CN113403205B - Penicillium beijerinckii MP6 with bacteriostatic action and application thereof - Google Patents
Penicillium beijerinckii MP6 with bacteriostatic action and application thereof Download PDFInfo
- Publication number
- CN113403205B CN113403205B CN202110663883.4A CN202110663883A CN113403205B CN 113403205 B CN113403205 B CN 113403205B CN 202110663883 A CN202110663883 A CN 202110663883A CN 113403205 B CN113403205 B CN 113403205B
- Authority
- CN
- China
- Prior art keywords
- penicillium
- phytophthora
- beijerinckii
- beilii
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/36—Penicillium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
Abstract
The invention discloses penicillium beijerinckii MP6 with an antibacterial effect and application thereof. The classification of the Penicillium beijerinckii MP6 is named as Penicillium beijerinckiiPenicillium bilaiaeAnd the culture is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2021612; the strain has developed hypha, short length and felt shape; the conidial heads are broom-shaped, conidial chains grow, and the nucleotide sequence of ITS is shown in SEQ ID No. 5. The penicillium beijerinckii MP6 can be used for preparing biocontrol agents for preventing and treating fusarium wilt, phytophthora blight and/or bacterial wilt, has the obvious effect of inhibiting fusarium oxysporum, phytophthora sojae, phytophthora nicotianae, phytophthora capsici and ralstonia solanacearum, further increases the resistance of plants to the fusarium wilt, the phytophthora blight or the bacterial wilt, and has good market application prospect.
Description
Technical Field
The invention belongs to the technical field of microorganisms, and particularly relates to penicillium beijerinckii MP6 with an antibacterial effect and application thereof.
Background
At present, because continuous cropping generally exists in agricultural production, root system metabolites of plants are gradually accumulated in soil, a growing and breeding environment is provided for soil-borne fungal diseases, and the soil-borne diseases in crop and vegetable cultivation are increasingly aggravated. After the crops are infected by soil-borne pathogenic fungi, the symptoms are generally epidemic diseases and blight, and the specific expression symptom is that the plants are withered, so that great economic loss is caused. Among them, fusarium, phytophthora and pseudomonas solanacearum are 3 important soil-borne pathogenic fungi.
Fusarium oxysporum is a soil-borne pathogenic fungus distributed worldwide, has a wide host range, and can cause fusarium wilt of more than 100 species of Fusarium such as melons, solanaceae, bananas, cottons, leguminosae, flowers and the like. After the host is infected by fusarium, the symptoms are diversified, which generally causes the browning of vascular bundles, the wilting and death of plants, the decay of bulbs and roots, the weak growth of plants and the like. Fusarium wilt is an important fungal soil-borne disease causing harm to agricultural production in recent years, occurs in many areas, particularly in crop areas with more serious emergence degree, and directly influences crop yield and economic benefit.
There are many kinds of phytophthora species, of which phytophthora nicotianae, phytophthora capsici and phytophthora sojae are common. Tobacco black shank caused by phytophthora nicotianae mainly infects roots and stem bases of tobacco to form black concave scabs thereon. Tobacco black shank is more severe throughout the world, particularly in temperate, subtropical and tropical regions. Phytophthora capsici caused by infection is a common disease occurring in capsicum. Phytophthora sojae infecting soybean can cause phytophthora sojae, which can be attacked in various growth periods of soybean, and has serious harm and destructiveness, and can cause the soybean to be out of production.
The ralstonia solanacearum is a pathogenic bacterium causing bacterial wilt, can infect various crops such as tomatoes, tobaccos and the like, and can propagate in vascular bundles after invading the plants, so that the vascular bundles are browned and rotted, and the plants are wilted due to lack of water, thereby seriously threatening the production safety of the crops.
At present, diseases caused by phytopathogens are mainly prevented and controlled by chemical pesticides and chemical agents, so that pesticide residues of agricultural products exceed standards, the physical health of consumers is harmed, environmental pollution and ecological balance damage are caused, and sustainable healthy development of agriculture is influenced. Biological control is one of the important measures for controlling plant diseases, and biocontrol bacteria achieve the aim of controlling or relieving the diseases by inducing the generation of disease resistance of host plants or by antagonism of pathogenic fungi. The biological agent or preparation can reduce or replace the use of chemical pesticides, thereby effectively preventing and treating diseases and avoiding negative effects caused by the use of chemical pesticides.
Disclosure of Invention
The invention aims to provide a penicillium beijerinckii MP6 with an inhibiting effect on various plant pathogenic bacteria and application thereof. The penicillium beilii MP6 has the function of obviously inhibiting the growth of fusarium oxysporum, phytophthora sojae, phytophthora nicotianae, phytophthora capsici and ralstonia solanacearum, and the generated fermentation liquid can be used for preparing a biocontrol agent and has good market application prospect.
In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:
the invention provides a penicillium beilii MP6 with an antibacterial effect, which is classified and named as penicillium beiliiPenicillium bilaiaeAnd the culture is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2021612.
Further, the nucleotide sequence of the ITS of the Penicillium beijerinckii MP6 is shown as SEQ ID No. 5; the nucleotide sequence of 26S rDNA is shown in SEQ ID No. 6.
Furthermore, the bacterial colony of Penicillium bylysine MP6 has developed hyphae, short length and felty shape; the conidium head is broom-shaped, and the conidium is chain-shaped.
Further, the penicillium beilii MP6 can effectively inhibit the growth of fusarium oxysporum, phytophthora nicotianae, phytophthora capsici, phytophthora sojae and ralstonia solanacearum.
The invention also provides application of the penicillium beilii MP6 in preparing a biocontrol preparation for preventing and treating fusarium wilt, phytophthora blight and/or bacterial wilt.
Further, the fusarium wilt is a plant fusarium wilt caused by fusarium oxysporum; the phytophthora root rot is phytophthora root rot of plants caused by phytophthora nicotianae, phytophthora capsici and/or phytophthora sojae; the bacterial wilt is plant bacterial wilt caused by Ralstonia solanacearum.
Furthermore, the penicillium beilii MP6 can obviously inhibit the growth of fusarium oxysporum, phytophthora nicotianae, phytophthora capsici, phytophthora sojae and ralstonia solanacearum.
Further, the penicillium beijerinckii MP6 can inhibit the hypha growth, spore germination formation and germ tube elongation of fusarium oxysporum, and inhibit the spore germination and germ tube elongation of phytophthora nicotianae and phytophthora capsici.
Furthermore, the biocontrol preparation contains a Penicillium beijerinckii MP6 fermentation broth.
Further, the preparation method of the penicillium beijerinckii MP6 fermentation liquor comprises the following steps: the penicillium beilii MP6 strain is inoculated in a potato glucose liquid culture medium, shaking culture is carried out for 14 days at 26 ℃, centrifugation is carried out for 10 min at 12000 rpm, and then a supernatant is filtered by a bacterial filter with the diameter of 0.22 mu m, thus obtaining the penicillium beilii MP6 fermentation liquid without thalli.
Furthermore, the volume ratio of the penicillium linkei MP6 fermentation liquor in the biocontrol preparation is 1-50%.
Further, when the biocontrol preparation is used for inhibiting spore germination and germ tube elongation of fusarium oxysporum, the volume ratio of the penicillium lysine MP6 fermentation liquid in the biocontrol preparation is 15-20%.
Further, when the biocontrol agent is used for inhibiting the hypha growth and the spore formation of fusarium oxysporum, the volume ratio of the penicillium lycii MP6 fermentation liquid in the biocontrol agent is 1-10%.
Furthermore, when the biocontrol preparation is used for inhibiting spore germination and germ tube extension of phytophthora capsici, the volume ratio of the penicillium linkei MP6 fermentation liquor in the biocontrol preparation is 20-50%.
Further, when the biocontrol preparation is used for inhibiting spore germination and germ tube elongation of phytophthora nicotianae, the volume ratio of the penicillium linkei MP6 fermentation liquor in the biocontrol preparation is 30-50%.
Compared with the prior art, the invention has the following advantages and beneficial effects:
the penicillium beilii MP6 strain is screened from vegetable field soil, and can obviously inhibit the growth of fusarium oxysporum, phytophthora nicotianae, phytophthora capsici, phytophthora sojae and ralstonia solanacearum, so that the fusarium oxysporum caused blight of plants, the phytophthora caused by phytophthora and the plant bacterial wilt caused by ralstonia solanacearum are effectively inhibited. The fermentation product of the penicillium beijerinckii MP6 has obvious inhibiting effects on the hypha growth, the spore germination formation and the bud tube elongation of fusarium oxysporum, phytophthora nicotianae, phytophthora capsici, phytophthora sojae and ralstonia solanacearum, so that the strain and the fermentation liquid thereof can be used for preparing a biocontrol agent, and further the resistance of plants to bacterial wilt, phytophthora blight and blight is enhanced.
Drawings
FIG. 1 is a colony and conidiogram of Penicillium beijerinckii MP 6;
FIG. 2 shows the inhibition of the growth of P.tabacum by MP 6;
FIG. 3 shows the inhibition of the growth of phytophthora capsici by Penicillium bailii MP 6;
FIG. 4 shows the inhibition of the growth of P.beilii MP6 strain on P.soyae;
FIG. 5 shows the inhibition of the growth of Fusarium oxysporum hyphae by Penicillium beijerinckii MP 6;
FIG. 6 shows the results of inhibition of germination of Fusarium oxysporum spores and elongation of germ tubes by the fermentation filtrate of Penicillium beijerinckii MP 6;
FIG. 7 shows the results of the inhibition of the germination of phytophthora capsici spores and the elongation of germ tubes by the fermentation filtrate of Penicillium bailii MP 6;
FIG. 8 shows the results of the inhibition of the germination of phytophthora nicotianae spores and the elongation of germ tubes by the fermentation filtrate of Penicillium beijerinckii MP 6;
FIG. 9 shows the inhibition of the growth of Fusarium oxysporum hyphae by the fermentation filtrate of Penicillium bailii MP 6;
FIG. 10 shows the results of the inhibition of conidiospore formation by the fermentation filtrate of Penicillium beijerinckii MP 6;
FIG. 11 shows the results of the growth inhibition of P.beilii MP6 on the L.solanacearum plate.
Detailed Description
The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers.
Example 1: isolation, screening and characterization of strains
First, separation and screening of bacterial strains
Collecting 15 parts of vegetable field soil sample in 7 months in 2018 in Qingdao, namely Yimo, transferring the sample into sterile water, and adding glass beads for scattering. Then diluting with sterile water to 10-4~10-7Taking 200 mul of the potato, coating the potato on a PDA plate (taking 200 g of potatoes, cleaning, cutting into blocks, adding proper water, boiling for 20-30 minutes, filtering by using gauze, taking potato juice, adding 20 g of glucose and 20 g of agar, fixing the volume to 1000 ml, and culturing at 26-28 ℃ under a natural pH condition).
Selecting a single mould colony, respectively inoculating the single mould colony, fusarium oxysporum, phytophthora nicotianae, phytophthora capsici and phytophthora sojae on a PDA (personal digital assistant) plate by using a plate confronting growth method, and culturing at 26-28 ℃. By calculating and testing the hypha growth inhibition rate of the mold on plant pathogenic bacteria, a strain with strong inhibition on the hypha growth of fusarium oxysporum, phytophthora nicotianae, phytophthora capsici and phytophthora sojae is screened out and numbered as MP 6.
II, classification and identification of MP6 strain
1. Morphological identification:
the colony morphology and conidia morphology of the MP6 strain on PDA plates were tested with reference to the characteristics of penicillium. The experimental results are shown in figure 1, the MP6 strain has developed hyphae, but is short in length, felty in shape, brood-shaped in conidium head and chain-shaped in conidium, and the characteristics accord with the typical characteristics of penicillium, so that the MP6 strain is determined to be a penicillium strain.
2. And (3) molecular identification:
PCR sequencing was performed using the universal primers ITS 1/ITS 4 and NL1/NL 4. Wherein, the ITS sequence primer: ITS 1: TCCGTAGGTGAACCTGCGG (SEQ ID No. 1); ITS 4: TCCTCCGCTTATTGATATGC (SEQ ID No. 2). 26S rDNA sequence primer: NL 1: GCATATCAATAAGCGGAGGAAAAG (SEQ ID No. 3); NL 4: GGTCCGTGTTTCAAGACGG (SEQ ID No. 4).
The PCR reaction system is as follows: 2 × PCR Master Mix: 12.5 mul; primer 1: 1 mul; primer 2: 1 mul; template: 1 mul; ddH2O：9.5 μl；
The PCR reaction procedure was as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30 s, annealing at 52 ℃ for 30 s, and extension at 72 ℃ for 0.5 min, and repeating for 30 cycles; renaturation at 72 ℃.
PCR products are recovered by glue, TA cloning is carried out, and single bacteria are picked and sent to a sequencing company for sequencing.
The ITS fragment sequence of the MP6 strain is shown as SEQ ID No.5 through sequencing; the 26S rDNA sequence is shown in SEQ ID No. 6.
Comparing the strains to be detected MP6 and Penicillium beijerinckii (B) by NCBI databasePenicillium bilaiae) The sequence matching rate of the ITS of MH1214 strain (GenBank: LN 901118.1) was 99.62%; with Penicillium bailii (Penicillium bilaiae) The sequence match rate of NRRL 3391 strain 28S rDNA (GenBank: AF 033402.1) was 99.65%. Finally determining the MP6 strain as Penicillium bailii through comprehensive analysisPenicillium bilaiae。
The screened Penicillium beijerinckii MP6 strain is preserved in the preservation unit: china center for type culture Collection; address: wuhan, Wuhan university; the preservation date is as follows: 26/5/2021, Penicillium beijerinckiiPenicillium bilaiae The preservation number of MP6 is CCTCC NO: m2021612.
EXAMPLE 2 biocontrol experiments with Penicillium beijerinckii MP6
1. MP6 strain for inhibiting growth of plant pathogenic bacteria hypha
The experimental method comprises the following steps: respectively carrying out activated culture on an MP6 strain and 4 pathogenic bacteria (fusarium oxysporum, phytophthora nicotianae, phytophthora capsici and phytophthora sojae) on a PDA (personal digital assistant) flat plate at the temperature of 26-28 ℃ for 3-5 days for later use; then, a round bacterial cake (the diameter is 0.60 cm) is punched at the edge of the activated bacterial strain hyphae (the growth condition is as consistent as possible) by using a puncher, the MP6 bacterial strain and the bacterial cake of the phytophthora to be tested are respectively picked to two ends of a new flat plate by using an inoculating needle, and then the culture dish is placed in an incubator (26-28 ℃) for culture. The growth conditions of the hyphae are observed and measured in time after treatment, the bacteriostasis effect is shown in figures 2-5, and the result shows that the MP6 strain has better inhibition effect on the growth of the hyphae of 4 pathogenic bacteria. The calculation shows that the hypha growth inhibition rate of the MP6 strain on the phytophthora nicotianae is 46.7%; the inhibition rate of MP6 strain on the growth of phytophthora capsici mycelium is 38.2%; the inhibition rate of the MP6 strain on the growth of soybean phytophthora hyphae is 52.1%; the inhibition rate of the MP6 strain on the hypha growth of fusarium oxysporum is 53.3%, which shows that the MP6 strain has broad antibacterial spectrum.
2. Inhibitory Effect of fermentation filtrate of MP6 Strain on spore germination and germ tube elongation
The experimental method comprises the following steps: the picked MP6 strain is inoculated to potato dextrose liquid culture medium (PDA culture medium without agar), shaking culture is carried out for 14 d at 26 ℃, then centrifugation is carried out for 10 min under the condition of 12000 rpm, filtration is carried out, and supernatant is filtered by a bacterial filter with the diameter of 0.22 μm, thus obtaining fermentation filtrate containing MP6 strain fermentation product (the fermentation filtrate does not contain MP6 strain, and is only the fermentation product of MP6 strain).
Diluting the fermentation filtrate with different concentrations, and detecting by concave slide method (adding 50 μ l of filtrate with different concentrations into sterilized concave slide respectively, wherein the concentration of phytophthora nicotianae spore is 1.7 × 105The spore concentration of phytophthora capsici per ml is 3.3 multiplied by 105The spore concentration of Fusarium oxysporum is 1.0 × 106Culturing at 26 deg.C under moisture-keeping condition, detecting spore germination rate in fermentation filtrate treatment with different concentrations, and measuring length of bud tube.
(1) Fermentation filtrate of MP6 strain for germination and elongation of spore of Fusarium oxysporum
After 12 hours of culture, the germination rate and the length of a germ tube of the spore are measured, and the result is shown in figure 6, and the inhibition rate of the spore germination of the fusarium oxysporum is obviously improved along with the increase of the content of the fermentation filtrate. When the content exceeds 20%, the germination inhibition rate of the fusarium oxysporum spores is over 66%, which indicates that the fermentation product of the MP6 strain has a strong inhibition effect on the germination of the fusarium oxysporum spores. Through measuring the length of the germ tube, the inhibition rate of the germ tube elongation is higher with the increase of the filtrate concentration, and when the content is 15%, the inhibition rate of the germ tube elongation is 73.7%, which indicates that the inhibition rate of fusarium oxysporum spore germination and the inhibition rate of the germ tube elongation are dose-dependent.
(2) MP6 strain fermentation filtrate for phytophthora capsici spore germination and bud tube elongation
After 2 hours of culture, the germination rate and the length of a germ tube of phytophthora capsici spores are measured, and the result is shown in fig. 7, the germination and the extension of the germ tube of the phytophthora capsici spores are also obviously inhibited along with the increase of the content of the fermentation filtrate, and when the concentration of the fermentation filtrate is 50%, the inhibition rate of the germination of the spores can reach 92.8%. The germination rate and the germ tube elongation of the phytophthora capsici spores are improved along with the increase of the fermentation filtrate of the strain MP6, which shows that the inhibition rate of the phytophthora capsici spores germination and the inhibition rate of the germ tube elongation are dose-dependent.
(3) Fermentation filtrate of MP6 strain for germination and extension of phytophthora nicotianae spore
After the cultivation for 1 hour, the germination rate and the sprout canal length of the phytophthora nicotianae spores are measured, and the result is shown in fig. 8, the inhibition rate of the phytophthora nicotianae spores to germination and the inhibition rate of the sprout canal elongation are also obviously improved along with the increase of the content of the fermentation filtrate, and when the concentration of the fermentation filtrate is 50%, the inhibition rate of the spores to germination can reach 79.6%. The germination rate and the germ tube elongation of the phytophthora nicotianae spores are improved along with the increase of the fermentation filtrate of the MP6 strain, and the inhibition rate of the phytophthora nicotianae spores germination and the germ tube elongation is dose-dependent.
3. Inhibition of fusarium oxysporum hypha growth and sporulation by MP6 strain fermentation filtrate
Obtaining MP6 strain fermentation filtrate according to the method, adding different fermentation filtrate contents (0.5%, 1%, 2%, 4%, 6%, 8%, 10%) into PDA culture medium, inoculating fusarium oxysporum cake onto culture medium with different concentrations, and after culturing for 6 days, finding that the inhibition of mycelium growth is gradually obvious along with the increase of the concentration of the fermentation liquid, so that bacterial colony is gradually reduced; the inhibitory effect of the fermentation broth concentration of 0.5% was almost not different from that of the wild type, but the effect was very remarkable when the fermentation filtrate concentration reached 4%. The inhibitory effect of the MP6 strain fermentation filtrate on the growth of fusarium oxysporum hyphae is shown in FIG. 9, and the colony diameter of fusarium oxysporum is smaller and smaller with the increase of the concentration of the fermentation liquid. The plates are continuously cultured for 12 days, spores of each plate are washed down and counted, the result is shown in figure 10, the spore production number of the fusarium oxysporum is reduced along with the increase of the concentration of the fermentation liquid, and when the concentration reaches 4%, the inhibition rate of the fusarium oxysporum spores is up to 90.8%. The MP6 strain fermentation filtrate can effectively inhibit the growth of fusarium oxysporum hyphae and the generation of spores, and the inhibition rate is dose-dependent.
Example 3: growth inhibition of P.beilii MP6 against plant bacterial wilt bacterium, Ralstonia solanacearum
A bacterial solution of Ralstonia solanacearum is dipped by a sterile cotton swab, and then the bacterial solution is coated on the surface of a flat plate, and then a Penicillium beilii MP6 strain is inoculated. The culture dish is placed in an incubator (26-28 ℃) in an inverted mode for culturing for 4-5 days, and the bacteriostatic action of the MP6 strain on the Ralstonia solanacearum is measured. The test results are shown in fig. 11, and a remarkable inhibition zone appears around the colonies of the MP6 strain, which indicates that the penicillium beilii MP6 has a significant inhibition effect on the growth of the ralstonia solanacearum.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Qingdao agricultural university
<120> penicillium beijerinckii MP6 with bacteriostatic action and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tccgtaggtg aacctgcgg 19
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcatatcaat aagcggagga aaag 24
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ggtccgtgtt tcaagacgg 19
<210> 5
<211> 544
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcttctcgtg agctctgggt cacctcccac ccgtgtctct tgtaccatgt tgcttcggcg 60
agcccgcctc acggccgccg gggggcatct gcccccgggc ccgcgcccgc cgaagccccc 120
tctgaacgct gtctgaagat tgcagtctga gcgataagca aaaattattt aaaactttca 180
acaacggatc tcttggttcc ggcatcgatg aagaacgcag cgaaatgcga taactaatgt 240
gaattgcaga attcagtgaa tcatcgagtc tttgaacgca cattgcgccc cctggtattc 300
cggggggcat gcctgtccga gcgtcattgc tgccctcaag cacggcttgt gtgttgggcc 360
tccgtcctcc ccccgggggg acgggcccga aaggcagcgg cggcaccgtg tccggtcctc 420
gagcgtatgg ggctttgtca cccgctctgt aggcccggcc ggcgctggcc gaccctccaa 480
ccccattttt tcaggttgac ctcggatcag gtagggatac ccgctgaact taagcatatc 540
aaaa 544
<210> 6
<211> 580
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tatagcagcg tcgagccgag cgcgttcctc ggtccgggca ggccgcatgg caccctcggc 60
tataagacgc cccgagaggc gttacattcc gagggccttt gaccggccgc ccaaaccgac 120
gctggcccgc ccacggggaa gtacaccagc ccgaaggctg gctgaacccc gtaggcgagt 180
ctggtcgcaa acgcttccct ttcaacaatt tcacgtgctt tttaactctc ttttcaaagt 240
gcttttcatc tttcgatcac tctacttgtg cgctatcggt ctccggccaa tatttagctt 300
tagatgaaat ttaccaccca tttagagctg cattcccaaa caactcgact cgtcgaagga 360
gcttcacacg ggcgcggaca ccccatccca tacgggattc tcaccctcta tgacagcccg 420
ttccagggca cttagatggg gaccgctccc gaagcatcct ctgcaaatta caatgcggac 480
cccgaaggag ccagctttca aatttgagct cttgccgctt cactcgccgt tactggggca 540
atccctgttg gtttcttttc ctccgctttg ggaatatgca 580
Claims (7)
1. A penicillium beilii MP6 with bacteriostasis is characterized in that: the Penicillium bilaiae is classified and named as Penicillium beilii, is preserved in China center for type culture Collection with the preservation number of CCTCC NO: m2021612; the nucleotide sequence of the ITS of the penicillium beijerinckii MP6 is shown in SEQ ID No. 5; the nucleotide sequence of 26S rDNA is shown in SEQ ID No. 6.
2. The use of penicillium beilii MP6 as claimed in claim 1 for the preparation of a biocontrol agent for the control of phytophthora and/or bacterial wilt, characterized in that: the phytophthora root rot is phytophthora root rot of plants caused by phytophthora nicotianae, phytophthora capsici and/or phytophthora sojae; the bacterial wilt is plant bacterial wilt caused by Ralstonia solanacearum.
3. Use according to claim 2, characterized in that: the penicillium beilii MP6 can obviously inhibit the growth of phytophthora nicotianae, phytophthora capsici, phytophthora sojae and ralstonia solanacearum.
4. Use according to claim 3, characterized in that: the penicillium beilii MP6 can inhibit spore germination and germ tube elongation of phytophthora nicotianae and phytophthora capsici.
5. Use according to claim 2, characterized in that: the biocontrol preparation contains Penicillium beilii MP6 fermentation liquor.
6. Use according to claim 5, characterized in that: the preparation method of the penicillium beijerinckii MP6 fermentation liquor comprises the following steps: inoculating the Penicillium beijerinckii MP6 strain into a potato glucose liquid culture medium, performing shake culture at 26 ℃ for 14 days, performing high-speed centrifugation, and filtering the supernatant by using a bacterial filter with the diameter of 0.22 mu m to obtain a Penicillium beijerinckii MP6 fermentation liquid without bacteria.
7. Use according to claim 5, characterized in that: the volume ratio of the penicillium linkei MP6 fermentation liquor in the biocontrol preparation is 1-50%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110663883.4A CN113403205B (en) | 2021-06-16 | 2021-06-16 | Penicillium beijerinckii MP6 with bacteriostatic action and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110663883.4A CN113403205B (en) | 2021-06-16 | 2021-06-16 | Penicillium beijerinckii MP6 with bacteriostatic action and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113403205A CN113403205A (en) | 2021-09-17 |
| CN113403205B true CN113403205B (en) | 2022-02-08 |
Family
ID=77684118
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110663883.4A Active CN113403205B (en) | 2021-06-16 | 2021-06-16 | Penicillium beijerinckii MP6 with bacteriostatic action and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113403205B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111454848B (en) * | 2020-04-15 | 2022-04-19 | 中国科学院微生物研究所 | Actinomucor elegans GD48, fermentation product, microbial inoculum and application thereof |
| CN115851533B (en) * | 2022-12-05 | 2023-06-27 | 众乐(潍坊)生物科技有限公司 | Bacillus thuringiensis and application thereof in inhibiting livestock and poultry feed mould |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5919446A (en) * | 1997-10-27 | 1999-07-06 | The United States Of America As Represented By The Secretary Of Agriculture | Control of fire blight on pome fruit trees with Erwinia herbicola |
| CN106119155A (en) * | 2016-06-24 | 2016-11-16 | 中国科学院南京土壤研究所 | For preventing and treating bacterial strain WXX 2 and the microbial inoculum of Roots of Peanut maize ear rot |
| CN109628328A (en) * | 2019-01-11 | 2019-04-16 | 河南省农业科学院植物保护研究所 | One plant can prevent and treat sesame wilt disease and visit bad mould and its screening technique and application with growth-promoting and induction of resistance effect |
| CN112899171A (en) * | 2021-04-02 | 2021-06-04 | 河南科技大学 | Rapex leucocytochys LL210, application thereof and biocontrol microbial inoculum |
-
2021
- 2021-06-16 CN CN202110663883.4A patent/CN113403205B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5919446A (en) * | 1997-10-27 | 1999-07-06 | The United States Of America As Represented By The Secretary Of Agriculture | Control of fire blight on pome fruit trees with Erwinia herbicola |
| CN106119155A (en) * | 2016-06-24 | 2016-11-16 | 中国科学院南京土壤研究所 | For preventing and treating bacterial strain WXX 2 and the microbial inoculum of Roots of Peanut maize ear rot |
| CN109628328A (en) * | 2019-01-11 | 2019-04-16 | 河南省农业科学院植物保护研究所 | One plant can prevent and treat sesame wilt disease and visit bad mould and its screening technique and application with growth-promoting and induction of resistance effect |
| CN112899171A (en) * | 2021-04-02 | 2021-06-04 | 河南科技大学 | Rapex leucocytochys LL210, application thereof and biocontrol microbial inoculum |
Non-Patent Citations (1)
| Title |
|---|
| 微生物产生的酶抑制剂研究1.蛋白酶抑制剂的筛选方法探讨;刘华珍等;《抗生素》;19831231;第8卷(第5期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113403205A (en) | 2021-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111925966B (en) | Bacillus belgii and culture method and application thereof | |
| CN108315267B (en) | Short dense trichoderma GSAAMLSHU-1 and application thereof | |
| Nirmaladevi et al. | Cultural, morphological, and pathogenicity variation in Fusarium oxysporum f. sp. lycopersici causing wilt of tomato | |
| CN111961629B (en) | Cherry preservative and fresh-keeping microbial preparation and preparation method and application thereof | |
| CN109055238B (en) | Aspergillus flavus strain TR32 with inhibiting effect on plant pathogenic bacteria and application thereof | |
| CN113403205B (en) | Penicillium beijerinckii MP6 with bacteriostatic action and application thereof | |
| US20220386625A1 (en) | Application of endophytic falciphora oryzae fo-r20 in controlling panicle blast | |
| Li et al. | Effects of root exudates from potato onion on Verticillium dahliae | |
| CN110643551B (en) | Stenotrophomonas rhizophila S11 for preventing and treating rice blast and application thereof | |
| CN111139186B (en) | Trichoderma viride with disease prevention and growth promotion functions and application thereof | |
| CN113403211B (en) | Hansenula polymorpha MP1861 with bacteriostatic effect on grape juice and application thereof | |
| CN111280183A (en) | Apple anthracnose leaf blight biocontrol microbial inoculum and preparation method and application thereof | |
| CN110862936A (en) | Weissella fusiformis MP4 strain with bacteriostatic action and application thereof | |
| CN113528355B (en) | Trichoderma antagonistic to various pathogenic fungi of potatoes and application thereof | |
| CN114921345A (en) | Conifera bacterial strain SGSF767 and application thereof in preventing and treating plant diseases | |
| CN115851479A (en) | Bacterium with antagonistic effect on botrytis cinerea and application thereof | |
| CN111187724B (en) | Endophytic fungus with dark blueberry root and application thereof | |
| CN114908003B (en) | Gluconobacter freundii MP262 with broad-spectrum antibacterial property and application thereof | |
| CN111394262B (en) | Weed biocontrol bacterium and application thereof | |
| CN115340961B (en) | Streptomyces griseus for antagonizing rice bacterial strip spot bacteria and application thereof | |
| CN113881573B (en) | Apple specialized fusarium layered-outlet bacterium and application thereof | |
| LU502662B1 (en) | Application of alternaria solani dt-15 in weed control | |
| CN113925064B (en) | Application of B-lysine-resistant bacillus in inhibition of growth of pitaya soft rot germs | |
| CN113502227B (en) | Fusarium vine, microbial inoculum and herbicide containing same and application of Fusarium vine | |
| CN114196551B (en) | Isaria javanica strain for preventing and controlling citrus pests and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |