CN113817772A

CN113817772A - Plasmid for verifying influence of human gene intron variation on gene splicing and construction method and application thereof

Info

Publication number: CN113817772A
Application number: CN202111051896.2A
Authority: CN
Inventors: 王义亭; 刘静; 梁萌萌
Original assignee: Zhejiang Saiweisi Biotechnology Co Ltd
Current assignee: Zhejiang Saiweisi Biotechnology Co Ltd
Priority date: 2021-09-08
Filing date: 2021-09-08
Publication date: 2021-12-21

Abstract

The invention provides a plasmid for verifying the influence of human gene Intron variation on gene splicing, wherein an Intron of a gene to be verified replaces Intron1 or Intron2 of an alternative splicing report plasmid pCDNA3.1-EGFP-AS to form a minigene plasmid containing the Intron of the gene to be verified. The invention also provides a construction method and application thereof. The invention can reflect the influence of gene intron variation on gene splicing at the cell level and the living body level and can detect alternative splicing practice from the transcription level by forming minigene plasmid containing the gene intron to be verified and combining cell transfection and cDNA detection.

Description

Plasmid for verifying influence of human gene intron variation on gene splicing and construction method and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a plasmid for verifying the influence of human gene intron variation on gene splicing, a construction method and application thereof.

Background

With the wide application of whole exome sequencing and whole genome sequencing in the field of rare genetic diseases, more and more variations of intron regions of genes are reported, but at present, no systematic verification method exists for the influence of the variations of the intron regions on gene splicing. In recent years, studies have suggested that mutations located within introns affect the splicing process of pre-mRNA in many disease-related genes. The most common form of splicing mutation is one that results in aberrant splicing by creating or enhancing splice sites or creating new branch points. In a particular intron, the mutation may create a new splice site, bordering a new exon, such that the newly generated exon is contained in the mature mRNA product. Therefore, a method for accurately, objectively and rapidly verifying the influence of genetic intron variation on gene splicing is necessary.

Disclosure of Invention

The invention aims to provide a plasmid for verifying the influence of human gene intron variation on gene splicing, a construction method and application thereof, so as to solve the defects of the prior art.

The invention adopts the following technical scheme:

the first aspect of the invention provides an alternative splicing reporter plasmid which is a plasmid pCDNA3.1-EGFP-AS containing E1-Intron1-E2-Intron2-E3, wherein the sequence of E1 is shown AS SEQ ID NO.1, the sequence of E2 is shown AS SEQ ID NO.2, the sequence of E3 is shown AS SEQ ID NO.3, the sequence of Intron1 is shown AS SEQ ID NO.4, and the sequence of Intron2 is shown AS SEQ ID NO. 5.

In a second aspect, the invention provides a plasmid for verifying the influence of the Intron variation of the human gene on the gene splicing, wherein the Intron of the gene to be verified replaces Intron1 or Intron2 of the alternative splicing report plasmid to form a minigene plasmid containing the Intron of the gene to be verified, namely the plasmid for verifying the influence of the Intron variation of the human gene on the gene splicing.

The third aspect of the present invention provides a method for constructing an alternative splicing reporter plasmid, comprising the following steps: based on the plasmid pCDNA3.1-EGFP-C, the EGFP gene sequence is divided into 3 segments and is respectively named AS E1, E2 and E3, the E1 sequence is shown AS SEQ ID NO.1, the E2 sequence is shown AS SEQ ID NO.2, the E3 sequence is shown AS SEQ ID NO.3, an Intron sequence Intron1 is inserted between E1 and E2, an Intron sequence Intron2 is inserted between E2 and E3, and the alternative splicing report plasmid pCDNA3.1-EGFP-AS is obtained, wherein the Intron1 and Intron2 respectively have a 5 'shearing site, a branch site and a 3' shearing site, the Intron1 sequence is shown AS SEQ ID NO.4, and the Intron2 sequence is shown AS SEQ ID NO. 5.

The fourth aspect of the present invention provides a method for constructing a plasmid for verifying the influence of human gene intron variation on gene splicing, comprising the steps of: based on the plasmid pCDNA3.1-EGFP-C, the EGFP gene sequence is divided into 3 segments and is respectively named AS E1, E2 and E3, the E1 sequence is shown AS SEQ ID NO.1, the E2 sequence is shown AS SEQ ID NO.2, the E3 sequence is shown AS SEQ ID NO.3, an Intron sequence Intron1 is inserted between E1 and E2, an Intron sequence Intron2 is inserted between E2 and E3, and the alternative splicing report plasmid pCDNA3.1-EGFP-AS is obtained, wherein Intron1 and Intron2 respectively have a 5 'shearing site, a branch site and a 3' shearing site, the Intron1 sequence is shown AS SEQ ID NO.4, and the Intron2 sequence is shown AS SEQ ID NO. 5;

intron1 or Intron2 of the alternative splicing report plasmid pCDNA3.1-EGFP-AS is replaced by the Intron of the gene to be verified to form a minigene plasmid containing the Intron of the gene to be verified, namely a plasmid for verifying the influence of the Intron variation of the human gene on the splicing of the gene.

In a fifth aspect, the present invention provides a method for verifying the effect of a variation in an intron of a human gene on gene splicing, comprising the steps of:

1) based on the plasmid pCDNA3.1-EGFP-C, the EGFP gene sequence is divided into 3 segments and is respectively named AS E1, E2 and E3, the E1 sequence is shown AS SEQ ID NO.1, the E2 sequence is shown AS SEQ ID NO.2, the E3 sequence is shown AS SEQ ID NO.3, an Intron sequence Intron1 is inserted between E1 and E2, an Intron sequence Intron2 is inserted between E2 and E3, and the alternative splicing report plasmid pCDNA3.1-EGFP-AS is obtained, wherein Intron1 and Intron2 respectively have a 5 'shearing site, a branch site and a 3' shearing site, the Intron1 sequence is shown AS SEQ ID NO.4, and the Intron2 sequence is shown AS SEQ ID NO. 5;

2) replacing Intron1 or Intron2 of the alternative splicing report plasmid pCDNA3.1-EGFP-AS with the Intron of the gene to be verified to form a minigene plasmid containing the Intron of the gene to be verified, namely a plasmid for verifying the influence of the Intron variation of the human gene on the splicing of the gene;

3) transfecting cells by minigene plasmids, and observing whether the transfected cells express complete fluorescent protein or not by a fluorescent microscope, wherein fluorescence indicates that the intron of the gene to be verified is correctly spliced, and if no fluorescence indicates that the intron of the gene to be verified is abnormally spliced; meanwhile, EGFP amplification sequencing of the transfected cells is combined to further verify whether the intron of the gene to be verified in the transfected cells is correctly spliced.

The sixth aspect of the present invention provides the use of the above plasmid for verifying the influence of human gene intron variation on gene splicing, comprising the steps of: transfecting cells by minigene plasmids, and observing whether the transfected cells express complete fluorescent protein or not by a fluorescent microscope, wherein fluorescence indicates that the intron of the gene to be verified is correctly spliced, and if no fluorescence indicates that the intron of the gene to be verified is abnormally spliced; meanwhile, EGFP amplification sequencing of the transfected cells is combined to further verify whether the intron of the gene to be verified in the transfected cells is correctly spliced.

The invention has the beneficial effects that:

the invention constructs plasmid pCDNA3.1-EGFP-AS containing special sequences Intron1 and Intron2, wherein Intron1 or Intron2 can be replaced by an Intron of a gene to be verified to form minigene plasmid containing the Intron of the gene to be verified, after the cell is transfected, whether the transfected cell expresses complete fluorescent protein can be observed through a fluorescence microscope, fluorescence shows that the Intron of the gene to be verified is correctly spliced, and fluorescence does not show that the Intron of the gene to be verified is abnormally spliced, and meanwhile, EGFP amplification sequencing of the transfected cell is combined to further verify whether the Intron of the gene to be verified in the transfected cell is correctly spliced.

The invention can not only reflect the influence of the genetic intron variation on the gene splicing at the cellular level and the living level, but also detect the alternative splicing practice from the transcription level by providing the plasmid and the construction method for accurately, objectively and quickly verifying the influence of the human genetic intron variation on the gene splicing and combining the cell transfection and the cDNA detection.

Drawings

FIG. 1 shows the insertion of Intron1 and Intron2 into EGFP.

FIG. 2 is a photograph of an electrophoresis gel obtained by inserting Intron1 and Intron2 into EGFP. Lane 1 shows the amplification of the EGFP full length using pCDNA3.1-EGFP-C as a template and a length of 728 bp; lane 2 shows the full length of EGFP amplification using pCDNA3.1-EGFP-AS AS a template, 1074bp in length.

FIG. 3 is a photograph of electrophoresis gel showing the result of amplification of cDNA from pCDNA3.1-EGFP-AS plasmid and transfected cell.

Lanes

1, 2, and 3 are full-length EGFP amplification using the cDNA of the cell transfected with pCDNA3.1-EGFP-AS plasmid AS template, and the length is 728 bp;

lanes

4, 5, and 6 are full-length EGFP amplification using pCDNA3.1-EGFP-AS plasmid AS template, length 1074 bp; lane 7 is EFGP amplification using untransfected cell cDNA as template, with no band amplified.

FIG. 4 shows the fluorescence of pCDNA3.1-EGFP-AS plasmid transfected cells (bar 50 μm). A. C, E is a photograph of bright field of cells transfected with pCDNA3.1-EGFP-AS, B, D, F is a photograph of fluorescence at the corresponding position of the bright field.

Fig. 5 is a graph showing the effect of intron variation in human genes on gene splicing (bar 50 μm). A. B is a picture of a bright field of a pCDNA3.1-EGFP-AS-TRPC6-wt transfected cell and a fluorescence picture of a corresponding position, C, D is a picture of a bright field of a pCDNA3.1-EGFP-AS-TRPC6-mut transfected cell and a fluorescence picture of a corresponding position, E, F is a picture of a bright field of a pCDNA3.1-EGFP-AS-ANK1-wt transfected cell and a fluorescence picture of a corresponding position, and G, H is a picture of a bright field of a pCDNA3.1-EGFP-AS-AKN1-mut transfected cell and a fluorescence picture of a corresponding position.

FIG. 6 shows the results of a sequencing validation. A is pCDNA3.1-EGFP-AS-TRPC6-wt transfected cell cDNA which is used AS a template for amplifying an EGFP sequencing result, and E1 and E2 are spliced normally; b is pCDNA3.1-EGFP-AS-TRPC6-mut transfected cell cDNA which is used AS a template for amplifying an EGFP sequencing result, and 1 base on the left side of an E2 exon is deleted; c is pCDNA3.1-EGFP-AS-ANK1-wt transfected cell cDNA AS a template for amplifying an EGFP sequencing result, and E1 and E2 are spliced normally; d is pCDNA3.1-EGFP-AS-AKN1-mut transfected cell cDNA AS a template, and the EGFP sequencing result is amplified, and 7bp retention occurs between E1 and E2.

Detailed Description

The invention is explained in more detail below with reference to exemplary embodiments and the accompanying drawings. The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention.

A report plasmid with alternative splicing is based on plasmid pCDNA3.1-EGFP-C (Addgene record number 129020), an EGFP gene sequence is divided into 3 segments which are respectively named AS E1, E2 and E3, two Intron sequences Intron1 and Intron2 are inserted at segmented breakpoints, Intron1 and Intron2 respectively have a 5 'splicing site, a branch site and a 3' splicing site so AS to ensure that U1snRNP can be combined with the 5 'splicing site to start splicing, U2AF is combined with a region between the branch site and the 3' splicing site to ensure that an Intron forms a lasso structure to splice, and the modified plasmid namely the report plasmid with alternative splicing is named AS pCDNA3.1-EGFP-AS.

The EGFP genes E1, E2 and E3 have the following sequences:

the sequence of E1 is shown in SEQ ID NO. 1:

ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTC

the sequence of E2 is shown in SEQ ID NO. 2:

ATCTGTACAACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAA

the sequence of E3 is shown in SEQ ID NO. 3:

ACAGACTCTCCAGCAGCTCTCTGCTTTGCCCTGCAGAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

intron1 sequenceAs shown in SEQ ID NO. 4:GTACTGGGAACCCGGCTGGGGTTGGAGGAGGTGGGGCCTGAGTGTGGGTATTGGACCCAGGGCTGGCACAGATAGCCCTGCCTGGCACTCACTCTTCACTTTGAGGTCACAGGGCCACCCAGGCTGTTCGTGGGAGGTGGGAGGCCCAAAGGCTGATGAGCCGGTCTTACACTCTTTCCCTGCCCAG

wherein the underlined sequences are the 5 'cleavage site, the branch site and the 3' cleavage site in that order.

The sequence of Intron2 is shown in SEQ ID NO. 5:GTAGGCCTGCTCACACCCCGAGTGCTCGCTCTCCTGCGTTGGCCAGGGTGGGGTTGGGGGTGGAGGAAAGAGCCGGCAGGCATGTCTACCTTGGCTATGCCTGGAGGGGGCCGAGGCTGGTGAAGCAGCCTTCAGTGAGGACAAACTGTTCTCCCACAG

The preparation method of the pCDNA3.1-EGFP-AS alternative splicing report plasmid comprises the following steps:

(1) the strategy of plasmid construction is that the EGFP sequence is divided into three sections of E1, E2 and E3, Intron1 is inserted between E1 and E2, and Intron2 is inserted between E2 and E3 (the schematic diagram refers to FIG. 1).

(2) The sequences Intron1 and Intron2 were designed and synthesized.

(3) The junction of E1 and E2 was cleaved by restriction endonuclease BsrG I, and Intron1 was inserted by DNA ligase. Intron1 is inserted between E1 and E2 through first-generation sequencing, then the junction of E2 and E3 is cut through restriction endonuclease HPA I, then Intron2 is inserted through DNA ligase, and first-generation sequencing is carried out to ensure that Intron2 is inserted between E2 and E3, so that plasmid pCDNA3.1-EGFP-AS which takes pCDNA3.1-EGFP-C AS a plasmid skeleton and contains E1-Intron1-E2-Intron2-E3 is obtained, and EGFP fragments are amplified by taking pCDNA3.1-EGFP-C and pCDNA3.1-EGFP-AS AS templates respectively, and the difference of the sizes of the amplified fragments can be seen through agarose gel running (FIG. 2).

(4) And selecting a plasmid with correct sequencing, and propagating the plasmid in escherichia coli.

Because the plasmid is proliferated in the escherichia coli, bacterial endotoxin is easily brought into a final product by using a common plasmid extraction method, and the existence of the bacterial endotoxin can influence the transfection efficiency of the plasmid and the cell growth, the plasmid pCDNA3.1-EGFP-AS is extracted by using an endotoxin-removing plasmid extraction kit (an endotoxin-free plasmid small-extraction medium-amount kit (DP118) and Tiangen biochemical engineering) so AS to reduce the negative influence of the endotoxin on the test result. The concentration and purity of the pCDNA3.1-EGFP-AS plasmid are determined by a nucleic acid determinator, and the concentration of the pCDNA3.1-EGFP-AS plasmid is 897ng/ul and the OD260/280 is 1.83 by determination, which indicates that the plasmid is pure and can be used for subsequent cell transfection.

The liposome lipo2000 transfection method is as follows:

(1) cell culture: a6 cm dish was loaded with approximately 10^5 Hek293T cells, 500ul DMEM medium with 10% FBS at 37 ℃ in 5% CO₂Culturing under the condition until the cell density reaches 80 percent of fusion;

(2) preparation of transfection solution: the following two solutions (the amounts used to transfect 1 dish cell) were prepared in sterile 1.5ml EP tubes:

tube A: 0.8ug of plasmid was dissolved in 50ul of Opti-MEM^TMIn serum-free medium (Invitrogen), mix well;

and (B) tube: 2ul lipo2000(Invitrogen) was dissolved in 50ul Opti-MEM^TMMixing in serum-free culture medium, standing at room temperature for 5 min;

c, pipe C: the A, B tubes were mixed and left at room temperature for 20 min.

(3) Preparation of transfection: with 2ml of Opti-MEM^TMWashing cells for 2 times in serum-free medium, gently and slowly blowing to prevent cells from being damaged, and adding 500ul Opti-MEM^TMA serum-free medium;

(4) transfection: slowly adding the C tube solution into a culture dish, gently shaking, and adding 5% CO at 37 deg.C₂Culturing for 6h under the condition, removing serum-free transfection solution by suction, and changing into DMEM culture solution containing 10% FBS to continue culturing.

And culturing for 24h after transfection, observing and expressing the green fluorescent protein in the cell transfected with the pCDNA3.1-EGFP-AS under a fluorescent microscope, indicating that the target gene in the cell transfected with the pCDNA3.1-EGFP-AS can be correctly cut and spliced after the transcription is completed, and continuously culturing for 48 h.

After culturing the transfected cells for 48h, digesting with trypsin, centrifuging, and suspending with PBS (0.1M, pH 7.4); the total RNA extraction kit is used for extracting RNA of transfected cells, RT-PCR is carried out, the process refers to the reverse transcription kit of the whole formula gold company, 1 mu gRNA in a system of 20 mu L is taken as a template, the reaction is carried out according to the procedures of 25 ℃ for 10min, 42 ℃ for 30min and 85 ℃ for 5s, and cDNA obtained by reverse transcription is stored at the temperature of-20 ℃.

A pair of primers EGFP-F and EGFP-R is designed on the sequence of EGFP by utilizing the RNA splicing principle to detect whether Intron1 and Intron2 are retained after cell transfection:

the sequence of the EGFP-F is shown as SEQ ID NO. 6: CCCTCTAGATTACTTGTAGAGCTC;

the EGFP-R sequence is shown as SEQ ID NO. 7: GGGAGACCCAAGCTGGCTAGCG.

And (3) designing synthesized EGFP-F and EGFP-R as primers by taking the cDNA as a template, respectively amplifying EGFP sequences, and performing PCR identification on splicing occurrence events again. Intron1 and Intron2 in the cell transfected with the reporter plasmid pCDNA3.1-EGFP-AS are sheared, the sequence of the Intron in the cell transfected with the reporter plasmid does not exist, which indicates that the Intron of the modified plasmid is properly sheared (FIG. 3), the transfected cell is photographed for 48h by using a fluorescence microscope, the cell morphology is observed to be normal in bright field, and the cell has fluorescence display under a filter, which indicates that the complete EGFP protein is abundantly expressed, and also indicates that Intron1 and Intron2 are properly sheared in the cell (FIG. 4).

To verify that the modified plasmids can be used to verify the effect of intron variation of human genes on gene splicing, the present invention verifies the effect of intron variation of two genes on splicing: TRPC6(c.2645-1G > A) and ANK1(c.1504-9G > A), that is, Intron1 was replaced with a mutant Intron sequence (mut) carrying a mutation and a wild-type Intron sequence (wt) not carrying a mutation, respectively, to construct plasmids pCDNA3.1-EGFP-AS-TRPC6-wt and pCDNA3.1-EGFP-AS-TRPC6-mut, pCDNA3.1-EGFP-AS-ANK1-wt and pCDNA3.1-EGFP-AS-ANK 1-mut. TRPC6-wt/mut, ANK1-wt/mut sequences are as follows (underlined positions are mutation sites). Then, Hek293T cells were transfected according to the above transfection method, and then whether green fluorescence was generated was observed to determine the influence of intron variation on gene splicing, and a generation sequencing verification was performed.

The TRPC6 intron wild-type sequence (TRPC6-wt) is shown in SEQ ID NO. 8:

GTGAGTTGAACGCAGAAGCAAATCAGCCCCTGAATGTGAGTCAGGACGGGGGCCTAGCGCAGAGTGCCTGGAGAGCTGCAGAGATGCGTACAGGGAGAGTGAACTTCAAGGGGAAAAGTAGAACAGGATCTCACCAACCGCCGTTCTGTTAAAGAGTGGGGAACAGGCTATGTCTCCACAGGCGGGGACAGGTGCCACTTGCTAGATAAAAAGCTCTCATTCTTATGGTGGACTTGGAGGGAGGAGGAAGTGGGTGGGAAAGGCAAGGAAGGGGCTGCTGCCTCAACCCCTGAATCATTCACCACCTTTTTGTTTTAACTTACTTTAGGAGGGCTTTTGTTATCATTCTGCTATAATCTCTTCATTCACAAAAACACTTAGCTAAGAAAACAAAAACCTGCTCAATTAGGAAGTTATTTCCTTTCAAAGGATTCAAAATAAAATTGTGTGTGAAATTAGAGCTGATTTCCTCCTGTCCCACAGTCACTAGTTTTTCCGCATTGCGTATTTATAGTTGACTTCTTATCACTCTTGCTTTCAAAG

the TRPC6 intron mutant sequence (TRPC6-mut) is shown in SEQ ID NO. 9:

GTGAGTTGAACGCAGAAGCAAATCAGCCCCTGAATGTGAGTCAGGACGGGGGCCTAGCGCAGAGTGCCTGGAGAGCTGCAGAGATGCGTACAGGGAGAGTGAACTTCAAGGGGAAAAGTAGAACAGGATCTCACCAACCGCCGTTCTGTTAAAGAGTGGGGAACAGGCTATGTCTCCACAGGCGGGGACAGGTGCCACTTGCTAGATAAAAAGCTCTCATTCTTATGGTGGACTTGGAGGGAGGAGGAAGTGGGTGGGAAAGGCAAGGAAGGGGCTGCTGCCTCAACCCCTGAATCATTCACCACCTTTTTGTTTTAACTTACTTTAGGAGGGCTTTTGTTATCATTCTGCTATAATCTCTTCATTCACAAAAACACTTAGCTAAGAAAACAAAAACCTGCTCAATTAGGAAGTTATTTCCTTTCAAAGGATTCAAAATAAAATTGTGTGTGAAATTAGAGCTGATTTCCTCCTGTCCCACAGTCACTAGTTTTTCCGCATTGCGTATTTATAGTTGACTTCTTATCACTCTTGCTTTCAAAA

the wild-type sequence of the intron of ANK1 (ANK1-wt) is shown in SEQ ID NO. 10:

GTGAGTAGTGAAGGCAGGAAGGGAAGGGTTTCAGATGTGAGCAGTTCCAGCACTGTGCAGAGAACCCATCCTCATTCCAGGCGGGGCTGCAGTGCTGTGGCCTGGGGATCACTTTTCATCCTGATCAGGTCACTCTGAGCGCCCAGATTCTGCTTTGCAGGGGGTTTGAGAAGACCAGGGGTATTTCTGCATGAGAGCCACATTTCTTTAAAATAAGGAAAGTCCAAGGTGCGTGGCTGGCCTGAGTATGTCCTGGGCTAACGATGACAGTTGCCATGTAAGGAGGGGGGCAACGTTTTAAAGAAAGCATTGCCAGCAAAAATCAGGCAAGAATTACTTGATCTAAAACTGGAGAGTTCCCCCTTGCTGTAAACACATTTTGCGGGGGTTGGAGGAGTAGACAGTGAGAAGAGCTGTGGAGTTTGCCAGTTGCTCACTCGGCCAACAGCAGGCTTCCTAACCACAGGCCACGATGGGTTCTCCTTAGAGTCAGGCCTGTGATTTGTGTTTGGGGCCCTCGAGGGAAGCCTCCAGCTGGGCCCCATGAGACCTGGCCCAGGCAGCCCGACAGCAGCATTCAGAAACAGGAAGTGGGGGGGTGTGGGTGGAAAAGTCCTCATTCTCTGTCAGCAGTTGAGACTCCCCTGACCCCAGCACAGAGAAAATCAAACTAGAGTTCAAGCAGAAAGACAAGCGCATCCACTCAGAAAGGATGTGGGAGACGGATGAGCAGCCACACTGCATTGAGTGCCTTTTATGCACCAAACGCAGAAACCATGTACATTATCAGCTTGATCCCAGCTGAGCCCTAGCAAGTAGACGTTATTATTCCCATTTTACAGATGGGAGGGCTGGGCCTTTGGGAAATAAGGTAGAAATAACAGCTCACTTGAAGAACTGTTGTAAGGATTCAGTAGGATACAGCATATTGGTTCCTGTAACTCAGAGACTTGATTCGAATCCTGACTCTTCATCTTCTTAGCTGTGTGACCTTGAGAAGGTCACTTGCCCTCTCTGGGCCCTGCCTTGCTTCTCTGTAAGATGAAAAGTTGGATTTGGTAACATTAGCGTTTCTTCTTCTTTGTTTTCCCTTCGGGGTCCAG

the sequence of the ANK1 intron mutant (ANK1-mut) is shown in SEQ ID NO. 11:

GTGAGTAGTGAAGGCAGGAAGGGAAGGGTTTCAGATGTGAGCAGTTCCAGCACTGTGCAGAGAACCCATCCTCATTCCAGGCGGGGCTGCAGTGCTGTGGCCTGGGGATCACTTTTCATCCTGATCAGGTCACTCTGAGCGCCCAGATTCTGCTTTGCAGGGGGTTTGAGAAGACCAGGGGTATTTCTGCATGAGAGCCACATTTCTTTAAAATAAGGAAAGTCCAAGGTGCGTGGCTGGCCTGAGTATGTCCTGGGCTAACGATGACAGTTGCCATGTAAGGAGGGGGGCAACGTTTTAAAGAAAGCATTGCCAGCAAAAATCAGGCAAGAATTACTTGATCTAAAACTGGAGAGTTCCCCCTTGCTGTAAACACATTTTGCGGGGGTTGGAGGAGTAGACAGTGAGAAGAGCTGTGGAGTTTGCCAGTTGCTCACTCGGCCAACAGCAGGCTTCCTAACCACAGGCCACGATGGGTTCTCCTTAGAGTCAGGCCTGTGATTTGTGTTTGGGGCCCTCGAGGGAAGCCTCCAGCTGGGCCCCATGAGACCTGGCCCAGGCAGCCCGACAGCAGCATTCAGAAACAGGAAGTGGGGGGGTGTGGGTGGAAAAGTCCTCATTCTCTGTCAGCAGTTGAGACTCCCCTGACCCCAGCACAGAGAAAATCAAACTAGAGTTCAAGCAGAAAGACAAGCGCATCCACTCAGAAAGGATGTGGGAGACGGATGAGCAGCCACACTGCATTGAGTGCCTTTTATGCACCAAACGCAGAAACCATGTACATTATCAGCTTGATCCCAGCTGAGCCCTAGCAAGTAGACGTTATTATTCCCATTTTACAGATGGGAGGGCTGGGCCTTTGGGAAATAAGGTAGAAATAACAGCTCACTTGAAGAACTGTTGTAAGGATTCAGTAGGATACAGCATATTGGTTCCTGTAACTCAGAGACTTGATTCGAATCCTGACTCTTCATCTTCTTAGCTGTGTGACCTTGAGAAGGTCACTTGCCCTCTCTGGGCCCTGCCTTGCTTCTCTGTAAGATGAAAAGTTGGATTTGGTAACATTAGCGTTTCTTCTTCTTTGTTTTCCCTTCAGGGTCCAG

fluorescence observations indicated that both the mutant plasmids carrying TRPC6(c.2645-1G > a) and ANK1(c.1504-9G > a) affected splicing compared to wild type, resulting in the inability to form the complete EGFP protein and thus no green fluorescence was observed in transfected cells (fig. 5), and first generation sequencing indicated that TRPC6(c.2645-1G > a) resulted in a 1bp deletion to the left of the E2 exon, while ANK1(c.1504-9G > a) resulted in a 7bp retention of ANK1-intron (fig. 6).

Through transfection experiments of the modified plasmid pCDNA3.1-EGFP-AS and verification of the influence of two cases of human gene intron variation on gene splicing, the method disclosed by the invention can be well used for verifying the influence of the human gene intron variation on gene splicing. The method can not only visually observe whether the transfected cells generate green fluorescence, but also further carry out RT-PCR verification on the transfected cells, thereby improving the accuracy of experimental results and having popularization significance.

Sequence listing

<110> Zhejiang Saishi Biotechnology Ltd

<120> a plasmid for verifying the influence of human gene intron variation on gene splicing, and a construction method and applications thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 141

<212> DNA

<213> E1 (Artificial sequence)

<400> 1

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt c 141

<210> 2

<211> 329

<212> DNA

<213> E2 (Artificial sequence)

<400> 2

atctgtacaa ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cctgacctac 60

ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc 120

gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac 180

aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag 240

ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac 300

agccacaacg tctatatcat ggccgacaa 329

<210> 3

<211> 258

<212> DNA

<213> E3 (Artificial sequence)

<400> 3

acagactctc cagcagctct ctgctttgcc ctgcagaaga tccgccacaa catcgaggac 60

ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 120

ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag 180

aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 240

gacgagctgt acaagtaa 258

<210> 4

<211> 187

<212> DNA

<213> Intron1 (Artificial sequence)

<400> 4

gtactgggaa cccggctggg gttggaggag gtggggcctg agtgtgggta ttggacccag 60

ggctggcaca gatagccctg cctggcactc actcttcact ttgaggtcac agggccaccc 120

aggctgttcg tgggaggtgg gaggcccaaa ggctgatgag ccggtcttac actctttccc 180

tgcccag 187

<210> 5

<211> 159

<212> DNA

<213> Intron2 (Artificial sequence)

<400> 5

gtaggcctgc tcacaccccg agtgctcgct ctcctgcgtt ggccagggtg gggttggggg 60

tggaggaaag agccggcagg catgtctacc ttggctatgc ctggaggggg ccgaggctgg 120

tgaagcagcc ttcagtgagg acaaactgtt ctcccacag 159

<210> 6

<211> 24

<212> DNA

<213> EGFP-F (Artificial sequence)

<400> 6

ccctctagat tacttgtaga gctc 24

<210> 7

<211> 22

<212> DNA

<213> EGFP-R (Artificial sequence)

<400> 7

gggagaccca agctggctag cg 22

<210> 8

<211> 543

<212> DNA

<213> TRPC6-wt (Artificial sequence)

<400> 8

gtgagttgaa cgcagaagca aatcagcccc tgaatgtgag tcaggacggg ggcctagcgc 60

agagtgcctg gagagctgca gagatgcgta cagggagagt gaacttcaag gggaaaagta 120

gaacaggatc tcaccaaccg ccgttctgtt aaagagtggg gaacaggcta tgtctccaca 180

ggcggggaca ggtgccactt gctagataaa aagctctcat tcttatggtg gacttggagg 240

gaggaggaag tgggtgggaa aggcaaggaa ggggctgctg cctcaacccc tgaatcattc 300

accacctttt tgttttaact tactttagga gggcttttgt tatcattctg ctataatctc 360

ttcattcaca aaaacactta gctaagaaaa caaaaacctg ctcaattagg aagttatttc 420

ctttcaaagg attcaaaata aaattgtgtg tgaaattaga gctgatttcc tcctgtccca 480

cagtcactag tttttccgca ttgcgtattt atagttgact tcttatcact cttgctttca 540

aag 543

<210> 9

<211> 543

<212> DNA

<213> TRPC6-mut (Artificial sequence)

<400> 9

gtgagttgaa cgcagaagca aatcagcccc tgaatgtgag tcaggacggg ggcctagcgc 60

agagtgcctg gagagctgca gagatgcgta cagggagagt gaacttcaag gggaaaagta 120

gaacaggatc tcaccaaccg ccgttctgtt aaagagtggg gaacaggcta tgtctccaca 180

ggcggggaca ggtgccactt gctagataaa aagctctcat tcttatggtg gacttggagg 240

gaggaggaag tgggtgggaa aggcaaggaa ggggctgctg cctcaacccc tgaatcattc 300

accacctttt tgttttaact tactttagga gggcttttgt tatcattctg ctataatctc 360

ttcattcaca aaaacactta gctaagaaaa caaaaacctg ctcaattagg aagttatttc 420

ctttcaaagg attcaaaata aaattgtgtg tgaaattaga gctgatttcc tcctgtccca 480

cagtcactag tttttccgca ttgcgtattt atagttgact tcttatcact cttgctttca 540

aaa 543

<210> 10

<211> 1103

<212> DNA

<213> ANK1-wt (Artificial sequence)

<400> 10

gtgagtagtg aaggcaggaa gggaagggtt tcagatgtga gcagttccag cactgtgcag 60

agaacccatc ctcattccag gcggggctgc agtgctgtgg cctggggatc acttttcatc 120

ctgatcaggt cactctgagc gcccagattc tgctttgcag ggggtttgag aagaccaggg 180

gtatttctgc atgagagcca catttcttta aaataaggaa agtccaaggt gcgtggctgg 240

cctgagtatg tcctgggcta acgatgacag ttgccatgta aggagggggg caacgtttta 300

aagaaagcat tgccagcaaa aatcaggcaa gaattacttg atctaaaact ggagagttcc 360

cccttgctgt aaacacattt tgcgggggtt ggaggagtag acagtgagaa gagctgtgga 420

gtttgccagt tgctcactcg gccaacagca ggcttcctaa ccacaggcca cgatgggttc 480

tccttagagt caggcctgtg atttgtgttt ggggccctcg agggaagcct ccagctgggc 540

cccatgagac ctggcccagg cagcccgaca gcagcattca gaaacaggaa gtgggggggt 600

gtgggtggaa aagtcctcat tctctgtcag cagttgagac tcccctgacc ccagcacaga 660

gaaaatcaaa ctagagttca agcagaaaga caagcgcatc cactcagaaa ggatgtggga 720

gacggatgag cagccacact gcattgagtg ccttttatgc accaaacgca gaaaccatgt 780

acattatcag cttgatccca gctgagccct agcaagtaga cgttattatt cccattttac 840

agatgggagg gctgggcctt tgggaaataa ggtagaaata acagctcact tgaagaactg 900

ttgtaaggat tcagtaggat acagcatatt ggttcctgta actcagagac ttgattcgaa 960

tcctgactct tcatcttctt agctgtgtga ccttgagaag gtcacttgcc ctctctgggc 1020

cctgccttgc ttctctgtaa gatgaaaagt tggatttggt aacattagcg tttcttcttc 1080

tttgttttcc cttcggggtc cag 1103

<210> 11

<211> 1103

<212> DNA

<213> ANK1-mut (Artificial sequence)

<400> 11

gtgagtagtg aaggcaggaa gggaagggtt tcagatgtga gcagttccag cactgtgcag 60

agaacccatc ctcattccag gcggggctgc agtgctgtgg cctggggatc acttttcatc 120

ctgatcaggt cactctgagc gcccagattc tgctttgcag ggggtttgag aagaccaggg 180

gtatttctgc atgagagcca catttcttta aaataaggaa agtccaaggt gcgtggctgg 240

cctgagtatg tcctgggcta acgatgacag ttgccatgta aggagggggg caacgtttta 300

aagaaagcat tgccagcaaa aatcaggcaa gaattacttg atctaaaact ggagagttcc 360

cccttgctgt aaacacattt tgcgggggtt ggaggagtag acagtgagaa gagctgtgga 420

gtttgccagt tgctcactcg gccaacagca ggcttcctaa ccacaggcca cgatgggttc 480

tccttagagt caggcctgtg atttgtgttt ggggccctcg agggaagcct ccagctgggc 540

cccatgagac ctggcccagg cagcccgaca gcagcattca gaaacaggaa gtgggggggt 600

gtgggtggaa aagtcctcat tctctgtcag cagttgagac tcccctgacc ccagcacaga 660

gaaaatcaaa ctagagttca agcagaaaga caagcgcatc cactcagaaa ggatgtggga 720

gacggatgag cagccacact gcattgagtg ccttttatgc accaaacgca gaaaccatgt 780

acattatcag cttgatccca gctgagccct agcaagtaga cgttattatt cccattttac 840

agatgggagg gctgggcctt tgggaaataa ggtagaaata acagctcact tgaagaactg 900

ttgtaaggat tcagtaggat acagcatatt ggttcctgta actcagagac ttgattcgaa 960

tcctgactct tcatcttctt agctgtgtga ccttgagaag gtcacttgcc ctctctgggc 1020

cctgccttgc ttctctgtaa gatgaaaagt tggatttggt aacattagcg tttcttcttc 1080

tttgttttcc cttcagggtc cag 1103

Claims

1. An alternative splicing reporter plasmid, which is a plasmid pCDNA3.1-EGFP-AS comprising E1-Intron1-E2-Intron2-E3, wherein the sequence of E1 is shown AS SEQ ID NO.1, the sequence of E2 is shown AS SEQ ID NO.2, the sequence of E3 is shown AS SEQ ID NO.3, the sequence of Intron1 is shown AS SEQ ID NO.4, and the sequence of Intron2 is shown AS SEQ ID NO. 5.

2. A plasmid for verifying the effect of human gene Intron variation on gene splicing, characterized in that Intron1 or Intron2 of the alternative splicing reporter plasmid of claim 1 is replaced with an Intron of a gene to be verified, to form a minigene plasmid containing the Intron of the gene to be verified, i.e., a plasmid for verifying the effect of human gene Intron variation on gene splicing.

3. A method for constructing an alternative splicing reporter plasmid, which is characterized by comprising the following steps: based on the plasmid pCDNA3.1-EGFP-C, the EGFP gene sequence is divided into 3 segments and is respectively named AS E1, E2 and E3, the E1 sequence is shown AS SEQ ID NO.1, the E2 sequence is shown AS SEQ ID NO.2, the E3 sequence is shown AS SEQ ID NO.3, an Intron sequence Intron1 is inserted between E1 and E2, an Intron sequence Intron2 is inserted between E2 and E3, and the alternative splicing report plasmid pCDNA3.1-EGFP-AS is obtained, wherein the Intron1 and Intron2 respectively have a 5 'shearing site, a branch site and a 3' shearing site, the Intron1 sequence is shown AS SEQ ID NO.4, and the Intron2 sequence is shown AS SEQ ID NO. 5.

4. A method for constructing a plasmid for verifying the effect of human gene intron variation on gene splicing, comprising the steps of: based on the plasmid pCDNA3.1-EGFP-C, the EGFP gene sequence is divided into 3 segments and is respectively named AS E1, E2 and E3, the E1 sequence is shown AS SEQ ID NO.1, the E2 sequence is shown AS SEQ ID NO.2, the E3 sequence is shown AS SEQ ID NO.3, an Intron sequence Intron1 is inserted between E1 and E2, an Intron sequence Intron2 is inserted between E2 and E3, and the alternative splicing report plasmid pCDNA3.1-EGFP-AS is obtained, wherein Intron1 and Intron2 respectively have a 5 'shearing site, a branch site and a 3' shearing site, the Intron1 sequence is shown AS SEQ ID NO.4, and the Intron2 sequence is shown AS SEQ ID NO. 5;

5. A method for verifying the effect of intronic variation of a human gene on gene splicing comprising the steps of:

6. Use of the plasmid of claim 2 for verifying the effect of intronic variation of a human gene on gene splicing, comprising the steps of: transfecting cells by minigene plasmids, and observing whether the transfected cells express complete fluorescent protein or not by a fluorescent microscope, wherein fluorescence indicates that the intron of the gene to be verified is correctly spliced, and if no fluorescence indicates that the intron of the gene to be verified is abnormally spliced; meanwhile, EGFP amplification sequencing of the transfected cells is combined to further verify whether the intron of the gene to be verified in the transfected cells is correctly spliced.