospore suspension obtaining can be used for pathogenic analysis.
2.2.5.3.2 mensuration is pathogenic to capsicum
The restructuring phytophthora blight of pepper pHAM34-antiPCFAE2/SD33 of induction and restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 zoospore are inoculated respectively to No. 6 (5-6 leaf phase) blades of middle green pepper of cultivation.Zoospore concentration adjustment to 1 * 10
5individual/ml.First will choose blade sterilization: 70% Ethanol Treatment 30s, 0.1% mercuric chloride is processed 7min, rinses 3 times in aqua sterilisa, dries standby.After drying, blade is laid on cut-and-dried water agar plate, each flat board is put 3, each blade inoculation 2 μ l zoospore suspension.Each sample connects 12 blades.With Phytophthora capsici wild type strain SD33 zoospore suspension, restructuring phytophthora blight of pepper pHAM34/SD33 zoospore suspension and sterilized water inoculation are in contrast.Do and repeat experiment for 3 times.1-7 days after inoculation, observe the symptoms every day, Taking Pictures recording.
After the reticent transformant inoculation of PCFAE2, the result of 1-7 days shows: the blade of inoculation Phytophthora capsici wild type strain SD33 zoospore (B in Fig. 5) very fast (after inoculation the 2nd day) occurs the downright bad spot that rots in inoculation site, and scab has expansion trend; There is same symptoms in the blade of inoculation restructuring phytophthora blight of pepper pHAM34/SD33 zoospore (C in Fig. 5); There is not scab (D in Fig. 5) in the Pepper Leaves of sterilized water inoculation; And within the 3rd day after inoculation, in inoculation site, there is the downright bad spot that rots with the blade after PCFAE2 gene silencing transformant pHAM34-antiPCFAE2/SD33 zoospore (A in Fig. 5) processing, (scab color is more shallow than contrast for strength reduction, Area Ratio contrast is little), onset area is less than inoculation Phytophthora capsici wild type strain SD33 blade, and onset area is 1/2 of inoculation Phytophthora capsici wild type strain SD33 blade.
After PCFAE2 overexpression transformant inoculation, the result of 1-7 days shows: the blade of inoculation wild-type zoospore (B in Fig. 6) very fast (after inoculation the 2nd day) occurs the downright bad spot that rots in inoculation site, and scab has again expansion trend; There is same symptoms in the blade of inoculation restructuring phytophthora blight of pepper pHAM34/SD33 zoospore (C in Fig. 6); There is not scab (D in Fig. 6) in the Pepper Leaves of sterilized water inoculation; And there is the time advance of symptom in blade after processing with restructuring phytophthora blight of pepper pHAM34-PCFAE2/SD33 zoospore (A in Fig. 6), within the 1st day after inoculation, in inoculation site, there is the downright bad spot that rots, intensity increases, onset area increases than contrast Infectikon area, and onset area is 4/3 times of inoculation Phytophthora capsici wild type strain SD33 blade.
Above-mentioned description of test PCFAE2 gene has participated in the process that phytophthora blight of pepper infects host and causes the capsicum epidemic disease course of disease to occur, and is important virulence factor.
Claims (7)
1. an albumen, be following a) or b) protein:
A) protein that the aminoacid sequence shown in sequence 2 21-569 positions forms in sequence table;
B) protein that the aminoacid sequence shown in sequence 2 forms in sequence table.
2. the nucleic acid molecule of albumen described in the claim 1 of encoding.
3. nucleic acid molecule according to claim 2, is characterized in that: described nucleic acid molecule is following 1) or 2) shown in gene:
1) its encoding sequence is the DNA molecular of the 61-1710 position Nucleotide of sequence 1 in sequence table;
2) its encoding sequence is the DNA molecular of the 1-1710 position Nucleotide of sequence 1 in sequence table.
4. any biomaterial following 1)-4):
1) expression cassette that contains nucleic acid molecule described in claim 2 or 3;
2) recombinant expression vector that contains nucleic acid molecule described in claim 2 or 3;
3) recombinant microorganism that contains nucleic acid molecule described in claim 2 or 3;
4) transgenic cell line that contains nucleic acid molecule described in claim 2 or 3.
5. method of protein described in preparation claim 1, comprises the encoding gene of protein claimed in claim 1 is expressed to the step that obtains protein described in claim 1 in biomass cells; Described biomass cells is microorganism cells, vegetable cell or non-human animal's cell.
6. the method for the recombinant microorganism of protein described in claim 1 is expressed in preparation, comprises the encoding gene of protein claimed in claim 1 is imported to host microorganism cell, obtains expressing the step of the recombinant microorganism of protein described in claim 1.
7. the application of protein in regulation and control Phytophthora capsici bacteria pathogenic described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210164062.7A CN102676468B (en) | 2012-05-24 | 2012-05-24 | Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210164062.7A CN102676468B (en) | 2012-05-24 | 2012-05-24 | Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102676468A CN102676468A (en) | 2012-09-19 |
| CN102676468B true CN102676468B (en) | 2014-07-16 |
Family
ID=46809021
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210164062.7A Expired - Fee Related CN102676468B (en) | 2012-05-24 | 2012-05-24 | Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102676468B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105886482B (en) * | 2016-05-16 | 2019-12-06 | 中国农业大学 | Phytophthora capsici chitin synthase and gene and application thereof |
-
2012
- 2012-05-24 CN CN201210164062.7A patent/CN102676468B/en not_active Expired - Fee Related
Non-Patent Citations (6)
| Title |
|---|
| 兰海等.辣椒疫霉菌研究概况.《湖北植保》.2008,(第1期),16-17. |
| 刘鹏展等.阿魏酸酯酶的研究与应用.《食品研究与开发》.2006,第127卷(第5期),169-171，164. |
| 叶建华等.微生物阿魏酸酯酶及其应用.《中国奶牛》.2007,(第10期),28-31. |
| 微生物阿魏酸酯酶及其应用;叶建华等;《中国奶牛》;20071231(第10期);28-31 * |
| 辣椒疫霉菌研究概况;兰海等;《湖北植保》;20081231(第1期);16-17 * |
| 阿魏酸酯酶的研究与应用;刘鹏展等;《食品研究与开发》;20061231;第127卷(第5期);169-171，164 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102676468A (en) | 2012-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113604490B (en) | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof | |
| Sun et al. | First report of southern blight of mung bean caused by Sclerotium rolfsii in China | |
| US20220369648A1 (en) | Endophytic falciphora oryzae fo-r20 and its application | |
| CN102634496B (en) | Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof | |
| CN102994401B (en) | A kind of method preparing apple rot pathogen transformant and GFP labeled strain | |
| CN105255915A (en) | Application of Arabidopis thaliana AtGDSL gene in prevention of sclerotinia rot and promotion of seed germination of rape | |
| CN104450740B (en) | A kind of alfalfa MsWRKY33 transcription factor and encoding proteins, preparation method and application | |
| US20220386625A1 (en) | Application of endophytic falciphora oryzae fo-r20 in controlling panicle blast | |
| CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
| CN106244599A (en) | A kind of Radix Notoginseng pathogenesis-related proteins 1 family gene PnPR1 2 and application | |
| CN113403205B (en) | Penicillium beijerinckii MP6 with bacteriostatic action and application thereof | |
| CN104911206A (en) | Method for obtaining transgenic alfalfa and special expression vector CPB-BAN-GFP thereof | |
| CN102659933B (en) | Bacillus thuringiensis gene cry8like and cry8G combination and application thereof | |
| CN102676468B (en) | Feruloyl esterase PCFAE2 deriving from phytophthora capsici leonian and coding gene and application of feruloyl esterase PCFAE2 | |
| CN102703402B (en) | Feruloyl esterase PCFAE1 from Phytophthora capsici Leonian and coding gene and application thereof | |
| CN108103042B (en) | Anti-verticillium wilt related receptor-like protein kinase GhPR5K, coding gene thereof and application thereof | |
| CN102660514B (en) | Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof | |
| CN109825456B (en) | Marina marine bacillus E40208a1 and application thereof | |
| Xiao et al. | Synonymy of two species of Bipolaris from aquatic crops of Poaceae | |
| CN106480073A (en) | Oryza meyeriana Distributed in Yunnan Province MeXB3 gene and its application | |
| CN106434689A (en) | Plant disease-resistant essential gene ShORR-1 and application thereof | |
| CN114990156B (en) | Recombinant vector based on RNAi interference sclerotinia sclerotiorum OAH gene, construction method and application thereof | |
| CN114854752B (en) | Double-stranded RNA molecule of targeted silencing phytophthora capsici cellulose synthase 3 and application thereof | |
| CN106497942A (en) | A kind of ash arrhizus bacteria gene BcSEP3 related to pathogenicity and its application | |
| CN102296060A (en) | Cloning method for elicitor Nep1 (Necrosis and ethylene-inducing peptide 1)-induced hypersensitive cell death regulating and controlling gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140716 Termination date: 20180524 |