CN110946050A - Method for enriching jujube witches broom phytoplasma by using catharanthus roseus - Google Patents
Method for enriching jujube witches broom phytoplasma by using catharanthus roseus Download PDFInfo
- Publication number
- CN110946050A CN110946050A CN201911130787.2A CN201911130787A CN110946050A CN 110946050 A CN110946050 A CN 110946050A CN 201911130787 A CN201911130787 A CN 201911130787A CN 110946050 A CN110946050 A CN 110946050A
- Authority
- CN
- China
- Prior art keywords
- phytoplasma
- grafting
- jujube witches
- witches broom
- jujube
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G22/00—Cultivation of specific crops or plants not otherwise provided for
- A01G22/60—Flowers; Ornamental plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G2/00—Vegetative propagation
- A01G2/30—Grafting
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for enriching jujube witches broom phytoplasma by using catharanthus roseus, which comprises the steps of taking catharanthus roseus as a stock and taking jujube witches broom branches as scions for grafting, then transferring the grafted plant to an artificial climate control chamber for culture, firstly carrying out dark culture for 1d under the condition of 23 ℃ and 85% of relative humidity, and then carrying out culture under the conditions of 16h photoperiod, 23 ℃ and 65% of relative humidity until disease occurs. The method better realizes the enrichment of the jujube witches broom phytoplasma, thereby better overcoming the problems of low content of the phytoplasma in the original host, difficult separation, complex operation and the like in the existing separation research of the jujube witches broom phytoplasma, and further laying a foundation for the deep research of the jujube witches broom phytoplasma and how to prevent and treat the jujube witches broom.
Description
Technical Field
The invention belongs to the technical field of phytoplasma preservation, and particularly relates to a method for preserving and enriching jujube witches broom phytoplasma by using catharanthus roseus.
Background
Jujube witches' broom is caused by phytoplasma (phytoplasma), and is an epidemic disease widely spread in east asia. Because of its difficult prevention and cure, it has the characteristics of quick propagation speed, high pathogenic force and destructiveness, so it is called "jujube cancer". Once the jujube witches broom is infected by the jujube tree, symptoms such as arbuscular, dwarfing, sterility and the like appear, and further serious economic loss is caused to the jujube industry. Research shows that the pathogen of jujube witches broom, phytoplasma, is parasitic in the phloem and young tissue of plant and can not be cultured in vitro, which brings great difficulty to the research of the disease. However, because pathogens can not be cultured in vitro and the pathogenesis of the jujube witches broom is not clear, the method is the most common method in the process of preventing and treating the jujube witches broom by cutting and burning the susceptible plants and eliminating the sources of phytoplasmas. However, the method consumes a great deal of manpower and material resources and causes irreversible damage to the jujube trees. Therefore, how to quickly and accurately separate the jujube witches broom phytoplasma from the host to obtain the genome information of the phytoplasma and to determine the occurrence mechanism of the jujube witches broom is the key direction of the current disease control research.
In the prior art, the main methods for separating phytoplasmas include a density gradient ultracentrifugation method and a differential centrifugation combined pulse electrophoresis separation method. The principle of the density gradient ultracentrifugation method is that the total DNA of a plant disease group is dissolved in cesium chloride or sucrose solutions with different concentration gradients, and an ultracentrifuge is used to enable the DNA with different densities to be separated in a gradient manner in the solutions. The principle of the differential centrifugation combined with the pulse electrophoresis method is to gradually remove host cell components through multiple times of differential centrifugation to obtain the phytoplasma. Both methods can isolate jujube witches broom phytoplasma to some extent. Specific examples thereof include: chen Yi 22331takes jujube witches broom leaves as material, and utilizes cesium chloride density gradient centrifugation combined with Real-time PCR method to separate and obtain relatively pure jujube witches broom phytoplasma DNA (Chen Yi 22331etc., ultracentrifugation combined with Real-time PCR to separate and purify jujube witches broom phytoplasma DNA, the proceedings of Beijing academy of agriculture, 2015, 30 (2): 5-9); fu Qiang et al uses the infected tissue culture seedling as material, uses differential centrifugation combined with pulse electrophoresis method to successfully separate a bright band between 1600 kb and 2200kb, and PCR detection proves that the band is phytoplasma DNA (Fu Qiang et al, differential centrifugation combined with pulse electrophoresis separation jujube wit phytoplasma DNA, Jiangxi agricultural science report 2016 (12): 66-69). However, the separation methods cannot successfully separate the high-quality jujube witches broom phytoplasma, and the main reason is that the phytoplasma is only parasitic on the phloem and young parts of the plant, and the concentration of the phytoplasma in the parts is very low and cannot be gathered in large quantities, so that the finally obtained phytoplasma DNA has low quality and has a large amount of host genome interference, and further, the DNA concentration and purity cannot meet the sequencing requirements. Therefore, whether a large amount of plant materials rich in jujube witches broom phytoplasma can be obtained is a key factor for successfully separating the pathogens.
Relevant host studies on phytoplasma have shown that phytoplasma concentrations in host insects and herbaceous plants are much higher than in woody plants. And because the medium insects (Chinese diamond-back leafhopper and the like) of the jujube witches broom phytoplasma are small in size, difficult to capture and culture and short in growth cycle, screening herbaceous plants capable of enriching the jujube witches broom phytoplasma in vivo and taking the herbaceous plants as phytoplasma separation materials is a feasible strategy.
Catharanthus roseus (Catharanthus roseus) is called marigold, Sichuan spring, Nisshin, Amaranthus tricolor and Sanwan flower, and is a perennial herb. In recent years, in foreign research on the isolation of phytoplasma, vinca rosea has been cultivated in large quantities because it can enrich various phytoplasmas. For example, Chenwang et al disseminate wheat blue dwarf (Wheatbilue dwarf) phytoplasma into Catharanthus roseus by Psammotettix striatus L and finally separate the chromosomal DNA of WBD phytoplasma by differential centrifugation (Chenwang et al, isolation of wheat blue dwarf phytoplasma chromosomal DNA, microbiological bulletin, 2013, 40 (4): 706 + 710). However, no report is found on how to enrich jujube witches broom phytoplasma by using catharanthus roseus.
Disclosure of Invention
The invention aims to provide a method for enriching jujube witches broom phytoplasma by using catharanthus roseus, which is used for solving the problem that the jujube witches broom phytoplasma is difficult to obtain in large quantities in the prior art.
In order to achieve the purpose, the invention adopts the following technical scheme:
a method for enriching jujube witches broom phytoplasma by using catharanthus roseus, which comprises the steps of taking the catharanthus roseus as a stock, taking jujube witches broom branches (with the thickness of 4-7mm being better) as scions for grafting, using an abdomen grafting method or a cleft grafting method for grafting, and then transferring the grafted plants to a phytotron for cultivation: firstly, carrying out 1-day dark culture under the condition of 23 ℃ and 85% of relative humidity, then, changing the condition of 16h photoperiod and 23 ℃ and 65% of relative humidity into culture, timely observing and recording the typical pathogenic phenotype after the jujube witches broom phytoplasma invades catharanthus roseus, and when the typical phenotype appears, carrying out the phytoplasma characterization on the molecular level by using the nested PCR technology, wherein the molecular detection of the existence of the phytoplasma is the successful transfection of the jujube witches broom phytoplasma. The spread time is greatly different, and the jujube witches broom phytoplasma can be detected in the catharanthus roseus after 40-80 days of culture.
Preferably, after the vinca seeds are sown, the vinca seeds are normally cultured, and the vinca seedlings growing for 30-40 days after sowing are selected as the stock, wherein the material with the vinpocetine diameter of 5-8 mm is the best.
Furthermore, the grafting method of grafting the vinca rosea to the jujube witches broom branches can adopt a ventral grafting method or a cleft grafting method.
Wherein, the specific steps of the abdominal grafting method are as follows:
(1) sterilizing a grafting knife, removing leaves on the ventral side of a catharanthus roseus rootstock by using the grafting knife, and beveling a cleavage port with the length of 1.5cm, wherein the depth exceeds half of the diameter of the rootstock but does not exceed 2/3;
(2) symmetrically beveling two sides of the jujube witches broom branches by 2-3cm to be used as scions, wherein the cut surfaces are 'long inside and short outside', and the heights of the two sides are consistent;
(3) inserting the scion into the stock seam and tightly attaching;
(4) and (4) wrapping and fixing the connector by using a grafting belt from bottom to top, and binding tightly.
Preferably, the scion of the abdominal grafting method is consistent with the diameter of the rootstock; or ensuring that the cambium on at least one side is butted and keeping the upper part of the cutting surface of the scion for 2 mm.
In addition, the cleft grafting method comprises the following specific steps:
(1) sterilizing the grafting knife, removing the top of the vinca stock by using the grafting knife, flattening, and splitting a 2-3cm long split opening from the middle;
(2) symmetrically beveling two sides of the jujube witches broom branches by 2-3cm to be used as scions;
(3) inserting the scion into the stock seam and tightly attaching;
(4) and (4) wrapping and fixing the connector by using a grafting belt from bottom to top, and binding tightly.
The invention has the following advantages:
generally, the grafting is difficult to succeed due to the distant relationship between herbaceous plants and woody plants, in the invention, the jujube tree belongs to woody plants, and the catharanthus roseus belongs to herbaceous plants, and the scion can die quickly after grafting. If the graft is cultured according to the conventional conditions after grafting, the scion dies soon and can not transmit the phytoplasma to the catharanthus roseus. The inventor of the invention improves the culture method in the test process: the grafted plant is moved to an artificial climate control room for culture, 1d dark culture is carried out under the condition of 23 ℃ and 85% of relative humidity, and then culture is carried out under the condition of 16h photoperiod, 23 ℃ and 65% of relative humidity, under the condition, the scion survival time can be effectively prolonged, the jujube witches broom phytoplasma is transfected and spread to the catharanthus roseus, and the jujube witches broom phytoplasma is enriched through the catharanthus roseus.
In addition, although a common grafting method such as an abdominal grafting method or a cleft grafting method is adopted, enrichment of the jujube witches broom phytoplasma is better realized by reasonably culturing the grafted catharanthus roseus, so that the problems of low content of the phytoplasma in the original host, difficult separation, complex operation and the like in the existing separation research of the jujube witches broom phytoplasma are better solved, and a foundation is laid for the deep research of the jujube witches broom phytoplasma and how to prevent and treat the jujube witches broom.
Drawings
FIG. 1 shows grafted transfection materials and tools;
FIG. 2 is a scheme of grafting a jujube witches broom branch scion and a catharanthus roseus rootstock by adopting an abdominal grafting method;
FIG. 3 is a scheme of grafting a jujube witches broom branch scion and a catharanthus roseus rootstock by cleft grafting;
FIG. 4 is a morphological diagram of Vinca rosea infected with jujube witches broom phytoplasma after grafting;
FIG. 5 is a diagram of the distribution state of the phytoplasma in the plant body recorded by a fluorescence photographing system when the DAPI staining method is used for identifying the jujube witches broom phytoplasma;
FIG. 6 is the result of the electrophoresis detection of jujube witches broom phytoplasma by nested PCR;
in the figure, M represents DL2000 marker, DNA template in lanes 1, 2 and 3 is engrafting disease-transmitted Catharanthus roseus DNA, + represents jujube witches broom disease lobe DNA, and-represents healthy Catharanthus roseus DNA control.
FIG. 7 is a standard curve of phytoplasma concentration.
Detailed Description
The present invention will be described in detail below with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the invention, but is made for the purpose of illustrating the general principles of the invention and not for the purpose of limiting the scope of the invention. The scope of the present invention is defined by the appended claims.
The experimental materials adopted by the invention are as follows:
catharanthus roseus, a common flower plant, is obtained from open market sources.
The jujube witches broom branches are branches on diseased jujube trees (the witches broom), are obtained from the planted jujube trees, and jujube tree materials are not required to be used for jujube varieties (such as pot jujube, Chinese forest jujube and the like) resisting the witches broom.
Example 1
A method for enriching jujube witches broom phytoplasma by using catharanthus roseus comprises the following specific steps:
(1) culturing vinca seedlings as grafting stock
After seeding the vinca seeds, normally culturing, and taking the vinca seedlings growing for 30-40 days after seeding as grafting materials, wherein the preferable grafting material is the vinca seedlings with the ground diameter of 5-8 mm;
(2) grafting transfection
Jujube witches broom branches are selected from jujube trees suffering from jujube witches broom, and are grafted to rootstock vinca seedlings by using the jujube witches broom branches as scions and adopting a belly grafting method (as shown in figure 2). Before a specific grafting operation, as shown in fig. 1, a rootstock, a jujube witches broom branch scion and a plurality of operation tools are prepared: the method comprises the following steps of grafting a band, 75% alcohol and a grafting knife, wherein the specific operation steps of the abdomen grafting method are as follows:
A. disinfecting a grafting knife by alcohol wiping or fire baking, removing leaves on the ventral side of a catharanthus roseus rootstock by using the grafting knife, and beveling a split opening with the length of about 1.5cm, wherein the depth is more than half of the diameter of the rootstock but cannot exceed 2/3;
B. symmetrically beveling two sides of the jujube witches broom branches by 2-3cm to be used as scions, wherein the heights of the two sides of the cut surfaces, namely the inner length and the outer length, are consistent;
C. inserting the scion into the stock seam and tightly attaching; the scion is selected to be the best consistent with the diameter of the stock, if not, the cambium on at least one side is ensured to be butted, and the upper part of the cutting surface of the scion is left about 2mm, so that the wound healing is facilitated;
D. the connector is fixed by using a grafting belt from bottom to top, and the binding is tight, so that the purposes of water resistance and moisture preservation are achieved.
(3) Culturing enriched phytoplasmas
Transferring the grafted plant (catharanthus roseus) to an artificial climate control room for culture: firstly, carrying out 1d dark culture under the culture condition of 23 ℃ and the relative humidity of 85 percent; culturing in dark for 1d under 16h photoperiod, 23 deg.C and 65% relative humidity until disease occurs. The disease-sensitive time of the catharanthus roseus of different strains is different, and phytoplasma can be detected in about the fastest 40 days and disease-sensitive symptoms appear. The average disease-affecting time is about 60d, and the catharanthus roseus after the disease-affecting symptoms appear can be used for subsequent test materials.
Example 2
A method for enriching jujube witches broom phytoplasma by using catharanthus roseus comprises the following specific steps:
(1) culturing vinca seedlings as grafting stock
After seeding the vinca seeds, normally culturing, and taking the vinca seedlings growing for 30-40 days after seeding as grafting materials, wherein the preferable grafting material is the vinca seedlings with the ground diameter of 5-8 mm;
(2) grafting transfection
Jujube witches broom branches are selected from jujube trees suffering from jujube witches broom, and are grafted to rootstock vinca seedlings by using a cleft grafting method (as shown in figure 3) by taking the jujube witches broom branches as scions. The specific grafting operation is the same as that in the embodiment 1, wherein the cleft grafting method comprises the following specific operation steps:
A. sterilizing the grafting knife, removing the top of the vinca stock by using the grafting knife, flattening, and splitting a split opening with the length of about 2-3cm from the middle;
B. symmetrically beveling two sides of the jujube witches broom branches by 2-3cm to be used as scions;
C. inserting the scion into the stock seam and tightly attaching;
D. wrapping the connector from bottom to top by using a grafting belt;
(3) culturing enriched phytoplasmas
Transferring the grafted plant (Catharanthus roseus) to an artificial climate control room for culturing, and performing dark culture for 1d under the culture condition of 23 ℃ and the relative humidity of 85%; culturing in dark for 1d under 16h photoperiod, 23 deg.C and 65% relative humidity until disease occurs. Catharanthus roseus after the occurrence of the disease symptoms can be used for subsequent test materials.
The following tests were continued with the plants grafted successfully in example 1 or 2 as material:
(I) characterization of transfection Effect
After about 50 days of culture, the grafted vinca rosea shows typical jujube witches broom phytoplasma infection symptoms (shown in figure 4, characteristics of arbuscular, lobular, plant yellowing, fasciculation and the like), and at the moment, the stem segments of the symptom parts are collected for DAPI staining so as to identify the infection effect.
The specific procedure for DAPI staining was: fixing the stem section of the infected catharanthus roseus by using 5% glutaraldehyde, and transversely cutting the stem section into sections with the thickness of 10mm by using a freezing microtome; the section is carried by a glass slide, and is repeatedly washed for more than three times by using a phosphate buffer solution and then stained by using DAPI fuel; observing the stained section under a fluorescence inverted microscope, observing morphological characteristics of the phytoplasma by adopting UV fluorescence with the magnification of 100 multiplied by 10, recording the distribution state of the phytoplasma in the infected catharanthus roseus by using a fluorescence photographing system, and comparing the distribution state with the distribution state of the healthy catharanthus roseus, the diseased jubes and the healthy jubes (shown in figure 5). The results prove that the phytoplasma in the vinca rosea with the infectious disease is distributed in a sheet shape at the phloem, and the phytoplasma in the jujube with the infectious disease is distributed in a dot shape, which shows that the content of the phytoplasma in the vinca rosea with the infectious disease is far more than that in the jujube branches.
In the test process, 150 catharanthus roseus (300 catharanthus roseus in total) are grafted by adopting a cleft grafting method and an abdominal grafting method respectively, 125 infected jujube witches phytoplasma can be identified and counted through observation of invasion symptoms of typical phytoplasma, 165 infected with fluorescence phenomenon of the phytoplasma are statistically identified through cell observation of DAPI dyeing (the fluorescent spot area in the catharanthus roseus is obviously larger than that in the infected jujube tissue when the fluorescent spot area is observed through DAPI dyeing observation), and the result shows that the jujube witches phytoplasma can be well spread to the catharanthus roseus in a cross-species manner through conventional grafting operation by combining with subsequent PCR qualitative identification (the jujube witches phytoplasma is detected in 178 grafted catharanthus roseus), thereby indicating successful transfection.
Qualitative identification of nested PCR
Sampling the cultured catharanthus roseus which is about 50 days and shows typical jujube witches broom phytoplasma infection symptoms, and detecting the phytoplasma in the infected catharanthus roseus by using the nested PCR technology. The specific process is as follows:
(1) first PCR
Collecting leaf and stem samples of infected catharanthus roseus, extracting total DNA, and carrying out PCR amplification by using the total DNA as a template and a phytoplasma universal primer pair (5 '-3') in a 50 mu L reaction system;
R16mF2：CATGCAAGTCGAACGGA
R16mR2：CTTAACCCCAATCATCGAC
the PCR reaction conditions are as follows: 94 ℃ for 5 min; 94 deg.C, 40s, 57 deg.C, 1min, 72 deg.C, 2min, 35 cycles; finally, extending for 10min at 72 ℃;
(2) second PCR
Diluting the product obtained after the first PCR amplification by 10 times, and performing PCR amplification (5 '-3') by using a primer pair R16F2n/R16R2 as a template; the PCR reaction conditions were the same as those in the first step except that the annealing temperature was adjusted to 52 ℃.
R16F2n：GAAACGACTGCTAAGACTGG
R16R2：TGACGGG.GGTGTGTACAAACCCCG
The PCR amplification product was detected by 1.5% agarose gel electrophoresis, and the band of interest was found to appear at 1400 bp (FIG. 6).
After sampling and PCR identification are carried out on all grafted catharanthus roseus, statistics shows that the jujube witches broom phytoplasma is detected in 178 grafted catharanthus roseus, and the result shows that the transfection efficiency is high, and the jujube witches broom phytoplasma can be transfected and stored by better utilizing a grafting mode.
(III) quantitative identification of qRT-PCR
In order to further determine the concentration of the jujube witches broom phytoplasma in enriched post-infectious vinca, the inventor utilizes qRT-PCR technology to determine the concentration of the phytoplasma, and the specific process is briefly described as follows.
(1) Establishing a standard curve
Taking the total DNA of the jujube witches broom leaves as a template, carrying out PCR amplification by using a jujube witches broom phytoplasma specific primer ZFF1/ZFR1,
ZFF1：5’-ACTGCTTTCGGGTATTGCTAAC-3’，
ZFR1：5’-TGACGGGACTCCGCACAAGC-3’；
PCR amplification is carried out by adopting a 50 mu L reaction system,
the PCR reaction conditions are as follows: 94 ℃ for 5 min; 94 ℃, 30s, 61 ℃, 30s, 72 ℃, 1min, 35 cycles; finally, extension is carried out for 10min at 72 ℃.
Diluting the amplification product according to concentration gradients of 0, 50, 100, 200, 300, 400 and 500 ng/. mu.L; the diluted PCR solution is used as a template, a Real-time PCR test is carried out by using the jujube witches broom phytoplasma specific primer 16SF/16SR, a corresponding CT value is obtained, and a standard curve is established (the result is shown in figure 7).
(2) Sensitive Catharanthus roseus sample assay
And (3) carrying out Real-time PCR detection by using the DNA of the infected catharanthus roseus as a template and using a 16SF/16SR primer pair to obtain a CT value.
16SF：5’-ACTGCTTTCGGGTATTGCTAAC-3’，
16SR：5’-TGACGGGACTCCGCACAAGC-3’；
(3) Phytoplasma concentration and copy number determination
And (3) substituting the CT value of the vinca rosea with the infectious disease obtained in the step (2) into the standard curve obtained in the step (1), and calculating to obtain the concentration of the endophytic agent in the vinca rosea with the infectious disease.
In addition, for Real-time PCR detection, the ABI PRISM7500FAST (Applied Biosystems) detection system was used by the SYBR dye method.
A20. mu.L reaction system was used, comprising:
cDNA template, 1. mu.L;
1. mu.L of each of the upstream and downstream primers (primer concentration: 0.4. mu.M);
SYBR Premix Ex Taq II enzyme, 10. mu.L;
ddH2O，7μL。
the amplification program was set up as follows: 95 ℃ for 30 s; 95 ℃, 5s, 60 ℃, 31s, 40 cycles; the final steps are 95 deg.C, 15s, 60 deg.C, 1min and 95 deg.C, 15 s;
during the detection, 3 biological replicates were set for each sample, and 3 operational replicates were set for each biological replicate.
According to the operation method, the concentrations of the jujube witches broom branches used for grafting before grafting and the jujube witches broom phytoplasmas of the vinca rosea with the disease are respectively detected, and the result shows that the average concentration of the jujube witches broom phytoplasmas in the jujube witches broom branches used for grafting before grafting is 200 ng/mu L, and the average concentration of the jujube witches broom phytoplasmas in the vinca with the disease is 525 ng/mu L, which indicates that the vinca rosea can enrich the jujube witches broom phytoplasmas.
Although the invention has been described in detail above with reference to a general description and specific examples, it will be apparent to one skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Claims (9)
1. A method for enriching jujube witches broom phytoplasma by using catharanthus roseus is characterized in that the method takes the catharanthus roseus as a stock and the jujube witches broom as a scion for grafting, a belly grafting method or a cleft grafting method is used for grafting, and then the grafted plant is moved into an artificial climate control room for culture: firstly, carrying out 1-day dark culture under the condition of 23 ℃ and 85% of relative humidity, then, changing the condition of 16h photoperiod and 23 ℃ and 65% of relative humidity into culture, timely observing and recording the typical pathogenic phenotype after the jujube witches broom phytoplasma invades catharanthus roseus, and when the typical phenotype appears, carrying out the phytoplasma characterization on the molecular level by using the nested PCR technology, wherein the molecular detection of the existence of the phytoplasma is the successful transfection of the jujube witches broom phytoplasma.
2. The method for preserving and enriching the jujube witches broom phytoplasma using vinca as claimed in claim 1, wherein the thickness of the jujube witches broom branch is 4-7 mm.
3. The method for preserving and enriching a jujube witches broom phytoplasma using vinca as claimed in claim 1, wherein the vinca rootstock is selected to grow 30-40 d vinca seedlings after seeding.
4. The method for enriching the jujube witches broom phytoplasma by using catharanthus roseus according to claim 1, characterized in that the ground diameter of the catharanthus roseus stock selected in grafting is 5-8 mm.
5. The method of claim 1, wherein the typical pathogenic phenotype includes arbuscular, rosette, dwarfing and floral defoliation.
6. The method for enriching the phytoplasma of jujube witches' disease using vinca as claimed in claim 1, wherein the grafting method is a belly grafting method or a cleft grafting method.
7. The method for enriching the phytoplasma of jujube witches' disease using vinca as claimed in claim 6, wherein the specific steps of the abdominal inoculation are:
(1) sterilizing a grafting knife, removing leaves on the ventral side of a catharanthus roseus rootstock by using the grafting knife, and beveling a cleavage port with the length of 1.5cm, wherein the depth exceeds half of the diameter of the rootstock but does not exceed 2/3;
(2) symmetrically beveling two sides of the jujube witches broom branches by 2-3cm to be used as scions, wherein the cut surfaces are 'long inside and short outside', and the heights of the two sides are consistent;
(3) inserting the scion into the stock seam and tightly attaching;
(4) and (4) wrapping and fixing the connector by using a grafting belt from bottom to top, and binding tightly.
8. The method for preserving and enriching jujube witches broom phytoplasma using vinca as claimed in claim 7, wherein the scion of the abdominal grafting is consistent with the diameter of the rootstock; or ensuring that the cambium on at least one side is butted and keeping the upper part of the cutting surface of the scion for 2 mm.
9. The method for enriching jujube witches broom phytoplasma using vinca as claimed in claim 6, wherein the cleft grafting method comprises the following steps:
(1) sterilizing the grafting knife, removing the top of the vinca stock by using the grafting knife, flattening, and splitting a 2-3cm long split opening from the middle;
(2) symmetrically beveling two sides of the jujube witches broom branches by 2-3cm to be used as scions;
(3) inserting the scion into the stock seam and tightly attaching;
(4) and (4) wrapping and fixing the connector by using a grafting belt from bottom to top, and binding tightly.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911130787.2A CN110946050A (en) | 2019-11-18 | 2019-11-18 | Method for enriching jujube witches broom phytoplasma by using catharanthus roseus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911130787.2A CN110946050A (en) | 2019-11-18 | 2019-11-18 | Method for enriching jujube witches broom phytoplasma by using catharanthus roseus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110946050A true CN110946050A (en) | 2020-04-03 |
Family
ID=69977609
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911130787.2A Withdrawn CN110946050A (en) | 2019-11-18 | 2019-11-18 | Method for enriching jujube witches broom phytoplasma by using catharanthus roseus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110946050A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112142831A (en) * | 2020-10-10 | 2020-12-29 | 河南农业大学 | Jujube witches broom phytoplasma effector gene Zaofeng3 and application |
| CN112369231A (en) * | 2020-11-24 | 2021-02-19 | 河北润丰林业科技有限公司 | Method for manufacturing artificial bird nest |
| CN113455223A (en) * | 2021-07-29 | 2021-10-01 | 广西壮族自治区农业科学院 | Preparation method and application of catharanthus roseus high-susceptibility citrus greening disease model |
| CN113897424A (en) * | 2021-11-11 | 2022-01-07 | 塔里木大学 | Kirschner's law verification method for phytoplasma diseases |
-
2019
- 2019-11-18 CN CN201911130787.2A patent/CN110946050A/en not_active Withdrawn
Non-Patent Citations (1)
| Title |
|---|
| 武红巾等: "感染枣疯病长春花病株的繁殖与管理方法", 《植物保护》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112142831A (en) * | 2020-10-10 | 2020-12-29 | 河南农业大学 | Jujube witches broom phytoplasma effector gene Zaofeng3 and application |
| CN112369231A (en) * | 2020-11-24 | 2021-02-19 | 河北润丰林业科技有限公司 | Method for manufacturing artificial bird nest |
| CN112369231B (en) * | 2020-11-24 | 2022-06-28 | 河北润丰林业科技有限公司 | Method for manufacturing artificial bird nest |
| CN113455223A (en) * | 2021-07-29 | 2021-10-01 | 广西壮族自治区农业科学院 | Preparation method and application of catharanthus roseus high-susceptibility citrus greening disease model |
| CN113897424A (en) * | 2021-11-11 | 2022-01-07 | 塔里木大学 | Kirschner's law verification method for phytoplasma diseases |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110946050A (en) | Method for enriching jujube witches broom phytoplasma by using catharanthus roseus | |
| WO2016119703A1 (en) | Method for conducting site-specific modification on entire plant via gene transient expression | |
| Hao et al. | Genetically stable regeneration of apple plants from slow growth | |
| JP6403665B2 (en) | Method for large-scale generation of artificial seeds containing symbiosis | |
| CN108849528B (en) | Method for obtaining eremochloa ophiuroides mutant | |
| Vahdati et al. | Rooting and other characteristics of a transgenic walnut hybrid (Juglans hindsii× J. regia) rootstock expressing rolABC | |
| Eremin et al. | Use of genetic diversity of the genus Prunus L. in selection of clonal rootstocks for stone fruit crops and features of their reproduction | |
| Da Vies et al. | Maintenance of mycoplasma‐like organisms occurring in Pyrus species by micropropagation and their elimination by tetracycline therapy | |
| CN105039353A (en) | Gene CaMS1 related to chili pollen development and application thereof | |
| Jiang et al. | Distribution patterns of mulberry dwarf phytoplasma in reproductive organs, winter buds, and roots of mulberry trees | |
| CN104946644B (en) | The molecular labeling of corn friction standing grain monosomic addition line genic male sterile gene and its application | |
| CN110663551A (en) | Method for cultivating stress-resistant novel cauliflower variety | |
| EP0626014B1 (en) | Plant carrying genes coding for enzymes of the phytosterol biosynthesis pathway and process for the production of same | |
| KR101563351B1 (en) | New aloe cultivar Aloe vera Saengjang and molecular marker for discriminating the same | |
| Yepes et al. | Elimination of the crown gall pathogen, Agrobacterium vitis, from systemically infected grapevines by tissue culture | |
| Yano et al. | Tolerant Actinidia species to Pythium helicoides and P. vexans causing root rot | |
| CN113061639A (en) | Method for determining pathogenicity of pathogenic bacteria of potato verticillium wilt | |
| CN111500755A (en) | Method for identifying symbiotic nitrogen-fixing blue algae in rhododendron dauricum leaf cavity by using azotase nif gene | |
| CN111937742A (en) | Method for creating intergeneric distant hybrid of hibiscus and chamomile | |
| JP2988787B2 (en) | Adventitious bud formation method of grape | |
| RU2583304C1 (en) | Method of in vitro selection of acid-resistant forms of clover | |
| CN113969252B (en) | Rhizobium SCAUY041 and application thereof | |
| CN109892218B (en) | Method for rapidly and efficiently screening plants without transgenic components in rice gene editing strain | |
| CN114438258B (en) | Method for breeding young cane shoot plants | |
| US20220056463A1 (en) | Transgenic Safflower Event Stack IND-1ØØØ3-4 X IND-1ØØ15-7 and Methods to Use It |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20200403 |
|
| WW01 | Invention patent application withdrawn after publication |