CN111893206B - Identification method and kit for dendrobium material with high dendrobine content - Google Patents
Identification method and kit for dendrobium material with high dendrobine content Download PDFInfo
- Publication number
- CN111893206B CN111893206B CN202010841238.2A CN202010841238A CN111893206B CN 111893206 B CN111893206 B CN 111893206B CN 202010841238 A CN202010841238 A CN 202010841238A CN 111893206 B CN111893206 B CN 111893206B
- Authority
- CN
- China
- Prior art keywords
- primer pair
- sequence
- dendrobium
- seq
- target gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an identification method and a kit for a dendrobium material with high dendrobine content, and relates to the technical field of dendrobium detection and breeding. According to the identification method, a target gene sequence of the dendrobium material to be identified is compared with a standard sequence, and if the sequence of the target gene is consistent with a base sequence of the standard sequence at a target site, the dendrobium material to be identified is indicated to be dendrobium with high dendrobine content. The identification method can identify the dendrobium material with high dendrobine content.
Description
Technical Field
The invention relates to the field of dendrobe detection technology and breeding, in particular to an identification method and a kit for dendrobe materials with high dendrobine content.
Background
Dendrobine is a pyrrolizidine derivative alkaloid, and is extracted and separated from stem of Dendrobium nobile (Dendrobium nobile Lindl) of Orchidaceae, and its molecular formula is C16H25NO2The molecular weight is 263.27, and the melting point is 134.5-136 ℃. The experiment shows that the component has effects of inhibiting cancer cell proliferation, resisting cataract, reducing blood sugar, lowering blood pressure, and reducing heart contractilityRespiratory depression, anti-alzheimer's disease and weak antipyretic analgesic action.
Dendrobe is a main source for extracting dendrobine, and a dendrobe material with high dendrobine content is a better strategy for improving the dendrobine extraction amount. But the identification method of the dendrobium material with high dendrobine content is lacked at present.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide an identification method and a kit for a dendrobium material with high dendrobine content. The identification method can identify the dendrobium material with high dendrobine content.
The invention is realized by the following steps:
on one hand, the invention provides an identification method of a dendrobe material with high dendrobine content, which comprises the following steps:
a comparison step: comparing the sequence of a target gene of the dendrobium material to be identified with a standard sequence, and if the sequence of the target gene is completely consistent with the base sequence of the standard sequence at a target site, indicating that the dendrobium to be identified is the dendrobium material with high dendrobine content;
the target gene comprises: a first target gene, a second target gene, and a third target gene; wherein the sequence of the first target gene is obtained by PCR amplification and sequencing of a first primer pair or a second primer pair; the sequence of the second target gene is obtained by PCR amplification and sequencing of a third primer pair or a fourth primer pair; the sequence of the third target gene is obtained by PCR amplification and sequencing of a fifth primer pair or a sixth primer pair;
the base sequence of the first primer pair is shown as SEQ ID NO.4-5, the base sequence of the second primer pair is shown as SEQ ID NO.6-7, the base sequence of the third primer pair is shown as SEQ ID NO.8-9, the base sequence of the fourth primer pair is shown as SEQ ID NO.10-11, the base sequence of the fifth primer pair is shown as SEQ ID NO.12-13, and the base sequence of the sixth primer pair is shown as SEQ ID NO. 14-15;
the standard sequence comprises: a first standard sequence, a second standard sequence, and a third standard sequence; the target sites comprise a first target site, a second target site and a third target site; 272, 617, 644, 787, 818, 906, 1016 and 1104 of the first standard sequence are the first target site, and the bases thereof are: G. c, C, T, T, C, C and A; positions 266, 320, 659, 1000, 1062, 1077 and 1337 of the second standard sequence are the second target site, and the bases thereof are: G. a, T, G, G, C and A; positions 396, 404, 455, 515, 571, 655, 664, 673 and 793 of the third standard sequence are the third target site, and the bases thereof are: A. g, A, C, T, G, C, G and G;
in making the comparison, the first target gene is compared to the first standard sequence, the second target gene is compared to the second standard sequence, and the third target gene is compared to the third standard sequence.
The inventor finds that for the dendrobium material, three target gene sequences amplified by the primer pair have a certain degree of correlation with the dendrobine content. Further analysis revealed that if the bases 272, 617, 644, 787, 818, 906, 1016 and 1104 of the first target gene were: G. c, C, T, T, C, C and A, bases 266, 320, 659, 1000, 1062, 1077 and 1337 of the second target gene are respectively: G. a, T, G, G, C and A, and bases 396, 404, 455, 515, 571, 655, 664, 673, and 793 of the third gene of interest are: A. g, A, C, T, G, C, G and G, the dendrobine content of the dendrobe material is higher.
Based on the discovery, the identification method of the dendrobium material with high dendrobine content provided by the embodiment of the invention compares the sequences of the three target genes of the dendrobium material to be identified with the standard sequence, and indicates that the dendrobium material to be identified is the dendrobium material with high dendrobine content if the sequences of the target genes are completely consistent with the base sequences of the standard sequence at the target sites. The identification method can identify the dendrobe material with high dendrobine content, and has high accuracy.
In an alternative embodiment, the base sequence of the first standard sequence is as shown in SEQ ID NO. 1:
atgaaccgcaagaagatgagagaggtgaaaaggaaactgctgcggtggcggcggccgattctgagtctggatatgattcgaatactaagccgaacacgccgtgggttgggcttggaagtctgatcaaaaccttcgcttccaagtcagaatcagtgatccagacctatcgccgcgacctggaggagtttggctcaggattgaagaaggagacggcggcgattcgggaggtcgccactcgggcggttcgcgatctaccgtcctcgctggaggcGggcgcgtcggtggcgcaggagtctcttgagtctgttgggcaggccatcgatgattttggtggatcagtgtggcgcggcactgcggagattatctccgagggtaaggatgccctcctcgccgctgattctgacgtcgagaccaattcctccgatctccagacgccttcctcctcggttgtgactgcctcggcctcgaagaggtacagccggtttgagacacaggttttggcaatgcaggcagatcccagtactttctcggaggagccagaggactcagaagatttccttaaatggaggactgagttcaagttggaggggaaggaggaggagatcgagattctttgCtatgacaatggaactctagaaggtctCtttgagaagctcgtgccttctgttgtggattatgacacattctggacacgttatttttacaagctttataagctcaagcaagcggaggatgtcagggccaatcttgttaagcgggcaatcgcaagggaggatgaagaagaggTtttgacctgggaggttgatgacgatgaagaTgatgggaagaaggaagaggaggcagagaagtatggtgaaggagaaagaaaagatgaaataaaaaaagaacatgtagatgataccaatCgcattgaattggtaccggagaagaaacctgatggggtaactgaagatttgatcttggaggttactgcagcgattgataatgaaatagccacatcatctgcgttagcagcCgatgatgccgaatcagccagcaatggatcaaccactaagccaggcgacaaagtgctccccgatgcaaaatctgagcctgtggaatcaAgcaaagatagtgacatatctattgtgtcaagccaggcctctatgccagaggaggaggatcttggatgggatgagattgaagatctgggcgatcatgatgataagaaagtgggtggaactagttcaacaacgaatagggcagatctccacaagaaacctagtcttttagaagaagatgacgatatggtgtcttgggatattga。
capital letters represent target sites.
The base sequence of the second standard sequence is shown as SEQ ID NO. 2:
agctttatagcaacagactcaccggagcaatcccgccggtgctcggaaactcgacgtcgcttacaattctgtcagtttatcgaaattcactctccggcaaggttccgccaactctcggcaagttctctgagctgcttgtacttgagctctcagagaatcagttctcaggggaattgccaaaagatacttgcactgcaggcaagttgctttatttcttagtgcttgacaatcagttttctggcgagctaccggagaattacgtgagGtgctggtctatgctgcgttttcgagtaaacaacaacgagctgggcggtgaagtAccaagcttgctctttgggcttccttatgcttccattattgatctgagcttcaatcattttcacggaaactttgcgaaatatataggaaatgccaagaatttatcagcactattcttgcagaacaataagttttctggcgggctgccgccggagatctcaaaagccgccagtttggtgaagatagatctcagcaataatcttttctcaggtccaattcccgctgaaatagggtacttgggcaagatgaaccagctttcgttgcaggggaacaagcttgactctgtcattcctgaatccctttctttgcttaagtccctcaatatgcttaacctctcaaaTaatctcctcacaggggagatacccaacagcctctgtgatatcctccccagttcactggacctttcaaacaaccagctttctggaccagttcctctccctcttatcaaagatggacttattgaaggggtttcaggcaatcctcgattgtgtgttccaatttatctcaatctcactgagccaattcttccactgtgtccacaacccagctttagaaagagactgagcggcatatgggccattttagtttctgcaattctgtcaattctcggggttctcttgctggttaagcgctggttgggcaagaagaacacgtttatcgagcgcgatcaactttcaaccgGctcgtctttcccctacgaagtcactaacttccacaagctaagctttgatcagcacgagataGcagaagggttgattCataaaaacattgttggtcatggaggatccggcaccgtctacaagatagaactaagtgatggtgaatcggttgccgtgaagaaattatggagaaaaagggcaaaggacgcttcgtccacagaaaagaagaattttgaaagggaactgagggcagaggtggagacactagggattatcagacacagaaacattgtaaagctctactgctacttatcaagcttagataccagtcttcttgtttatgagtacatgcctaatggAaacctctgggatgctcttcacaatgccgggaagttcctgagttggcctagcaggaatcggattgcgcttggggtagcgcagggactggcttaccttcaccatgatctcttgcaccccatcattcatcgagatattaagagctcaaacatactccttgatgcagatttcgagccaaaggttgcagattttggaatttccaaggtcttgcatgctgggatgaattacacagcatccaccactgtgattgccggcacccatggatacttagccccaggtaaatttattaagttcttaaccatttcttcatatggaatgttgttcactgcgtttatatcagaattatgcaaactaatagttgaatttcatggcagaatatgcctactccaccaaagcaaccacaaaatgtgatgta。
the base sequence of the third standard sequence is shown as SEQ ID NO. 3:
gaaagagtaccacctcaagatcagacagtagatccagtaatactccattgcacagttcagagcagccagtccttccctcttcaaacttgtgctcttcaccttcctcaaataatgagagtatttcttatgaaaaagaactctccatcactcatgcagatagggatgaaacatcaccatttcatcctaaatgcaaacaagatgaaagcactgctacaaatatgaattttctccataaagatgaagaaaatggaaaccagctgagacctggtcaacttagctttgataactcaaagtctcaagatctgctaaaatcatcttcgactcctctcaattttacttctactttgggcaatgtttcaaccgacttaaaatcacatactaatagaaggtcatatActtatgaGgctagcatctcttcaattgatgatgattctgttgatcatattctcaataaAaatcacttgatgtctatgagaactttcagacttcaaaggttttcaaaattagtcagtaaCatatcaaaggaaggagaagaagataatgttcagggtgaacatgaattcaatagaaTtccactgaaatcaagaactaatagtaatgaaagtgcagatgaaggcaatgcttgtccaaatagaaagctacagtttttaagaaGcaatcatcCtgcatacaGacaacgagcttcagttgagtctcttccattttcgagtcgagttgagtttgagacgaaccaaacatctcatttcaggggcccaaccttcatttcaaatgcatcgagaagtcggaagcaagGccgaattgagctatcgagcaacatgtatgatctcagaaatcttaatattggtcatcaccaatgctcttcacatccatcgcctagctcctgctgcagtagctcaaagtgtagttgtgcctgtaatatccaccaatgctttttaattgaagaagttgaaaagttgaagatgaaagacaaaaagtatcagacaaggcgccaatgcaggccaatttccaatggtgcgccatttgtgatatgcagccaatgctttgaactgcttcgattgcctatggactttttcatctcgaaaaagggatcaaataaacttcaatgtggctcttgttcaaaaatcctagtactgcaatttcctgctaaggactgctcaatatcaaacaactttgcttcttctaaaagttgtccacaagtgcttcaatcttctcattc。
wherein, the 272 th, 617 th, 644 th, 787 th, 818 th, 906 th, 1016 th and 1104 th bases (first target sites) of the first standard sequence are respectively: G. c, C, T, T, C, C and A.
The 396, 404, 455, 515, 571, 655, 664, 673 and 793 (third target site) bases of the third standard sequence are: A. g, A, C, T, G, C, G and G.
The present invention does not limit the base sequences of the sites other than the target site in the first standard sequence, the second standard sequence and the third standard sequence. That is, a sequence having at least 80% homology with the standard sequence described above but having a target site identical to the site described above may be used as the standard sequence for the purpose of the identification of the present invention.
In an optional embodiment, the dendrobine-containing dendrobe material with a dendrobine content equal to or higher than 0.2% by mass.
The inventor finds that the dendrobine content of the dendrobine material is generally higher than 0.2% in percentage by mass under the condition that the sequence of the target gene of the dendrobine material is consistent with the base sequence of the standard sequence at the target site. And if the sequence of the target gene of the dendrobium material is not completely consistent with the base sequence of the standard sequence at the target site, the dendrobium material has the dendrobine content of less than 0.2 percent by mass, even 0 percent by mass.
In an optional embodiment, the dendrobine-containing dendrobe material with a dendrobine content of 0.2-0.5% by mass.
In an optional embodiment, the dendrobium alkaloid content by mass is obtained by detecting dendrobium material in a dry weight state.
In an alternative embodiment, the dendrobine content in percentage by mass refers to the dendrobine content in the pseudobulb part.
In an alternative embodiment, in performing PCR amplification, the genomic DNA template used is extracted from the leaves, stems or flowers and fruits of the dendrobium material to be identified.
In another aspect, the invention provides a kit for identifying a dendrobine-containing dendrobe material, wherein the kit comprises:
amplifying a first primer pair or a second primer pair of a first target gene by PCR;
amplifying a third primer pair or a fourth primer pair of a second target gene by PCR;
amplifying a fifth primer pair or a sixth primer pair of a third target gene by PCR;
the base sequence of the first primer pair is shown as SEQ ID NO.4-5, the base sequence of the second primer pair is shown as SEQ ID NO.6-7, the base sequence of the third primer pair is shown as SEQ ID NO.8-9, the base sequence of the fourth primer pair is shown as SEQ ID NO.10-11, the base sequence of the fifth primer pair is shown as SEQ ID NO.12-13, and the base sequence of the sixth primer pair is shown as SEQ ID NO. 14-15.
In an alternative embodiment, the kit further comprises a PCR reaction buffer.
In an alternative embodiment, the PCR reaction Buffer contains PCR Buffer, dNTPS and DNA polymerase.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 shows the result of agarose gel electrophoresis of 12 dendrobe DNA samples amplified using a first primer pair.
FIG. 2 shows the result of agarose gel electrophoresis of 12 dendrobe DNA samples amplified using the fourth primer pair.
FIG. 3 shows the result of agarose gel electrophoresis of 12 dendrobe DNA samples amplified using the sixth primer pair.
FIG. 4 shows the partial sequencing result of the first target gene fragment of sample No. 69, where 245 th of the peak position is relative to the target site 272.
FIG. 5 shows the partial sequencing result of the first target gene fragment of sample No. 69, in which the 231/258/401/432/520/630/718 th positions of the peak map position correspond to the 617/644/787/818/906/1016/1104 target positions, respectively.
FIG. 6 shows the partial sequencing result of the second target gene fragment of sample No. 69, in which the 240/294/633 th positions of the peak map position correspond to the 266/320/659 th target positions, respectively.
FIG. 7 shows the partial sequencing result of the second target gene fragment of sample No. 69, in which the 414/1062/1077 th positions of the peak map position correspond to the 1000/1062/1077 th target positions, respectively.
FIG. 8 shows the partial sequencing result of the second target gene fragment of sample No. 69, in which the 616 th position of the peak map corresponds to the target site 1337.
FIG. 9 shows the partial sequencing result of the third target gene fragment of sample No. 69, in which the positions 233/241/292/352/408/492/501/510/630 of the peak map correspond to the target sites 396/404/455/515/571/655/664/673/793, respectively.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
The identification method of the dendrobium material with high dendrobine content provided by the embodiment comprises the following steps:
(1) extraction of DNA
Plant genome DNA extraction kit (CW0553M) adopting Kangshi century
1. Taking a 2.0ml EP tube, adding 700ul Buffer GP1 and 10ul beta-mercaptoethanol, mixing uniformly, centrifuging instantaneously, and preheating in a water bath kettle at 65 ℃.
2. The mortar and spoon were pre-cooled with liquid nitrogen.
3. Wiping forceps and blades with 75% ethanol, cutting fresh tissue (leaf, stem or flower and fruit) of herba Dendrobii to be identified to about 0.1g, grinding into powder with liquid nitrogen, rapidly taking out, adding into preheated EP tube, reversing, mixing, and marking.
4. After all samples had been ground, a water bath was run at 65 ℃ for 30min, during which the phase was reversed 1 time every 5 min.
5. 10ul of 10mg/ml RNase A solution (purchased from KANG, century, CW0600) was added to each tube, agitated and mixed up and down, and allowed to stand at room temperature for 10 min.
6. Adding 700ul chloroform, shaking up and down, mixing uniformly, and centrifuging at 12,000rpm for 5 min.
7. During centrifugation, a new 2.0ml EP tube and an adsorption column filled in the collection tube are prepared and marked.
8. After centrifugation, approximately 500ul of the resulting upper aqueous phase was transferred to a corresponding 2.0ml EP tube, 700ul of Buffer GP2 was added, inverted 20 times and mixed well.
9. Adding all the solution obtained in the above steps into prepared adsorption column filled into the collecting tube, centrifuging at 2,000rpm for 1min, pouring off waste liquid in the collecting tube, and replacing the adsorption column into the collecting tube. (adding 700ul of the solution into the adsorption column for the first time, centrifuging at 12,000rpm for 1min, pouring the waste liquid out of the collection tube, replacing the adsorption column into the collection tube, adding the rest solution into the adsorption column for the second time, centrifuging at 12,000rpm for 1min, pouring the waste liquid out of the collection tube, and replacing the adsorption column into the collection tube.)
10. 500ul of Buffer GW1 (to check whether absolute ethanol was added before use) was added to the adsorption column, centrifuged at 12,000rpm for 1min, the waste liquid in the collection tube was discarded, and the adsorption column was replaced in the collection tube.
11. 500ul of Buffer GW2 (to check whether absolute ethanol was added before use) was added to the adsorption column, centrifuged at 12,000rpm for 1min, the waste liquid in the collection tube was discarded, and the adsorption column was replaced in the collection tube.
12. The above step 11 is repeated.
13. Centrifuge at 12,000rpm for 2min and discard the collection tube. The column was placed in a new labeled 1.5ml centrifuge tube and the tube was opened for 10min at room temperature to allow for thorough air drying.
14. 100ul Buffer GE was suspended in the middle of the adsorption column, incubated in a 56 ℃ water bath for 15min, centrifuged at 10,000rpm for 2min, and the DNA solution was collected.
15. 3ul of DNA solution is taken, 1.0% agarose gel is used for electrophoresis for 30min at 160v, a gel imaging system is used for detecting the quality of DNA, and the rest is placed in a refrigerator at the temperature of 20 ℃ below zero for storage.
(2) PCR amplification
Amplifying the first target gene sequence using the first primer pair or the second primer pair;
amplifying a second target gene sequence using the third primer pair or the fourth primer pair;
amplifying the third target gene sequence using the fifth primer pair or the sixth primer pair;
the base sequence of the first primer pair is shown as SEQ ID NO.4-5, the base sequence of the second primer pair is shown as SEQ ID NO.6-7, the base sequence of the third primer pair is shown as SEQ ID NO.8-9, the base sequence of the fourth primer pair is shown as SEQ ID NO.10-11, the base sequence of the fifth primer pair is shown as SEQ ID NO.12-13, and the base sequence of the sixth primer pair is shown as SEQ ID NO. 14-15.
SEQ ID NO.4：AGAGAGGTGAAAAGGAAACTGC；
SEQ ID NO.5：TAGTTCCACCCACTTTCTTATC；
SEQ ID NO.6：ATGAACCGCAAGAAGATGAG；
SEQ ID NO.7：TCAATATCCCAAGACACCAT；
SEQ ID NO.8：AGCTTTATAGCAACAGACTC；
SEQ ID NO.9：TACATCACATTTTGTGGTTG；
SEQ ID NO.10：ACTCTCGGCAAGTTCTCTGA；
SEQ ID NO.11：TGTGTAGTTCATCCCAGCAT；
SEQ ID NO.12：GAAAGAGTACCACCTCAAGA；
SEQ ID NO.13：GTCCATAGGCAATCGAAGCA；
SEQ ID NO.14：AAGCACTCTCCATCACTCAT；
SEQ ID NO.15：GAATGAGAAGATTGAAGCAC。
In this embodiment, the first primer pair, the fourth primer pair and the sixth primer pair are preferably used to perform PCR amplification on the dendrobe DNA sample obtained by the previous extraction step. If amplification is not optimal, amplification is performed using another pair of primers.
PCR was amplified using KOD FX high fidelity polymerase (TOYOBO CO., LTDLife Science Department). The reaction was carried out in 40. mu.l total, including 2 XPCR Buffer 20. mu.l, 2mM dNTPS 8. mu.l, upstream and downstream primers (10. mu. mol/L) each 2. mu.l, KOD FX polymerase (1.0U/. mu.l) 0.8. mu.l, and DNA template 50 ng.
The PCR reaction program is: pre-denaturation at 94 ℃ for 2min, denaturation at 98 ℃ for 15s, annealing at 50 ℃ for 30s, extension at 68 ℃ for 1min30s, 35 cycles, and final extension at 68 ℃ for 5 min.
After the PCR reaction is finished, the quality of the product is detected to meet the Sanger sequencing requirement through agarose gel electrophoresis, and the product is recycled for sequencing.
(3) The sequencing is carried out, and the sequence is determined,
sequencing the obtained amplification product to respectively obtain the sequences of the first target gene, the second target gene and the third target gene of the sample.
(4) Identification
Comparing the sequence of the target gene of the dendrobium to be identified with a standard sequence, and if the following conditions (a) - (c) are met, indicating that the dendrobium material to be identified is the dendrobium material with the dendrobium alkali content higher than 0.2% (mass percentage, calculated by dry weight);
(a) the first target gene corresponds to the base sequence of the first standard sequence at positions 272, 617, 644, 787, 818, 906, 1016 and 1104, that is, the base sequences at positions 272, 617, 644, 787, 818, 906, 1016 and 1104 are respectively: G. c, C, T, T, C, C and A;
(b) the second target gene corresponds to the base sequence of the second standard sequence at positions 266, 320, 659, 1000, 1062, 1077 and 1337, i.e., the bases at positions 266, 320, 659, 1000, 1062, 1077 and 1337 are: G. a, T, G, G, C and A;
(c) the second target gene is identical to the third standard sequence in the base sequences at positions 396, 404, 455, 515, 571, 655, 664, 673 and 793, i.e., the bases at positions 396, 404, 455, 515, 571, 655, 664, 673 and 793 are: A. g, A, C, T, G, C, G and G.
Wherein the base sequences of the first standard sequence, the second standard sequence and the third standard sequence are respectively shown as SEQ ID NO. 1-3.
By adopting the method, a large batch of dendrobium materials can be identified simultaneously, the identification can be completed only by PCR amplification, sequencing and comparison of the identification, and the method has the characteristics of simple operation, quick time and accurate result.
Experimental example 1
The method of example 1 is adopted to identify 113 dendrobium materials
The information of 113 dendrobium materials is shown in table 1, the dendrobium alkali content detected by the existing method is dried to constant weight at 60 ℃, and then the dendrobium alkali is detected according to the method specified in pharmacopoeia of the people's republic of China (2015), and the detected part is pseudobulb, which is shown in table 1.
TABLE 1113 Dendrobium material information and dendrobine content thereof
The method of example 1 is adopted to identify the 113 dendrobium materials, the electrophoresis results of a part of samples are shown in fig. 1-3, the size of the first target gene fragment is about 1506bp, the size of the second target gene fragment is about 1455bp, the size of the third target gene fragment is about 1084bp, the sequencing results are shown in fig. 4-9, and the sequence comparison results are shown in table 2.
Table 2 identification results of 113 dendrobium materials by the method of example 1
In the table: "+" indicates no sequencing and "-" indicates deletion of the site.
The data in table 2 show that the three target genes of the Dendrobium nobile material numbered 40(Dendrobium findlayanum), 60(Dendrobium linayanum) and 69(Dendrobium nonbile var alba) are completely consistent with the target site base sequences of the three standard sequences, respectively, and then according to the detection result, the Dendrobium nobile material numbered 40(Dendrobium findlayanum), 60(Dendrobium linayanum) and 69(Dendrobium nonbile var alba) can be considered to have the Dendrobium nobile base content higher than 0.2% by the method of example 1; the identification result is consistent with the result in table 1, and table 1 shows that the Dendrobium nobile variety (Dendrobium nobile var alba) nobile content of number 69 is 0.4651%, the Dendrobium nobile (Dendrobium linawianum) nobile content of number 60 is 0.2875%, the Dendrobium nobile (Dendrobium findlayanum) nobile content of number 40 is 0.2382%, and the result accuracy can reach 100%. Therefore, the identification method provided in example 1 can identify the dendrobium material with high content, especially dendrobium alkali content higher than 0.2%.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> southern China university of agriculture
GUANGZHOU MEIHUJIAN BIOTECHNOLOGY Co.,Ltd.
GUANGZHOU SCGENE TECHNOLOGY Co.,Ltd.
<120> identification method and kit for dendrobium material with high dendrobine content
<160> 15
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1306
<212> DNA
<213> Artificial sequence
<400> 1
atgaaccgca agaagatgag agaggtgaaa aggaaactgc tgcggtggcg gcggccgatt 60
ctgagtctgg atatgattcg aatactaagc cgaacacgcc gtgggttggg cttggaagtc 120
tgatcaaaac cttcgcttcc aagtcagaat cagtgatcca gacctatcgc cgcgacctgg 180
aggagtttgg ctcaggattg aagaaggaga cggcggcgat tcgggaggtc gccactcggg 240
cggttcgcga tctaccgtcc tcgctggagg cgggcgcgtc ggtggcgcag gagtctcttg 300
agtctgttgg gcaggccatc gatgattttg gtggatcagt gtggcgcggc actgcggaga 360
ttatctccga gggtaaggat gccctcctcg ccgctgattc tgacgtcgag accaattcct 420
ccgatctcca gacgccttcc tcctcggttg tgactgcctc ggcctcgaag aggtacagcc 480
ggtttgagac acaggttttg gcaatgcagg cagatcccag tactttctcg gaggagccag 540
aggactcaga agatttcctt aaatggagga ctgagttcaa gttggagggg aaggaggagg 600
agatcgagat tctttgctat gacaatggaa ctctagaagg tctctttgag aagctcgtgc 660
cttctgttgt ggattatgac acattctgga cacgttattt ttacaagctt tataagctca 720
agcaagcgga ggatgtcagg gccaatcttg ttaagcgggc aatcgcaagg gaggatgaag 780
aagaggtttt gacctgggag gttgatgacg atgaagatga tgggaagaag gaagaggagg 840
cagagaagta tggtgaagga gaaagaaaag atgaaataaa aaaagaacat gtagatgata 900
ccaatcgcat tgaattggta ccggagaaga aacctgatgg ggtaactgaa gatttgatct 960
tggaggttac tgcagcgatt gataatgaaa tagccacatc atctgcgtta gcagccgatg 1020
atgccgaatc agccagcaat ggatcaacca ctaagccagg cgacaaagtg ctccccgatg 1080
caaaatctga gcctgtggaa tcaagcaaag atagtgacat atctattgtg tcaagccagg 1140
cctctatgcc agaggaggag gatcttggat gggatgagat tgaagatctg ggcgatcatg 1200
atgataagaa agtgggtgga actagttcaa caacgaatag ggcagatctc cacaagaaac 1260
ctagtctttt agaagaagat gacgatatgg tgtcttggga tattga 1306
<210> 2
<211> 1749
<212> DNA
<213> Artificial sequence
<400> 2
agctttatag caacagactc accggagcaa tcccgccggt gctcggaaac tcgacgtcgc 60
ttacaattct gtcagtttat cgaaattcac tctccggcaa ggttccgcca actctcggca 120
agttctctga gctgcttgta cttgagctct cagagaatca gttctcaggg gaattgccaa 180
aagatacttg cactgcaggc aagttgcttt atttcttagt gcttgacaat cagttttctg 240
gcgagctacc ggagaattac gtgaggtgct ggtctatgct gcgttttcga gtaaacaaca 300
acgagctggg cggtgaagta ccaagcttgc tctttgggct tccttatgct tccattattg 360
atctgagctt caatcatttt cacggaaact ttgcgaaata tataggaaat gccaagaatt 420
tatcagcact attcttgcag aacaataagt tttctggcgg gctgccgccg gagatctcaa 480
aagccgccag tttggtgaag atagatctca gcaataatct tttctcaggt ccaattcccg 540
ctgaaatagg gtacttgggc aagatgaacc agctttcgtt gcaggggaac aagcttgact 600
ctgtcattcc tgaatccctt tctttgctta agtccctcaa tatgcttaac ctctcaaata 660
atctcctcac aggggagata cccaacagcc tctgtgatat cctccccagt tcactggacc 720
tttcaaacaa ccagctttct ggaccagttc ctctccctct tatcaaagat ggacttattg 780
aaggggtttc aggcaatcct cgattgtgtg ttccaattta tctcaatctc actgagccaa 840
ttcttccact gtgtccacaa cccagcttta gaaagagact gagcggcata tgggccattt 900
tagtttctgc aattctgtca attctcgggg ttctcttgct ggttaagcgc tggttgggca 960
agaagaacac gtttatcgag cgcgatcaac tttcaaccgg ctcgtctttc ccctacgaag 1020
tcactaactt ccacaagcta agctttgatc agcacgagat agcagaaggg ttgattcata 1080
aaaacattgt tggtcatgga ggatccggca ccgtctacaa gatagaacta agtgatggtg 1140
aatcggttgc cgtgaagaaa ttatggagaa aaagggcaaa ggacgcttcg tccacagaaa 1200
agaagaattt tgaaagggaa ctgagggcag aggtggagac actagggatt atcagacaca 1260
gaaacattgt aaagctctac tgctacttat caagcttaga taccagtctt cttgtttatg 1320
agtacatgcc taatggaaac ctctgggatg ctcttcacaa tgccgggaag ttcctgagtt 1380
ggcctagcag gaatcggatt gcgcttgggg tagcgcaggg actggcttac cttcaccatg 1440
atctcttgca ccccatcatt catcgagata ttaagagctc aaacatactc cttgatgcag 1500
atttcgagcc aaaggttgca gattttggaa tttccaaggt cttgcatgct gggatgaatt 1560
acacagcatc caccactgtg attgccggca cccatggata cttagcccca ggtaaattta 1620
ttaagttctt aaccatttct tcatatggaa tgttgttcac tgcgtttata tcagaattat 1680
gcaaactaat agttgaattt catggcagaa tatgcctact ccaccaaagc aaccacaaaa 1740
tgtgatgta 1749
<210> 3
<211> 1216
<212> DNA
<213> Artificial sequence
<400> 3
gaaagagtac cacctcaaga tcagacagta gatccagtaa tactccattg cacagttcag 60
agcagccagt ccttccctct tcaaacttgt gctcttcacc ttcctcaaat aatgagagta 120
tttcttatga aaaagaactc tccatcactc atgcagatag ggatgaaaca tcaccatttc 180
atcctaaatg caaacaagat gaaagcactg ctacaaatat gaattttctc cataaagatg 240
aagaaaatgg aaaccagctg agacctggtc aacttagctt tgataactca aagtctcaag 300
atctgctaaa atcatcttcg actcctctca attttacttc tactttgggc aatgtttcaa 360
ccgacttaaa atcacatact aatagaaggt catatactta tgaggctagc atctcttcaa 420
ttgatgatga ttctgttgat catattctca ataaaaatca cttgatgtct atgagaactt 480
tcagacttca aaggttttca aaattagtca gtaacatatc aaaggaagga gaagaagata 540
atgttcaggg tgaacatgaa ttcaatagaa ttccactgaa atcaagaact aatagtaatg 600
aaagtgcaga tgaaggcaat gcttgtccaa atagaaagct acagttttta agaagcaatc 660
atcctgcata cagacaacga gcttcagttg agtctcttcc attttcgagt cgagttgagt 720
ttgagacgaa ccaaacatct catttcaggg gcccaacctt catttcaaat gcatcgagaa 780
gtcggaagca aggccgaatt gagctatcga gcaacatgta tgatctcaga aatcttaata 840
ttggtcatca ccaatgctct tcacatccat cgcctagctc ctgctgcagt agctcaaagt 900
gtagttgtgc ctgtaatatc caccaatgct ttttaattga agaagttgaa aagttgaaga 960
tgaaagacaa aaagtatcag acaaggcgcc aatgcaggcc aatttccaat ggtgcgccat 1020
ttgtgatatg cagccaatgc tttgaactgc ttcgattgcc tatggacttt ttcatctcga 1080
aaaagggatc aaataaactt caatgtggct cttgttcaaa aatcctagta ctgcaatttc 1140
ctgctaagga ctgctcaata tcaaacaact ttgcttcttc taaaagttgt ccacaagtgc 1200
ttcaatcttc tcattc 1216
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence
<400> 4
agagaggtga aaaggaaact gc 22
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence
<400> 5
tagttccacc cactttctta tc 22
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
atgaaccgca agaagatgag 20
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<400> 7
tcaatatccc aagacaccat 20
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<400> 8
agctttatag caacagactc 20
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<400> 9
tacatcacat tttgtggttg 20
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<400> 10
actctcggca agttctctga 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<400> 11
tgtgtagttc atcccagcat 20
<210> 12
<211> 20
<212> DNA
<213> Artificial sequence
<400> 12
gaaagagtac cacctcaaga 20
<210> 13
<211> 20
<212> DNA
<213> Artificial sequence
<400> 13
gtccataggc aatcgaagca 20
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence
<400> 14
aagcactctc catcactcat 20
<210> 15
<211> 20
<212> DNA
<213> Artificial sequence
<400> 15
gaatgagaag attgaagcac 20
Claims (8)
1. The identification method of the dendrobium material with high dendrobine content is characterized by comprising the following steps:
a comparison step: comparing the sequence of a target gene of the dendrobium material to be identified with a standard sequence, and if the sequence of the target gene is completely consistent with the base sequence of the standard sequence at a target site, indicating that the dendrobium to be identified is the dendrobium material with high dendrobine content;
the target gene comprises: a first target gene, a second target gene, and a third target gene; wherein the sequence of the first target gene is obtained by PCR amplification and sequencing of a first primer pair or a second primer pair; the sequence of the second target gene is obtained by PCR amplification and sequencing of a third primer pair or a fourth primer pair; the sequence of the third target gene is obtained by PCR amplification and sequencing of a fifth primer pair or a sixth primer pair;
the base sequence of the first primer pair is shown as SEQ ID NO.4-5, the base sequence of the second primer pair is shown as SEQ ID NO.6-7, the base sequence of the third primer pair is shown as SEQ ID NO.8-9, the base sequence of the fourth primer pair is shown as SEQ ID NO.10-11, the base sequence of the fifth primer pair is shown as SEQ ID NO.12-13, and the base sequence of the sixth primer pair is shown as SEQ ID NO. 14-15;
the standard sequence comprises: a first standard sequence, a second standard sequence, and a third standard sequence; the target sites comprise a first target site, a second target site and a third target site; 272, 617, 644, 787, 818, 906, 1016 and 1104 of the first standard sequence are the first target site, and the bases thereof are: G. c, C, T, T, C, C and A; positions 266, 320, 659, 1000, 1062, 1077 and 1337 of the second standard sequence are the second target site, and the bases thereof are: G. a, T, G, G, C and A; positions 396, 404, 455, 515, 571, 655, 664, 673 and 793 of the third standard sequence are the third target site, and the bases thereof are: A. g, A, C, T, G, C, G and G;
when comparing, the first target gene is compared to the first standard sequence, the second target gene is compared to the second standard sequence, and the third target gene is compared to the third standard sequence; the base sequence of the first standard sequence is shown as SEQ ID NO.1, the base sequence of the second standard sequence is shown as SEQ ID NO.2, and the base sequence of the third standard sequence is shown as SEQ ID NO. 3; the dendrobium material with high dendrobine content is a dendrobium material with the dendrobine content equal to or higher than 0.2 percent in percentage by mass.
2. The method for identifying the dendrobine-containing dendrobe material as claimed in claim 1, wherein the dendrobine-containing dendrobe material is a dendrobine-containing dendrobe material with a mass percentage of 0.2% -0.5%.
3. The method for identifying dendrobium nobile material with high dendrobine content according to claim 1, wherein the mass percentage content of dendrobine refers to the dendrobine content of pseudobulb part.
4. The method for identifying the dendrobium material with high dendrobine content according to claim 1, wherein the mass percentage content of dendrobine is detected by dry weight of the dendrobium material.
5. The method for identifying dendrobium nobile material with high dendrobine content in claim 1, wherein the genomic DNA template used in PCR amplification is extracted from leaves, stems or flowers and fruits of the dendrobium nobile material to be identified.
6. A kit for identifying a dendrobium material with high dendrobine content is characterized by comprising:
amplifying a first primer pair or a second primer pair of a first target gene by PCR;
amplifying a third primer pair or a fourth primer pair of a second target gene by PCR;
amplifying a fifth primer pair or a sixth primer pair of a third target gene by PCR;
the base sequence of the first primer pair is shown as SEQ ID NO.4-5, the base sequence of the second primer pair is shown as SEQ ID NO.6-7, the base sequence of the third primer pair is shown as SEQ ID NO.8-9, the base sequence of the fourth primer pair is shown as SEQ ID NO.10-11, the base sequence of the fifth primer pair is shown as SEQ ID NO.12-13, and the base sequence of the sixth primer pair is shown as SEQ ID NO. 14-15; the dendrobium material with high dendrobine content is a dendrobium material with the dendrobine content equal to or higher than 0.2 percent in percentage by mass.
7. The kit of claim 6, wherein the kit further comprises a PCR reaction buffer.
8. The kit of claim 7, wherein the PCR reaction Buffer comprises PCR Buffer, dNTPS and DNA polymerase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010841238.2A CN111893206B (en) | 2020-08-20 | 2020-08-20 | Identification method and kit for dendrobium material with high dendrobine content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010841238.2A CN111893206B (en) | 2020-08-20 | 2020-08-20 | Identification method and kit for dendrobium material with high dendrobine content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111893206A CN111893206A (en) | 2020-11-06 |
| CN111893206B true CN111893206B (en) | 2021-07-27 |
Family
ID=73229187
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010841238.2A Active CN111893206B (en) | 2020-08-20 | 2020-08-20 | Identification method and kit for dendrobium material with high dendrobine content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111893206B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101735231A (en) * | 2010-01-20 | 2010-06-16 | 遵义医学院 | Method for extracting purified dendrobine from dendrobium stem |
| CN107333651A (en) * | 2017-07-03 | 2017-11-10 | 福建农林大学 | A kind of method for improving Dendrobidium huoshanness protocorm alkaloid |
-
2020
- 2020-08-20 CN CN202010841238.2A patent/CN111893206B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101735231A (en) * | 2010-01-20 | 2010-06-16 | 遵义医学院 | Method for extracting purified dendrobine from dendrobium stem |
| CN107333651A (en) * | 2017-07-03 | 2017-11-10 | 福建农林大学 | A kind of method for improving Dendrobidium huoshanness protocorm alkaloid |
Non-Patent Citations (1)
| Title |
|---|
| Development of EST-derived markers in Dendrobium from EST of related taxa;Narisa Juejun等;《Songklanakarin J. Sci. Technol.》;20130430;第35卷(第2期);149-158 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111893206A (en) | 2020-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101516190B1 (en) | SSR primer sets for discrimination of oriental melon line or cultivar and uses thereof | |
| Diaz et al. | Identification of Phoenix dactylifera L. varieties based on amplified fragment length polymorphism (AFLP) markers | |
| CN109112230B (en) | ISSR-SCAR marker capable of identifying stylosanthes guianensis pollen sterility gene and identification method thereof | |
| CN112063738B (en) | Molecular marker of gene related to growth of populus tomentosa, screening method, kit and application | |
| CN111893206B (en) | Identification method and kit for dendrobium material with high dendrobine content | |
| CN115852028B (en) | Triple PCR primer group, kit and detection method for detecting rice blast fungus non-toxic genes | |
| CN104988240B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs16287910 | |
| CN106957923B (en) | Universal primer for identifying species of pathogenic bacteria of potato scab and detection method | |
| KR101940286B1 (en) | Primer Set for Identifying Maternal origin of Ilex x wandoensis and Uses Thereof | |
| CN113025724B (en) | Dual PCR primer, method and kit for identifying small pissodes punctatus | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN111876521B (en) | Identification method of SNP locus of biosynthesis gene of medicinal plant active compound | |
| CN109456967B (en) | Specific nucleotide, labeled primer and identification method of physalis macrocarpa | |
| CN111315764B (en) | Petal purpurin and coding gene thereof | |
| KR20130091850A (en) | Snp primer for discrimination of chunpoong cultivar of panax ginseng c.a. meyer and method for discriminating the chunpoong cultivar using the same | |
| CN113637784A (en) | SSR molecular marker AerM02 for sex identification of actinidia arguta and application thereof | |
| CN111979352A (en) | System for detecting pinellia ternata infecting virus by mRT-PCR and application thereof | |
| CN111996274A (en) | Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing | |
| CN110453004B (en) | Method for identifying sterile stylosanthes guianensis by using ISSR-SCAR marker | |
| CN105063202A (en) | Method for identification of bee colony royal jelly high yield characters by SNP marker rs4208349 | |
| CN114350776B (en) | Asparagus male specific primer and biological sex identification method | |
| JP6220332B2 (en) | Hop variety identification method | |
| CN111690658B (en) | DNA extraction and identification method of oviductus ranae | |
| CN114717359B (en) | Lily virus LCrV-1 specific detection target sequence, kit and detection method | |
| CN110331230B (en) | Marker primer pair of post flower sterility gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |