KR20130091850A - Snp primer for discrimination of chunpoong cultivar of panax ginseng c.a. meyer and method for discriminating the chunpoong cultivar using the same - Google Patents

Abstract

PURPOSE: A single nucleotide polymorphism (SNP) primer for determining the variety of Panax ginseng C.A. Meyer and a primer set by the combination thereof are provided to effectively distinguish Chunpoong from different varieties of Panax ginseng C.A. Meyer through PCR analysis, to effectively select breeding resources of the new variety, and to prevent entrance of different varieties of Panax ginseng C.A. Meyer. CONSTITUTION: A gene of Auxin repressed protein for determining the variety of Panax ginseng C.A. Meyer is selected among sequences of sequence numbers 1-10. An SNP primer for determining the variety of Panax ginseng C.A. Meyer specifically amplifies the gene of auxin repressed protein of sequence number 1. The SNP primer does not specifically amplify one or more genes of auxin repressed protein of sequence numbers 2-10. A method for determining the variety of Panax ginseng C.A. Meyer comprises the steps of: extracting DNA from a ginseng sample; performing PCR using the SNP primer and preparing a PCR product; and analyzing the length of the PCR product. [Reference numerals] (AA) Positive marker; (BB) Negative marker

Description

SNP primer for discriminating Korean ginseng thunder cultivar and method for discriminating Korean ginseng thunder cultivar using same {SNP primer for discrimination of Chunpoong cultivar of Panax ginseng C.A. Meyer and method for discriminating the Chunpoong cultivar using the same}

The present invention relates to a SNP primer for discriminating Korean ginseng thunderstorm varieties and a method for discriminating Korean ginseng thunderstorm varieties using the same.

The pharmacological component of ginseng was Panax , 1854 quinquefolius ) The scientific research on the active ingredient of ginseng began by separating the amorphous substance, which is a kind of saponin mixture from the root, and the research of chemical active ingredient of ginseng began in earnest by the Brekhman of Soviet Union in 1957. By emphasizing that it is an active ingredient, intensive research on saponins was conducted, and many studies were actively conducted in the biochemical field by the 1960s. Currently, the National Center for Biotechnology Information (NCBI) has registered genetic information on 15 species of ginseng plants belonging to the genus Araliaceae Panax . Among them, Korean ginseng ( Panax) is commercialized and grown. ginseng CA Meyer, Panax of China notoginseng FH Chen, Panax of Japan japonicus CA Meyer, and Panax ginseng in the United States and Canada quinquefolium L.).

Korean ginseng cultivation status in Korea is mainly cultivated as Jakyungjong, a traditional mixed species before breeding. Since the viscera do some fertilization, each individual has different characteristics of the stem and leaves, which are the main traits of the ground, and these characteristics have different characteristics in the growth such as bud, frontal lobe, flowering and fruiting. I can't. Therefore, in order to grow high-purity and stable ginseng, the breeding has been attempted by individual selection, starting with Gimpo, Ganghwa, and Pocheon since 1965. The strains were promulgated through the 2nd and 3rd generation propagation process and tested for productivity test to select promising strains with high possibility of excellent varieties. The selected system was subjected to a regional adaptation test and finally verified the productivity by performing an cultivation test in a farm. Through this process, the first Korean ginseng varieties such as Cheonpung and Yeonpung were registered in Korea for the first time in 1998. Since 2000, new varieties such as Old Wind, Geumpung and Whirlwind have been registered continuously (Kwon et. al ., J. Ginseng Res. 22 (4): 244-251, 1998; Kwon et al ., J. Ginseng Res. 24 (1): 1-7, 2000).

Compared with other new varieties, the Tianfeng varieties are the most popular ginseng varieties, which are most suitable for the production of red ginseng because of their excellent growth and uniformity. However, it has been reported that the purity rate is low at 67% and new seed management measures are needed (Lee et. al ., The Korean Society of Ginseng, 3-18, 2005). In addition, because the typhoon varieties are registered by the morphological distinction method and there is no genetic marker, it is difficult to prevent a decrease in purity rate due to incorporation of external seeds.

Molecular biological methods currently used to distinguish ginseng varieties are mainly random amplified polymorphic DNA (RAPD), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). , Multiplex PCR, inter simple sequence repeat (ISSR), and the like. However, these methods are difficult to distinguish between varieties of ginseng with close relationship because of difficulty in selecting specific markers and reproducible results.

On the other hand, single nucleotide polymorphism (SNP) method has been widely used in human disease diagnosis and new drug development. The SNP refers to a single base variation known as a cause of genetic variation, and in humans, it is represented at a ratio of 1,200 to 1,500 bp in bases, and since the SNP marker is present at a high ratio, it is an individual of the genome with high accuracy and resolution. It is very useful for deciphering the differences between livers. These comparative studies of SNPs suggest new breakthroughs in species evolution and phylogenetic studies, and are reported to cause differences in disease resistance. However, it is not easy to find SNPs that can distinguish similar varieties that have been grown by short-term separation of ginseng as mixed breeds like ginseng.However, there is no known method for efficiently producing SNP primers. There is. Even if only 70-80% of the primers are similar, it is highly likely to hybridize with the mother DNA, which makes it difficult to construct and utilize SNP primers with different nucleotide sequences. In addition, in Korea, there is no research on SNPs targeting cultivated crops, so it is urgently required to secure genetic resources. Therefore, in order to shorten the time period for breeding varieties of ginseng and to clearly distinguish the varieties in the distribution process of root ginseng, there is an urgent need for the development of genetic molecular markers capable of discriminating specific varieties of Korean ginseng.

An object of the present invention is to clarify the distinction between ginseng varieties closely related to the flexible relationship, genes that can accurately determine the hurricane among the currently grown Korean ginseng varieties, SNP primers to specifically amplify the gene and Korean ginseng using the same It is to provide a method for distinguishing a typhoon variety.

In order to achieve the above object, the present invention provides a Auxin repressed protein gene for determining the ginseng variety selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 10.

Auxin repressed protein gene described in SEQ ID NO: 1 is derived from the Korean ginseng natural wind varieties, SEQ ID NO: 2 to SEQ ID NO: 10 are the old wind, lotus, sensation, sailor, good luck, incense, blue, gold and Hwagisam ( P) . is derived from quinquefolius).

In a preferred embodiment of the present invention, in order to develop molecular markers for discriminating Korean ginseng thunderstorm varieties, 6,000 EST data were analyzed through the root tissue EST analysis of thunderstorm and viscera species (see Table 1). To select candidate genes for marker selection, the genes expressed in the roots of the typhoon and the viscera were selected and compared. The Auxin repressed protein gene was found to be capable of detecting a typhoon specific SNP that can distinguish the typhoon. The gene was selected as the target gene because it was judged high. As a result of amplifying the Auxin repressed protein gene in actual ginseng and other varieties of ginseng, the genes isolated from the typhoon were identified as the other varieties SEQ ID NOs: 2 to 10, which are described by the old winds, gusts, whirlwinds, and sailors. Compared with the gene sequences of Sunun, Sunhyang, Blue Sun, Geumpung and Hwagisam, it was confirmed to have a single base polymorphism at various sites on the base sequence (see FIG. 2). Therefore, the gene described in SEQ ID NO: 1, which is a thunder-derived Auxin repressed protein gene, contains a SNP that can be distinguished from other varieties, and thus may be usefully used as a marker gene for thunder.

In addition, the present invention can specifically amplify the typhoon-derived Auxin repressed protein gene described in SEQ ID NO: 1, the old wind selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10, gusts, whirlwinds, sailors, sun clouds, One or more Auxin repressed protein genes derived from Hyanghyang, Cheongseon, Geumpung and Hwagisam provide SNP primers for discriminating Korean ginseng thunderstorm varieties composed of polynucleotides that cannot be specifically amplified.

The SNP primer may specifically bind to and amplify the polynucleotide represented by SEQ ID NO: 1, and may be 15 to 50 mer designed not to bind to any one or more genes selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10. All polynucleotides of length, preferably 15 to 30 mer in length, more preferably 18 to 25 mer in length, can be used, but most preferably at least one polynucleotide selected from the group consisting of SEQ ID NO: 11 to SEQ ID NO: 15 desirable.

In addition, the present invention can not specifically amplify the typhoon-derived Auxin repressed protein gene described in SEQ ID NO: 1, and are selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10 One or more Auxin repressed protein genes derived from Hyanghyang, Cheongseon, Geumpung and Hwagisam provide SNP primers for discriminating Korean ginseng thunderstorm varieties composed of polynucleotides that can be specifically amplified.

The SNP primer is unable to bind to the polynucleotide described in SEQ ID NO: 1 and cannot amplify it, so that it can specifically bind to and amplify any one or more genes selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10 Designed 15 to 50 mer long, preferably 15 to 30 mer long, more preferably 18 to 25 mer long polynucleotides are all available, but most preferably the polynucleotides set forth in SEQ ID NO: 16 or SEQ ID NO: 17 Do.

If the length of the primer of the present invention is too short, it is not specific to the desired sequence, and if it is too long, it may be mismatched, so it is preferable to have a length of 18 to 25 mer, but is not limited thereto. In addition, the primer of this invention can be used individually or in combination of 2 or more types.

In addition, the present invention provides a set of SNP primers for discriminating Korean ginseng thunder variety comprising the primers described in SEQ ID NO: 11 to SEQ ID NO: 13.

In the SNP primer set, the primers described in SEQ ID NO: 11 and the primers described in SEQ ID NO: 12 are universal primer pairs, so that universal bands may appear in Korean ginseng to identify differences from other species. The primers set forth in SEQ ID NO: 12 and the primers set out in SEQ ID NO: 13 are typhoon-specific SNP primer pairs, which allow discrimination of typhoons from other varieties.

The SNP primer set may further include a primer set forth in SEQ ID NO: 16. The primer described in SEQ ID NO: 16 does not bind to the SNP of the thunder-derived Auxin repressed protein gene, but can be used for discrimination of the thunder and the ginseng by additionally binding to and amplifying the gene of Hwagisam.

The present invention also provides a SNP primer set for discriminating Korean ginseng thunder cultivar comprising the primers described in SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17.

The primers described in SEQ ID NO: 14 and the primers described in SEQ ID NO: 15 are universal primer pairs, and the primers described in SEQ ID NO: 17 specifically bind to genes of Hwagisam or Korean ginseng except for the storm, No band other than the universal band appears.

In a preferred embodiment of the present invention, SNP primers for distinction between varieties or species that are related to each other in some cases may need to be distinguished using only one nucleotide sequence. Designed differently using mismatching methods. In other words, it is designed as AG or CT by mismatching near the sense and anti-sense ends and using specific SNP moieties that have genetic variation of the hurricane-derived Auxin repressed protein gene. Positive and negative SNP primers can be prepared, respectively (see FIG. 3 and Table 3).

According to one embodiment of the present invention, as a result of performing PCR using the positive marker (SEQ ID NO: 11 to SEQ ID NO: 13, and SEQ ID NO: 16), as a result of the storm, Korean ginseng (7 species including Yeonpung) and Hwagisam Universal DNA band (600 bp), DNA band (200 bp), and DNA band (400 bp), which are specific to Hwagi-sam, are commonly identified as the positive markers. 7 kinds of algae, and hwagisam can be determined (see Fig. 6). In addition, in case of using a negative marker (SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 17), universal DNA band (643 bp) and Korean ginseng commonly found in Chunpoong, Korean Ginseng (7 species including Yeonpung) and Hwagisam (7 species other than Yeonpung) and DNA bands (406 bp) appearing specifically in Hwagisam can be identified to distinguish the typhoon from other varieties (see Fig. 7).

According to another embodiment of the present invention, in order to find out whether it is possible to discriminate between the ginseng from other ginseng varieties by using the positive or negative markers, double-blind for six year old new varieties Cheonpung, Yeonpung, Geumpung, Jakyungjong and Hwangsukjong As a result of the law, the storm could be clearly distinguished from other ginseng varieties. In addition, when the negative markers UKF1 and NKF1 and NKR1 primers were used, 643 bp universal band was amplified in Puncture, Korean Ginseng, and Ginseng Ginseng, and 406 bp was amplified only in Korean Ginseng and Ginseng Ginseng. Confirmed that it was not amplified (see FIG. 8). In particular, the use of a positive marker suggests a clear criterion to increase the purity rate of low thunderstorm discrimination to 100% (see FIGS. 9 and 10).

Therefore, SNP primers using SNPs and combinations thereof in the Auxin repressed protein gene region of Korean ginseng assorted varieties can be usefully used to discriminate between the cultivated ginseng from the ginseng varieties cultivated by PCR analysis. .

In addition, the present invention can specifically amplify the Auxin repressed protein gene described in SEQ ID NO: 1, any one or more Auxin repressed protein gene selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10 to specifically amplify Uncountable SNP primers; And

One or more Auxin repressed protein genes of SEQ ID NO: 1 can not be specifically amplified, and any one or more Auxin repressed protein genes selected from the group consisting of SEQ ID NOs: 2 to 10 may be specifically amplified SNP primers. It provides a PCR kit for determining the ginseng thunder cultivar varieties comprising at least one SNP primer selected from the group consisting of.

According to one embodiment of the invention, the SNP primers preferably include the primers set forth in SEQ ID NO: 11 to SEQ ID NO: 13, more preferably further comprises a primer described in SEQ ID NO: 16.

According to another embodiment of the present invention, the SNP primer preferably includes a primer described in SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17, but is not limited thereto.

According to another embodiment of the present invention, the kit may include all of the SNP primers.

The kit may further include reagents for DNA extraction, amplification and product detection and instructions therefor. Examples include reagents for DNA extraction, dNTP (dATP, dCTP, dGTP and dTTP) mixtures, thermostable DNA polymerase suitable for DNA amplification reactions, buffer solutions and reagents for labeling and detecting nucleic acids. It is not limited thereto, and may include all reagents required for PCR reactions known to those skilled in the art.

As a positive or negative marker, the SNP primer set can be usefully used as a PCR kit for discriminating gusts because it can discriminate gusts from other cultivars by specifically recognizing the SNP region of the Auxin repressed protein gene region of Korean ginseng gusts. have.

In addition, the present invention provides a method for discriminating Korean ginseng thunder cultivar using the SNP primer.

Specifically, the method according to the wind breeze of the present invention,

Extracting DNA of the sample of the ginseng variety to be identified;

Using the DNA extracted in the step as a template and can specifically amplify the Auxin repressed protein gene described in SEQ ID NO: 1, at least one Auxin repressed protein gene selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10 SNP primers that cannot specifically amplify; And

One or more Auxin repressed protein genes of SEQ ID NO: 1 can not be specifically amplified, and any one or more Auxin repressed protein genes selected from the group consisting of SEQ ID NOs: 2 to 10 may be specifically amplified SNP primers. Generating a PCR product by performing a polymerase chain reaction (PCR) using at least one SNP primer selected from the group consisting of; And

Analyzing the length of the PCR product.

According to one embodiment of the invention, the SNP primer set preferably comprises a primer described in SEQ ID NO: 11 to SEQ ID NO: 13. In this case, if the length of the PCR product is 200 bp and 600 bp can be determined as a cultivated varieties, if the 600 bp alone, Korean ginseng cultivars excluding the gusts.

In the method of the present invention, in carrying out the PCR, primers described in SEQ ID NO: 16 may be additionally used. In this case, if the length of the PCR product is 200 bp and 600 bp, the genus cultivar is 400 bp and 600 bp. In case of 600 bp alone, the Korean ginseng cultivated species except for the gust and the gwagi ginseng can be determined. That is, by using together the primer described in SEQ ID NO: 16 can not only determine the storm, but also can be mixed with the fire ginseng.

According to a preferred embodiment of the present invention, the primer set forth in SEQ ID NO: 11: the primer described in SEQ ID NO: 12: the primer described in SEQ ID NO: 13: the primer described in SEQ ID NO: 16: 1: 1: 1: 1 of It is preferable to mix in a concentration ratio, but it is not limited to this.

The PCR reaction conditions are preferably annealing temperature of 50 to 55 ℃, pre-modified for 10 minutes at 94 ℃, denatured for 45 seconds at 94 ℃, annealing for 45 seconds at 55 ℃, amplification for 45 seconds at 72 ℃ After repeating 30 times, it is more preferable to complete the amplification by final extension at 72 ° C. for 5 minutes, but it is applicable to all PCR conditions in which 200 bp, 400 bp and 600 bp bands are all identified. Do.

According to another embodiment of the invention, the SNP primer set preferably comprises a primer described in SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17. In this case, if the length of the PCR product is 643 bp alone, it can be discriminated as Korean ginseng cultivars excluding the hurricane if the astronomical variety, 643 bp and 406 bp.

In a preferred embodiment of the present invention, the primers described in SEQ ID NO: 14: primers described in SEQ ID NO: 15: primers described in SEQ ID NO: 17 is preferably mixed in a concentration ratio of 1: 1, but not limited thereto. Do not.

The PCR reaction conditions were pre-modified at 94 ° C. for 4 minutes, denatured at 94 ° C. for 30 seconds, annealing at 63 ° C. for 30 seconds, and amplified at 72 ° C. for 30 seconds, and finally at 72 ° C. It is preferably composed of, but not limited to, a last extension of 7 minutes.

In the method, the sample to be discriminated may be a ginseng sample that is expected to contain a celestial herb, hwagisam and Korean ginseng cultivars.

In the embodiment of the present invention, as a result of performing PCR by the above method, it was confirmed that the specific DNA fragment of the Korean ginseng can be specifically distinguished by amplification of the correct DNA fragment of the expected size, and thus, the SNP primer of the present invention. The method using the set can be usefully used for discriminating Korean ginseng thunder cultivar.

The present invention has been developed a novel genetic marker that can easily and quickly isolate the gust wind varieties, illegal in Korea by using the SNP primer that can specifically recognize the SNP of the Auxin repressed protein gene of Korean ginseng gust wind varieties As a result, it is possible to identify foreign ginseng that is imported and sold, and contribute to making the distribution order of domestic ginseng market more clear and transparent.

1 is a photograph showing a ginseng sample used for ginseng determination.
2 is a diagram showing the position of the SNP according to the ginseng variety:
Chunpoong (SEQ ID NO: 1); Gopoong (SEQ ID NO: 2); Yunpoong (SEQ ID NO: 3); Sensation (Sunpoong, SEQ ID NO: 4); Source (Sunwon, SEQ ID NO: 5); Good luck (Sunweon, SEQ ID NO: 6); Incense (Sunhyang, SEQ ID NO: 7); Chungsun (SEQ ID NO: 8); Goldpong (SEQ ID NO: 9); And Hwagisam ( P. quinquefolius , SEQ ID NO: 10).
3 is a diagram showing the design of specific SNP primers for discriminating hurricanes from other Korean ginseng cultivars:
1F: universal forward primer;
2R: universal reverse primer;
4F: typhoon specific primer;
3F: Hwagisam specific primers;
UKF1: universal forward primer;
UKR1: universal reverse primer;
NKF1: Gastrointestinal specific primers.
4 is a diagram schematically illustrating PCR amplification for discriminating gusts from Korean ginseng cultivars:
Positive marker A: Standard primer;
Positive marker B: hurricane specific primer;
Positive marker C: fire ginseng specific primer;
Negative marker A: standard primer; And
Negative Marker B: Firegi specific primer.
FIG. 5 is a diagram showing PCR amplification in the storm (1), Korean ginseng (2) and flowering ginseng (3) using the SNP primer for storm detection according to various PCR conditions:
A: a (1F: 2R: 3F: 4F = 5 M: 5 M: 5 M: 5 M), b (1F: 2R: 3F: 4F = 10 M: 10 M: 10 M: 10 M), Table 2 Use of PCR program A;
B: a (1F: 2R: 3F: 4F = 5 M: 5 M: 20 M: 15 M), using PCR program C in Table 2;
C: a (1F: 2R: 3F: 4F = 10 M: 10 M: 5 M: 5 M), using PCR program C of Table 2;
D: a, b, c, d, e (1F: 2R: 3F: 4F = 10 M: 10 M: 10 M: 10 M), using PCR program B of Table 2;
AT-a, 50 ° C .; b, 52 ° C .; c, 54 ° C .; d: 55 ° C .; e, 55 ° C .;
M: size marker, 2 μl of 100 bp DNA ladder (Bioneer Co., LTD).
FIG. 6 is a diagram showing a PCR product using positive markers for Typhoon (1), Korean Ginseng (2), and Hwagi (3).
FIG. 7 is a diagram showing a PCR product using negative markers for Typhoon (1), Korean Ginseng (2) and Hwagi (3).
8 is a diagram showing the results of double-blind method using a positive or negative marker for the ginseng cultivars confirmed by PCR:
PCR conditions for positive markers: using 1F, 2R, 3F and 4F primers at annealing temperatures 55 ° C. and using PCR program E in Table 2; And
PCR conditions for negative markers: using UKF1, NKF1 and NKR1 primers at annealing temperature 63 ° C.
9 is a diagram showing the results of PCR using a positive marker for thunderstorm discrimination:
M: size marker; Lanes 1, 2, 3: storms, lanes 4, 5, 6: winds, lanes 7, 8, 9: gold winds; Lanes 10, 11 and 12: antiquity; Lanes 13, 14 and 15: whirlwind; Lanes 16, 17 and 18: sailors; Lanes 19, 20, and 21: good luck; Lanes 22, 23 and 24: incense; Lanes 25, 26 and 27: blue wire; Lanes 28, 29 and 30: American ginseng.
10 is a diagram showing the results of PCR using a negative marker for storm detection:
M: size marker; Lanes 1, 2, and 21: hurricane, lanes 3, 4 and 22: gust, lanes 5, 6 and 23: golden wind; Lanes 7, 8 and 24: old-fashioned; Lanes 9, 10 and 25: whirlwind; Lanes 11, 12 and 26: sailors; Lanes 13, 14 and 27: good luck; Lanes 15, 16 and 28: incense; Lanes 17, 18 and 29: blue wire; Lanes 19, 20 and 30: American ginseng.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the present invention is not limited to the following Examples and Experimental Examples.

< Example  1> Preparation of Ginseng

Korean Ginseng ( Panax ginseng CA Meyer) used the new varieties of seedlings, Cheonpung (10), Hwagi (10) and Korean Ginseng Group (10), which were cultivated (Fig. 1). The leaves were transported to the laboratory using an ice box with ice, or dried with silica gel and placed in a closed plastic bag to the laboratory. The seedlings collected from the soil are removed by running tap water to remove the soil from the surface, and then removed with water using a paper towel, placed in a mortar and poured with liquid nitrogen, completely crushed, and then placed in a deep freezer at -70 ° C until use. Stored.

< Example  2> Auxin repressed protein  Gene Amplification and Sequence Analysis thereof

<2-1> from ginseng DNA  extraction

In order to extract DNA from the ginseng prepared in Example 1, the CTAB method (Doyle et Doyle, 1987) was performed using the following modified method. Specifically, firstly, about 1.0 g of ginseng powder tissue, which was cryopreserved, was extracted with 15 ml of extraction buffer (2% CTAB; 100 mM Tris, pH 8.0) to which 0.5% 2-β-mercaptoethanol was added. 50 mM EDTA, pH 8.0; 500 mM NaCl), and incubated at 65 ° C. for 20 minutes, and 2% PVP-40 was added to the extraction buffer to remove impurities such as phenolic compounds and tannins. After incubation, 7.5 ml of SEVAC solution mixed with chloroform: isoamylalchol = 24: 1 was added, and the supernatant was obtained by centrifugation at 8,000 g for 30 minutes, and the amount was 2/3 of the volume. After the addition of isopropanol (isopropanol) was stored at -20 ℃ for at least 12 hours and centrifuged at 8,000 g for 30 minutes to separate the DNA. The isolated DNA pellet was washed with 70% ethanol and then dissolved in TE buffer (1 M Tris, 0.5 M EDTA, pH 8.0), and then 7.5 M ammonium acetate, 2.5 M acetic acid, if necessary. Purification was done using sodium acetate. Then, the extracted DNA solution was treated with RNase (2 units / ml, 37 ° C., 1 hour; Berhinger Mannheim) to remove RNA, Geneclean kit (Bio 101 Inc., CA, USA) and Chelex 100 (Bio). DNA was purified purely using Rad Lab., CA, USA. The purified DNA was electrophoresed with 0.7% agarose gel to confirm the condition, and then stained with 1% EtBr to perform a spot-test comparing the brightness with a marker on a UV illuminator, or spectroscopy. The concentration was calculated using a photometer.

<2-2> Auxin repressed protein  Gene amplification

PCR was performed to amplify the Auxin repressed protein gene from the DNA of ginseng isolated in Example <2-1>. Specifically, the PCR reaction was carried out in a total volume of 20 μl, and a mixture of 1 μl of 10 × buffer, 2.5 μl, 10 mM dNTP 0.5 l, 0.5 U DNA polymerase, and 50 ng of primer. First, the Auxin repressed protein expressing sequence tag (EST) gene primer used for PCR was prepared by confirming the nucleotide sequence at the National Center for Biotechnology Information (NCBI). (SEQ ID NO: 18) and reverse primer ARPR1: 5'-CAAACAGCAACGCTACTCGCA-3 '(SEQ ID NO: 19), PCR was carried out under the conditions of Table 2 below: ① Pre-denatured (pre-denatured at 94 ℃ 4 minutes) -denaturation, (2) denaturation at 94 ° C for 30 seconds, annealing at 64 ° C for 30 seconds, 33 repeats of the amplification cycle consisting of 2 minutes extension at 72 ° C, and 3 final extension for 7 minutes at 72 ° C. DNA product was obtained through the PCR process of step (Table 2). The DNA product obtained as described above was confirmed by electrophoresis with 1 kb and 100 bp DNA ladder (Bioneer, Korea) in 1.5% agarose gel, the band on the agarose gel electrophoresis was UV light The image was taken using a digital camera and stored as data.

Candidate Identification origin Ace. No. No. of child Major latex protein homolog Common ice T12249 41 Ribonuclease 2 Panax ginseng RNS2_PANGI 36 Auxin repressed protein panax ginseng - - Metallothionein-2 Oenanthe javanica AF017787 35 Ribonuclease 1 Panax ginseng RNS1_PANGI 21 Protein WSI724 Rice T07613 18 Fungal elicitor-induced
protein Parsley T15043 17 Hypothetical protein Arabidopsis thaliana E86255 16 Hydroxyproline-rich glycoprotein DZ-HRGP Volvox carteri VCA242540 15 Pherophorin-dz1 protein Volvox carteri  f. VCA429230 13 Major latex-like protein Prunus persica AF239177 12 Glyceraldehyde-3-phosphate dehydrogenase Garden snapdragon DESKG 11 Chromosome 2L section Drosophila melanogaster AE003588 11 Dcarg-1 Daucus carota AB027501 10 Extensin homolog T9E8.80 Arabidopsis thaliana T06291 10 Ribosomal protein S26 Garden pea T50822 9 Acidic ribosomal protein p1a Maize T02039 9 Ag13 protein A. glutinosa AGAG13 9 Specific tissue protein 2 Cicer arietinum CANST2PRO 9

Pre-degeneration denaturalization Annealing Temperature
(AT) extension cycle
Number of times Final-extension Program A 94 ℃, 10 minutes 94 ° C, 30 seconds 66 ° C, 30 seconds 72 ° C., 30 seconds 30 72 ° C, 10 min Program B 96 ℃, 5 minutes 96 ° C, 30 seconds 55 ~ 66 ℃, 30 seconds 72 ° C., 30 seconds 30 72 ° C, 10 min Program C 96 ℃, 5 minutes 96 ° C, 30 seconds 60 ° C, 30 seconds 72 ° C., 40 seconds 35 72 ° C, 10 min Program D 96 ℃, 5 minutes 96 ° C, 30 seconds 55 ° C / 58 ° C, 30 seconds 72 ° C., 40 seconds 36 72 ° C, 10 min Program E 94 ℃, 5 minutes 94 ° C, 30 seconds 64 ℃, 30 seconds 72 ° C., 1 minute 33 72 ° C, 10 min

<2-3> Auxin repressed protein  Gene Cloning  And sequencing

In order to analyze the sequence of the DNA product selected through the PCR process of Example <2-2>, gene cloning was performed using the pGEM T easy vector (promega, USA) according to the supplier's instructions. The plasmid for sequencing was then subjected to an alkali lysis method (Bimboim et. al ., 1979). Specifically, the bacteria containing the plasmid were incubated for 12-16 hours in 4 ml of LB medium, and the culture was transferred to a 1.5 ml centrifuge tube to harvest the bacteria. The bacteria were suspended in 100 μl of GTE buffer (50 mM Glucose; 25 mM Tris-HCl, pH8.0; 10 mM EDTA), followed by 200 μl of alkaline dodecyl sulfate (SDS) solution (0.2 N NaOH). , 1% SDS) was added and mixed and stored on ice for 5 minutes. 150 μl of 3 M potassium acetate (pH 4.8) solution was added thereto, stored on ice, and centrifuged to obtain a supernatant. The supernatant was added to the same amount of phenol / chloroform (phenol: chloroform = 1: 1) and centrifuged at 12,000 × g for 10 minutes and 2 times ethanol was added to the supernatant and placed at -70 ℃ for 30 minutes. Then, the DNA isolated from the plasmid was centrifuged at 4 ° C. for 10 minutes, washed with 80% ethanol and dried, and then dried in TE buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA) containing 50 μl of RNase. It was used by melting. Plasmid DNA selected for double sequencing was added to 350 μl TE buffer and treated with 400 μl PEG solution (13% PEG, 2.5 M NaCl) on ice for 10 minutes. Plasmid DNA was centrifuged at 12,000 × g for 10 minutes at 4 ° C., washed with 70% ethanol, and dried and dissolved in 400 μl of TE buffer. The same amount of phenol / chloroform (1: 1) was added to the solution, followed by centrifugation at 12,000 × g for 10 minutes, followed by adding 2 times of ethanol and 1/4 times of 10 M ammonium acetate to the supernatant. Treatment was carried out at −70 ° C. for 30 minutes to precipitate. Precipitated plasmid DNA was obtained by centrifugation at 4 ° C. for 10 minutes, washed with 70% ethanol, naturally dried, dissolved in 10 μl of sterile water, and quantified and used for reaction for sequencing. As described above, Auxin repressed protein genes isolated through PCR and cloning process were subjected to automated sequencer (Perkin Elmer Ltd., ABI 3700) using dye labeled dideoxy termination method according to the supplier's instructions. Sequencing was performed.

< Example  3> sequence alignment ( sequence alignment )through SNP  analysis

For SNP analysis of Auxin repressed protein genes in the hurricane, the accuracy and sequence alignment of sequencing were confirmed and verified using ClustalV program and Autoassembly Sequencer. Finally, the results were visually examined. The genetic information obtained from the sequencing analysis was created by Kimura's two parameters of the DNADIST program in PHYLIP (Phylogenetic Inference Package, ver. 3.5c).

As a result, SNPs were found at various sites in the Auxin repressed protein genes of Typhoon and Hwagi (Fig. 2).

< Example  4> SNP  By detection Celestial  Discrimination

<4-1> Typhoon  For discrimination SNP  Positive and negative Primer  making

As a basic principle of the SNP primer development analysis system, an Amplification Refractory Mutation System (ARMS) was used. In general, when PCR amplification using Taq polymerase, PCR amplification does not occur when mismatching with the template DNA in the 3'-nucleotide of the primer. SNP primers were prepared using this. At this time, the Taq polymerase used for amplification as a prerequisite was used without the 3'-exonucleolytic proofreading activity. ARMS primers were designed to cause G / T or A / C (primer / template) mismatches. Primer fabrication is performed by synthesizing a secondary primer by determining a primary control primer of an appropriate size arbitrarily selected from the base sequences of the gene of interest and determining a specific primer site inside the primary control primer amplification product. By amplifying the nucleotide base immediately before the specific nucleotide at the site with an arbitrary nucleotide, it was specifically amplified, whereby it was designed to compete between primers (Fig. 3). PCR primers were prepared for the detection of specific molecular markers for determining the activity (Table 3).

primer The length (mer) order SEQ ID NO:  1F 23 left 5'ACAGAAACACTAGTTACTGCTGC 3 ' 11 2R 21 right 5'AGCGTCGGACAAAATATAATT 3 ' 12 4F 21 right 5'CTCCACACGTTGTCGGCCTAA 3 ' 13 3F 22 left 5'ACAAACAAAACCAAACGAAAC 3 ' 16 UKF1 19 left 5'CTACACGTTGTCGGCATTG 3 ' 14 NKR1 19 right 5'CCTCCTCAATGATGGTGCT 3 ' 15 NKF1 20 left 5'GGTAACTGGGTATAGAGCAT 3 ' 17

<4-2> SNP Primer  optimal PCR  Establish condition

Since the SNP primers prepared in Example <4-1> have different reaction characteristics according to SNPs, PCR reaction conditions (DNA concentration, amplification number, concentration ratio between primers, and dNTP mix concentration) according to the characteristics of each primer are established. Was intended.

<4-2-1> multiple PCR Optimal for primer  Check combination

In order to establish multiple PCR conditions for the SNP positive or negative primers prepared in Example <4-1>, multiple PCR was performed at a constant ratio of 1F: 2R: 3F: 4F to Cheonpung, Hwagi and Korean Ginseng. As a negative primer, multiple PCR was performed at a constant ratio of UKF1: NKF1: NKR1.

As a result, in the case of the positive primer, the universally identified band size was 600 bp, specifically, the band size detected only in the typhoon was 200 bp, and the primer was designed to be 400 bp. When the PCR was completed, the band was identified at 600 bp and 200 bp in the thunderstorm, the band appeared only at 600 bp in Korean ginseng, and at 600 bp and 400 bp in the case of hwagisam.

In the case of negative primers, the commonly identified band size was 643 bp and specifically, the band size identified only in Korean ginseng and flowering ginseng was 406 bp. Upon successful completion of multiple PCR, 643 bp bands appeared in the thunderstorm and 643 bp and 406 bp bands were identified in Korean ginseng or flowering ginseng (Fig. 4).

At this time, when the concentration ratio of each positive primer was 1F: 2R: 3F: 4F = 5M: 5M: 15M: 10M, the universal band did not appear, and 10M: 10M: 10M: 10M When confirmed as. In addition, in order to confirm the annealing (annealing) temperature value, the primer concentration was 10 M: 10 M: 10 M: 10 M and PCR was performed by changing the annealing temperature from 50 to 55 ° C, but no significant difference was observed. The concentration ratio of each primer of the negative primer was UKF1: NKF1: NKR1 = 5 M: 5 M: 5 M, and the optimum annealing temperature was 67 ° C. (FIG. 5).

<4-2-2> SNP  positivity Primer  Composition and PCR  Check condition

To develop molecular markers for distinguishing gusts from Hwagi or Korean ginseng, refer to Toni (2003) et al., And set the Taq polymerase concentration to 2 U and select a specific primer composition. Was performed. For PCR reaction composition, 2 μl of each primer (1F, 2R, 3F, and 4F) was added, and 20 μg / DNA was added to 4 μl of 3.1 × PCR Mix (premix containing components required for PCR such as Taq DNA polymerase). 4 μl of the additive PSB was added to distilled water to a final volume of 20 μl to increase the specificity of each primer in multiple PCR. PCR conditions consisted of 30 repeated amplification cycles consisting of 10 minutes of pre-denaturation at 94 ° C., 45 seconds at 94 ° C., 45 seconds at 55 ° C., 45 seconds at 72 ° C., and finally a final extension of 5 minutes at 72 ° C. PCR was performed.

As a result, a universal band was identified at 600 bp in the Typhoon, Hwagisam and Korean Ginseng, and in particular, 200 bp, which is a specific band in the Typhoon, and 400bp in the Hwagisam, were detected. 6).

<4-2-3> SNP  voice Primer  Composition and PCR  Check condition

When using SNP negative primers, the following PCR conditions were chosen. 0.3 μl, 2 μl, 1 μl of each primer (UKF1, NKF1, and NKR1) of each PCR reaction composition was added in 3.3 μl, and 10 μl of 2 × PCRMix (premix containing components required for PCR such as Taq DNA polymerase). DNA was added at 20 ng / μl and the final volume was adjusted to 20 μl with distilled water. PCR conditions consisted of 33 repetition amplification cycles consisting of 4 minutes pre-denaturation at 94 ° C., 30 seconds at 94 ° C., 30 seconds at 63 ° C., 30 seconds at 72 ° C., and finally a final extension of 7 minutes at 72 ° C. Three steps of PCR were performed.

As a result, the universal band 643bp, Korean ginseng or hwagisam appeared in the 406 bp band, and only 643 bp appeared in the hurricane was distinguished from Korea ginseng and hwagisam (Fig. 7).

< Experimental Example  1> In a double-blind fashion  by Celestial  Discrimination

It was confirmed whether the gusts distinguished using the gusts SNP primer prepared in <Example 4>. Specifically, experiments were performed in a state in which the 20 varieties were not known at all in order to determine the storm from 20 ginseng leaves mixed with the storm. 20 mg of ginseng leaves were placed in a sterile 1.5 ml small eppendorf tube, and liquid nitrogen was pulverized quickly for 5 seconds with a sterilized mortar. Then, 200 ml of 0.5 M NaOH was added and vortexed and mixed. 5 μl was taken and vortexed into a tube containing 495 μl of 100 M Tris (pH 8.0), and 1 μl was used as a template for the PCR reaction (Wang et al ., 1993). After extracting the DNA as described above, SNP analysis was performed according to the PCR conditions and methods established in <Example 4>.

As a result, the 1st, 2nd, 7th, 14th, 15th, and 20th samples were found to have a typhoon band at 200 bp and 600 bp, and 3, 4, 5, 10 times. And the 16th sample was confirmed that the band is confirmed by the 400 bp and 600 bp, and the remaining 6, 8, 9, 11, 12, 13, 17, 18 and 19 samples Was identified as Korean ginseng. These results indicate that the SNP molecular markers in the Auxin repressed protein region are accurate and reproducible and are effective as positive markers for storm detection. In addition, as a result of PCR analysis using a negative primer after extracting DNA in the same manner as the positive primer, samples 1, 2, 7, 14, 15 and 20 were undetectable because no band was detected. The remaining 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 16, 17, 18, and 19 samples Since the band was confirmed at 422 bp, it could be seen that it was Korean ginseng or flowering ginseng (FIG. 8).

< Experimental Example  2> Typhoon  For more than 9 varieties Typhoon  Discriminant Hit rate  Confirm

According to the method of <Experimental Example 1>, the DNA is separated from the central lobules of the sensation, sensation, geum, archaic sensation, sensation, sensation, incense, blue and American ginseng, and the SNP positive and negative primers of the present invention are separated. PCR was performed using as a marker.

As a result, when the positive marker was used, the hit ratio against the typhoon was 100% (the typhoon hit score / the typhoon sample score = 3/3 × 100 = 100), and the error rate for the typhoon was 3.7% (the typhoon error score / the typhoon). Ex-sample score = 1/27 × 100 = 100) (FIG. 9). On the other hand, the negative marker also showed that the hit ratio against the typhoon was 100% (thunder hit score / storm sample score = 2/2 × 100 = 100), and the error rate against the typhoon was 3.7% (thunder error score / storm and others). Sample score = 1/27 × 100 = 100) (FIG. 10). Therefore, the hit ratio and error rate of the positive or negative primers developed for storm detection were 100% and 3.7%, respectively, and the positive and negative primers were effective as markers for storm detection.

<110> Korea Ginseng Corporation <120> SNP primer for discrimination of Chunpoong cultivar of Panax          ginseng C.A. Meyer and method for discriminating the Chunpoong          cultivar using the same <130> 2011-DPA-150 <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Chunpoong <400> 1 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggcctta cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 2 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Gopoong <400> 2 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 3 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Yunpoong <400> 3 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 4 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Sunpoong <400> 4 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 5 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Sunwon <400> 5 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 6 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Sunweon <400> 6 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 7 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Sunhyang <400> 7 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 8 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Chunsun <400> 8 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 9 <211> 1101 <212> DNA <213> Panax ginseng C.A. Meyer, Gumpoong <400> 9 taacataact actcaagcta ataataacaa acagaaacac tagttactgc tgcactaata 60 tatacacaaa catcaactta ttaaatcaag ggaaatatga taaaacacgc tatttatatg 120 caaccatcgg cggtgcgggt gccaaaacaa aaccaaacca aaatacgggc ctcggctatc 180 ctctcctcct caatgatggt gcttgctcct agtctcccca ctgtagagcc tgcagtgtcg 240 cacaaacaaa ataagttgta ttttcattaa tagcacacta cagtaatata cacgtatata 300 gaggctgata tatacgtacg taccagtcat aaacagtggg agagttgggc tgtggcttgt 360 caaacacctg ggagcccata cccctgctgg caaggttact ccccgggttg aacacgctcc 420 tccacacgtt gtcggccttg cgcaccgccg ttggagatgg agtcgtcggt gttgccggtg 480 cccccgggct cgacggcatc gacaacgacc tctggttgct actacccaca tctccctcta 540 caaacaatag tatttataca ttaccaaaaa acatatatat atgccatcaa tacattacaa 600 gtacatgaca ataaattata ccccgtccga cgcttaccac actctgacaa aggtaagagt 660 ccaaggatcc cgttagaatg aaattcactc aagtgtaagt ttactttatc gtatcaaata 720 cagtttgata cagtactgac acaggcaaaa aaaatgatct aagcgtcagt tggtcctgaa 780 gtactgaaat tactatgaag tcagttcatg ctctataccc agttacccac ccccatagtc 840 catacacttc atttaagtat aaaaaattta acaaaattaa ttgagaagta acttgtcact 900 gaaatccgag ttcataactt agatcactac atatatatac ttacatacat atatacaagt 960 acagaaaagg gcttaacata tatatattgg ttgatcgtct agagatgtaa tatttactag 1020 gaaattaaca actagaagaa catacatata caaatttata tattcagcag attaaaaaga 1080 aggaatttga agtttaacca t 1101 <210> 10 <211> 1082 <212> DNA <213> Panax quinquefolium L <400> 10 tactcaagct aataataaca aacagaaaca ctagttactg ctgcactaat atacacacaa 60 acatcaactt attaaattaa gggaaatgat aaaacacgct atttacatgc aaccatcggt 120 ggtgcgggtg ccaaaacaaa acaaaaccaa acgaaactac gggcctcggc tatcctctcc 180 tcctcaatga tggtgcttgc tcctagtctc cccactgtag agcctgcagt gtcgcacaaa 240 caaaataagt tgtattttca ttaatagcac actacagtaa tatacacgta tatagaggtt 300 gatatatacg tacgtaccag tcataaacag tgggagagtt gggctgtggc ttgtcaaaca 360 cctgggagcc catacccctg ctggcaaggt tactccccgg gttgaacacg ctcctccaca 420 cgttgtcggc cttgcgcacc gccgttggag atggagtcgt cggtgttgcc ggtgcccccg 480 ggctcgacgg catcgacaac gacctctggt tgctactacc cacatctccc tctacaaaca 540 atagtattta tacattacca aaaaacatat atatatgcca tcaatacatt ataagtacat 600 gacaataaat tataccccgt ccgacgctta ccacactctg acaaaggtaa gagtccaagg 660 atcccgttag catgaaattc actcaagtgt aagtttactt tatcgtatca aatacagttt 720 gatacagtac cgacacaggc aaaaaaaatg atctaagcgt cagttggtcc tgaagtactg 780 aaattactat gaagtaagtt catgctgtat acccagttac ccacccccat agtccataca 840 ctttatttaa gtataaaaaa tttaacaaaa ttaattgaga agtaacttgt cactgaaatc 900 cgagttcata acttagatca ctacatatat atacttacat acatatatac aagtacagaa 960 aagggcttaa catatatata ttggttgatc gtctagagat gtaatattta ctaggtaaat 1020 taacaactag aagaacatac atatacaaat ttatatattc agcagattaa aaagaaggaa 1080 tt 1082 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 1F <400> 11 acagaaacac tagttactgc tgc 23 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 2R <400> 12 agcgtcggac aaaatataat t 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4F <400> 13 ctccacacgt tgtcggccta a 21 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> UKF1 <400> 14 acagaaacac tagttactgc tgc 23 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NKR1 <400> 15 cctcctcaat gatggtgct 19 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 3F <400> 16 acaaacaaaa ccaaacgaaa c 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NKF1 <400> 17 ggtaactggg tatagagcat 20 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ARPF1 <400> 18 cttggcaagt tcaggaagat g 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ARPR1 <400> 19 caaacagcaa cgctactcgc a 21

Claims (17)

Auxin repressed protein gene for discriminating ginseng varieties selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 10. The Korean ginseng hurricane that can specifically amplify the Auxin repressed protein gene described in SEQ ID NO: 1, wherein any one or more Auxin repressed protein genes selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10 cannot be specifically amplified SNP primer for breed identification. The method according to claim 2,
Said SNP primers are SNP primers for distinguishing a typhoon variety, characterized in that at least one selected from the group consisting of primers set forth in SEQ ID NO: 11 to SEQ ID NO: 15. Korean ginseng thunder can not specifically amplify the Auxin repressed protein gene described in SEQ ID NO: 1, and at least one Auxin repressed protein gene selected from the group consisting of SEQ ID NO: 2 to SEQ ID NO: 10 SNP primer for breed identification. The method of claim 4,
Said SNP primer is a primer described in SEQ ID NO: 16 or a primer described in SEQ ID NO: 17 SNP primer for discriminating Korean ginseng thunder. PCR kit for determining the ginseng thunder cultivar varieties comprising any one or more SNP primers selected from the group consisting of SNP primers of claim 2. The method of claim 6,
Said kit is a PCR kit for determining the ginseng thunder cultivar, characterized in that it comprises a primer described in SEQ ID NO: 11 to SEQ ID NO: 13. The method of claim 7,
The kit PCR kit for determining the ginseng thunderstorm varieties, characterized in that it further comprises a primer described in SEQ ID NO: 16. The method of claim 6,
Said kit is a PCR kit for determining Korean ginseng thunder cultivar, characterized in that it comprises a primer described in SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17. The method of claim 6,
Said kit is a PCR kit for determining Korean ginseng thunder variety, further comprising any one or more selected from the group consisting of a dNTP (dATP, dCTP, dGTP and dTTP) mixture, a DNA polymerase and a buffer solution. Extracting DNA of the sample of the ginseng variety to be identified;
Using the DNA extracted in the above step as a template and performing a polymerase chain reaction (PCR) using any one or more SNP primers selected from the group consisting of SNP primers of Claims 2 to 5 to generate a PCR product. Making; And
Korean ginseng thunder breeze determination method comprising the step of analyzing the length of the PCR product. The method of claim 11,
Said SNP primer is a ginseng thunder cultivar discrimination method characterized in that it comprises a primer described in SEQ ID NO: 11 to SEQ ID NO: 13. The method of claim 12,
Said SNP primer is a ginseng thunder variety discrimination method, characterized in that it further comprises a primer described in SEQ ID NO: 16. The method of claim 11,
Said SNP primer is a ginseng thunder cultivar discrimination method comprising the primers set forth in SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 17. The method of claim 12,
If the length of the PCR product is 200 bp and 600 bp cheonpung varieties, 600 bp alone Korean Ginseng cheonpung variety discrimination method characterized in that discriminated by the cultivation of Korea ginseng except for the gust. The method according to claim 13,
If the length of the PCR product is 200 bp and 600 bp cheonpung varieties, 400 bp and 600 bp if the ginseng cultivars, 600 bp alone if the ginseng cultivation species except for the cheonpung and Hwagisam, Korean ginseng cheonpung variety discrimination method characterized in that it is characterized. The method according to claim 14,
If the length of the PCR product 643 bp alone cheonpung varieties, 643 bp and 406 bp Korean ginseng cheonpung varieties, characterized in that discriminated by the cultivation of Korean ginseng excluding the gusts.

Images