CN113717991B - Method for editing gene fusion - Google Patents
Method for editing gene fusion Download PDFInfo
- Publication number
- CN113717991B CN113717991B CN202111280023.9A CN202111280023A CN113717991B CN 113717991 B CN113717991 B CN 113717991B CN 202111280023 A CN202111280023 A CN 202111280023A CN 113717991 B CN113717991 B CN 113717991B
- Authority
- CN
- China
- Prior art keywords
- gene
- seq
- fusion
- region
- recombinant aav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Abstract
The invention provides an editing method of a fusion gene, which is characterized by comprising the following steps: (1) designing a sgRNA near the natural breakpoint of two genes involved in fusion; (2) a recombinant AAV vector is designed to allow homologous recombination and repair of two broken DNAs. The method can ensure that the sequence of the obtained fusion gene is completely consistent with the natural sequence no matter whether the natural breakpoint is in the exon, the exon boundary or the intron region, and overcomes the problem of inaccurate breakpoint sequence in the existing method.
Description
Technical Field
The invention belongs to the technical field of molecules, and particularly relates to a method for editing gene fusion.
Background
Fusion gene (Fusion gene) refers to a process in which the sequences of all or a part of two genes are fused to each other into a new gene, which may be the result of chromosomal translocation, deletion in the middle, or inversion. Among them, chromosomal translocation is an important means for forming a fusion gene, and the major cause is that a double-strand break of DNA or two adjacent single-strand breaks of DNA are repaired by mistake, resulting in a positional change of a chromosomal fragment. Fusion genes can produce tumorigenic effects by two mechanisms: one is overexpression of a gene at one of the breakpoints, and the other is generation of a hybrid gene by fusion of two genes. Over 300 fusion genes have been discovered in various hematological and solid tumors, and there is considerable evidence that gene fusion by chromosomal translocations is a key driver of tumorigenesis. Therefore, research on fusion genes and their specific translocation breakpoints is crucial to understanding the pathogenesis and clinical phenotype of cancer, determining prognostic indicators, monitoring recurrence status.
The expression of fusion genes caused by chromosomal translocations is currently studied mainly in three ways: (1) ectopically expressing the fusion gene in a conventional cell line; (2) silencing the fusion gene in the tumor cell; (3) patient derived cell lines were studied directly. However, the above methods have respective problems: (1) expression of the fusion gene at non-physiological levels; (2) fusion genes cannot guarantee complete silencing; (3) patient-derived cell lines do not reproduce the initial stages of cancer development in vivo. Therefore, the above approaches all have limitations.
In order to study the role of specific translocations in tumorigenesis and develop therapies against these malignancies, there must be a viable approach to accurately induce chromosomal translocations in cell culture systems. In the earlier constructed model, DNA double strand breaks were generated by introducing I-SceI endonuclease cleavage sites at both genomic sites and overexpressing I-SceI, followed by selection for chromosomal translocations using the previously introduced marker fragments. Thereafter, programmable nuclease development has made it unnecessary to modify and cleave endogenous sites beforehand to construct chromosomal translocations. ZFNs (Zinc finger nuclei) and TALENs (Transcription activator-like effector nuclei) nucleases have been used in lactationChromosomal translocations are constructed in animal cells. In a recent study, the discovery of CRISPR-Cas9 (Clustered regulated interleaved Short Palindromic repeat-CRISPR-associated end effector 9) further simplifies the process of introducing DNA double strand breaks at the target genomic site. Using these different programmable nucleases, a series of oncogenic fusion genes have been constructed in human cell lines, including EWSR1-FLI1 (ZFNs, CRISPR-Cas 9), NPM1-ALK (TALENs, CRISPR-Cas 9), EML4-ALK (CRISPR-Cas 9), and CD74-ROS1 (CRISPR-Cas 9). For example, based on CRISPR/Cas9 technology-induced gene fusion, the design principle is as follows: one sgRNA was designed near the break point of two fused genes (the spontaneous break point of DNA during natural fusion of genes, hereinafter referred to as "natural break point"), resulting in the break of two DNA double strands (sgRNA guides the break point formed by Cas9 shearing DNA, hereinafter referred to as "cleavage site"), followed by DNA repair by Non-Homologous End Joining (NHEJ) or Homologous Recombination (HR) repair under the guidance of a Homologous recombination template. The non-homologous end-joining method is used, and DNA can repair the broken DNA by random connection and cause insertion/deletion of bases at the joint. Compared to non-homologous end joining, methods of homologous recombination typically introduce a process of resistance selection, resulting in increased editing efficiency. However, the recombinant vectors used in homologous recombination have been reported to generally comprise a homologous left arm and a homologous right arm (see FIG. 1): the homologous left arm corresponds to an upstream sequence of the Cas9 cleavage site on the upstream gene, terminating at the cleavage site of Cas9 on the gene; the homologous right arm begins at the cleavage site on the downstream gene for Cas9 and is homologous to a sequence downstream of the cleavage site on the gene. The cleavage sites of Cas9 on the upstream gene and the downstream gene are determined by the designed sgRNA sequence, and when the sgRNA is designed, due to the limitation of the sequence itself, such as the requirement of a PAM sequence, avoidance of a repeat sequence, and the like, it cannot be guaranteed that a proper sgRNA can be found at an accurate natural breakpoint position, that is, it cannot be guaranteed that the sgRNA can accurately guide Cas9 to cut off DNA at a real breakpoint, and further a homologous arm sequence and a homologous arm sequence are causedThe natural breakpoint sequences are not identical. Therefore, when the reported homologous recombinant plasmid is used as a template for recombination and repair, the accuracy of a natural breakpoint sequence cannot be ensured, and the repaired broken DNA is not identical to the real gene. As shown in FIG. 2, Fabio et al are inducingEWSR1Genes andWT1in gene fusion, a LoxP sequence was inserted between two fused genes, which were obtained by the method shown in FIG. 1.
In summary, whether by means of non-homologous end joining or homologous recombination, induced chromosomal translocations fail to precisely fuse at the natural breakpoint or DNA deletions or insertions occur at the natural breakpoint junction. This inaccurate breakpoint has potential impact on the functioning of the fusion gene, especially the fusion between exons, such as COSF571 (C)ETV6Exon 5 of gene andNTRK3fusion between exons 15 of the gene), COSF1434 (FGFR3Exon 17 of the gene andTACC3fusion between exons 10 of the gene), and the like, and inaccurate connection at a breakpoint can cause the destruction of an open reading frame or the premature termination of translation due to frame shift mutation in the translation process, and finally functional protein cannot be formed; meanwhile, inaccurate breakpoints are not beneficial to the evaluation of the detection performance of the molecular diagnosis in clinic. At present, no method for accurately editing the breakpoint of the fusion gene exists in the literature.
Disclosure of Invention
In view of the fact that a cell line carrying chromosomal translocation is an important model for researching pathogenesis, developing treatment strategies and evaluating detection performance, the invention provides a novel method for accurately constructing a gene fusion cell line aiming at the defects of the existing method.
The invention provides a method for accurately inducing gene fusion, so that the sequence of a fusion gene is completely identical to a natural sequence. On the basis of CRISPR/Cas9, an sgRNA, namely sgRNA1 and sgRNA2, is respectively designed near the natural breakpoint of two genes (gene A and gene B) participating in fusion, and simultaneously, a recombinant AAV vector is designed. The method utilizes sgRNA1 and sgRNA2 to guide the cleavage of Cas9 protein on gene a and gene B, and simultaneously causes the breakage of two DNA sites. In the presence of the recombinant AAV vector, the two broken DNAs undergo homologous recombination and repair, so that the natural breakpoint is accurately introduced.
AAV vector in the present invention refers to a recombinant adeno-associated virus vector.
In one aspect, the invention provides a method for editing a fusion gene.
The editing method comprises the following steps: (1) designing sgRNAs respectively in the vicinity of natural breakpoints of two genes (gene A and gene B) involved in fusion, wherein the sgRNAs are sgRNA1 and sgRNA 2; (2) a recombinant AAV vector is designed as a repair template to enable two broken DNAs to undergo homologous recombination repair.
In particular, the natural breakpoint is within an exon, an exon boundary, or an intron region.
Specifically, the sgRNA is in the region within 100bp upstream or downstream of the natural breakpoint of the gene, i.e., the sgRNA1 is in the region within 100bp upstream or downstream of the natural breakpoint of the gene a; the sgRNA2 is in the region within 100bp upstream or downstream of the natural breakpoint of the gene B.
Preferably, the sgRNA1 is selected from SEQ ID No.2, SEQ ID No.15, SEQ ID No. 20.
Preferably, the sgRNA2 is selected from SEQ ID NO.3, SEQ ID NO.16, and SEQ ID NO. 21.
Specifically, the homologous recombination AAV vector comprises two structural regions.
More specifically, the two structural regions are as follows:
the I region is a homologous left arm, starts from a 100-plus 1000 bp region at the upstream of the natural breakpoint of the gene A and ends at the natural breakpoint of the gene A; region II, the homologous right arm, begins at the natural breakpoint of gene B and comprises the 100-and 1000-bp region downstream thereof.
Preferably, said homologous recombination AAV vector i region is selected from: SEQ ID NO.4, SEQ ID NO.17, SEQ ID NO. 22.
Preferably, said homologous recombination AAV vector ii region is selected from: SEQ ID NO.5, SEQ ID NO.18, SEQ ID NO. 23.
Specifically, the method for editing the fusion gene comprises the following steps:
(1) designing related sgRNAs, and preparing AAV vectors;
(2) cells transfected by sgRNA and infected by recombinant AAV vector;
(3) and detecting mRNA of the fusion gene.
Further specifically, the step (2) comprises: the two sgrnas were mixed with Cas9 protein, and cells were transfected by electroporation. After electroporation was complete, cells were infected with recombinant AAV.
Preferably, the mixing ratio of the two sgrnas to the Cas9 protein is 1: 3 (mass ratio). The multiplicity of infection (the ratio of the AAV viral genome copy number to the cell number) of the recombinant AAV was 100000.
Preferably, the fusion gene is a fusion gene COSF571ETV6Exon 5 of gene (ENST 00000396373.8) andNTRK3fusion between exon 15 of gene (ENST 00000394480.6); to is directed atETV6sgRNA1 of the gene is SEQ ID NO.2, forNTRK3sgRNA2 of gene: SEQ ID No. 3; the sequence of the recombinant AAV vector I region is SEQ ID NO. 4; the sequence of the II area is SEQ ID NO. 5.
Preferably, the fusion gene is a fusion gene ROR1-DNAJC6ROR1The 9 th exon part of gene (ENST 00000371079.6) andDNAJC6fusion between intron 1 of gene (ENST 00000371069.5); sgRNA1 for ROR1 gene is SEQ ID No. 15; the sgRNA2 is SEQ ID NO.16 aiming at DNAJC6 gene; the sequence of the recombinant AAV vector I region is SEQ ID NO.17, and the sequence of the recombinant AAV vector II region is SEQ ID NO. 18.
Preferably, the fusion gene is a fusion gene COSF1347FGFR3Intron 17 of gene (ENST 00000440486.8) andBAIAP2L1fusion between intron 1 of gene (ENST 00000005260.9); to is directed atFGFR3The sgRNA1 of the gene is SEQ ID NO. 20; to is directed atBAIAP2L1The sgRNA2 of the gene is SEQ ID NO. 21; the sequence of the recombinant AAV vector I region is shown as SEQ ID NO. 22; the sequence of the II area is SEQ ID NO. 23.
In another aspect, the invention provides a fusion gene.
The fusion gene was prepared by the editing method described above.
Preferably, the fusion gene is a fusion gene COSF571ETV6Exon 5 of gene (ENST 00000396373.8) andNTRK3fusion between exon 15 of gene (ENST 00000394480.6); to is directed atETV6sgRNA1 of the gene is SEQ ID NO.2, forNTRK3The sgRNA2 of the gene is SEQ ID NO. 3; the sequence of the recombinant AAV vector I region is SEQ ID NO. 4; the sequence of the II area is SEQ ID NO. 5.
Preferably, the fusion gene is a fusion gene ROR1-DNAJC6ROR1The 9 th exon part of gene (ENST 00000371079.6) andDNAJC6fusion between intron 1 of gene (ENST 00000371069.5); to is directed atROR1The sgRNA1 of the gene is SEQ ID NO. 15; to is directed atDNAJC6The sgRNA2 is SEQ ID NO. 16; the sequence of the recombinant AAV vector I region is SEQ ID NO.17, and the sequence of the recombinant AAV vector II region is SEQ ID NO. 18.
Preferably, the fusion gene is a fusion gene COSF1347FGFR3Intron 17 of gene (ENST 00000440486.8) andBAIAP2L1fusion between intron 1 of gene (ENST 00000005260.9); to is directed atFGFR3The sgRNA1 of the gene is SEQ ID NO. 20; to is directed atBAIAP2L1The sgRNA2 of the gene is SEQ ID NO. 21; the sequence of the recombinant AAV vector I region is shown as SEQ ID NO. 22; the sequence of the II area is SEQ ID NO. 23.
In yet another aspect, the invention provides a cell.
The cell comprises the expression vector.
Such cells include, but are not limited to: human cells, animal cells.
Such cells include, but are not limited to: CHO cells.
The invention has the beneficial effects that:
the invention provides a method for editing gene fusion, relates to the design of paired sgRNAs and the design of a homologous recombination AAV vector, and particularly relates to the design of two structural regions contained in the recombination AAV vector, which is important for the successful implementation of the method. Wherein, the structural domain I region is a homologous left arm, starts from a 100-plus 1000 bp region at the upstream of the natural breakpoint of the upstream gene and ends at the natural breakpoint of the upstream gene; the region II is the homologous right arm, starts from the natural breakpoint of the downstream gene and comprises a 100-and 1000-bp region downstream of the natural breakpoint. The fusion gene obtained by the method can ensure that the sequence of the fusion gene is completely consistent with the natural sequence, and overcomes the problem of inaccurate breakpoint sequence in the existing method, thereby meeting the requirements of gene fusion research. Meanwhile, the AAV vector is used as a template for homologous recombination repair, so that the success rate of homologous recombination repair is improved, a screening marker is not needed, and LoxP sequences are prevented from being introduced at breakpoint positions.
By using the method of the invention to edit gene fusion, the fusion gene with accurate sequence can be obtained no matter the natural breakpoint is in the exon, the exon boundary or the intron region.
Drawings
FIG. 1 is a schematic diagram of fusion gene construction based on a homologous recombination method.
FIG. 2 is a diagram showing the effect of constructing a fusion gene by the homologous recombination method.
FIG. 3 is a diagram illustrating an editing method according to embodiment 1.
FIG. 4 shows the correct cell cloneETV6Exon 5 of gene andNTRK3sanger sequencing results of gene No.15 exon DNA level fusion.
FIG. 5 shows the correct cell cloneETV6Exon 5 of gene andNTRK3sanger sequencing results of RNA level fusion of exon 15 of gene.
FIG. 6 is a diagram illustrating an editing method according to embodiment 2.
FIG. 7 shows the correct cell cloneROR1Exon 9 of gene andDNAJC6the result of Sanger sequencing at the DNA level of intron 1 fusion of the gene.
FIG. 8 shows the correct cell cloneROR1Exon 9 of gene andDNAJC6RNA level Sanger sequencing results for intron 1 fusion of the gene.
FIG. 9 is a diagram illustrating an editing method according to embodiment 3.
FIG. 10 is a drawing showingIn the correct cell cloneFGFR3Intron 17 of the gene andBAIAP2L1the result of Sanger sequencing at the DNA level of intron 1 fusion of the gene.
FIG. 11 shows the correct cell cloneFGFR3Intron 17 of the gene andBAIAP2L1RNA level Sanger sequencing results for intron 1 fusion of the gene.
Detailed Description
The present invention will be further illustrated in detail with reference to the following specific examples, which are not intended to limit the present invention but are merely illustrative thereof. The experimental methods used in the following examples are not specifically described, and the materials, reagents and the like used in the following examples are generally commercially available under the usual conditions without specific descriptions.
Example 1 editing of the fusion Gene COSF571
COSF571 isETV6Exon 5 of gene (ENST 00000396373.8) andNTRK3fusion between 15 th exons of the gene (ENST 00000394480.6), respectively selecting 200 bp sequences at the upstream and downstream of a natural breakpoint for display, wherein the sequences are shown as SEQ ID NO.1 and specifically as follows:
CAGCCCCATCATGCACCCTCTGATCCTGAACCCCCGGCACTCCGTGGATTTCAAACAGTCCAGGCTCT CCGAGGACGGGCTGCATAGGGAAGGGAAGCCCATCAACCTCTCTCATCGGGAAGACCTGGCTTACATGAACCACAT CATGGTCTCTGTCTCCCCGCCTGAAGAGCACGCCATGCCCATTGGGAGAATAGCAG//ATGTGCAGCACATTAAGA GGAGAGACATCGTGCTGAAGCGAGAACTGGGTGAGGGAGCCTTTGGAAAGGTCTTCCTGGCCGAGTGCTACAACCT CAGCCCGACCAAGGACAAGATGCTTGTGGCTGTGAAGgtaaaccccagaggcatgccggcaccaggaggagggctg gctgagggcccagggagggaaggaagaggc
wherein the italic part isETV6A gene sequence; underlined part isNTRK3The gene sequence, "/" is the position of the natural breakpoint of the fusion gene,NTRK3in the gene sequence, capital letters are exons, and lowercase letters are introns.
The schematic diagram of the editing method in this embodiment is shown in fig. 3, and specifically includes the following steps:
1. design of related sgRNA and recombinant vector
(1) Referring to FIG. 3, the upstream geneETV6sgRNA of (1) and targeting downstream geneNTRK3The sgRNA of (a) is a region within 100bp upstream or downstream of the natural breakpoint of the two genes, respectively.
To is directed atETV6Genes andNTRK3two sgrnas were designed for the gene, respectively:
to is directed atETV6sgRNA1 of gene: SEQ ID No. 2;
to is directed atNTRK3sgRNA2 of gene: SEQ ID No. 3;
the sgRNA was directly obtained by chemical synthesis, and the sgRNA of this example was synthesized by tassel corporation;
(2) with reference to FIG. 3 requirements: region I, homologous left arm, starting fromETV6The 100-bp region upstream of the natural breakpoint terminates atETV6The natural breakpoint of (a); zone II, homologous right arm, starting fromNTRK3The natural breakpoint of (1), comprising a 100-and 1000-bp region downstream thereof. Wherein, the sequence of the I region is shown as SEQ ID NO. 4; the sequence of the II area is shown as SEQ ID NO. 5.
In addition, in order to facilitate the subsequent identification work, corresponding primers are designed according to fig. 3, as follows:
| primer name | Primer sequence (5 '-3') |
| F1 | SEQ ID NO.6 |
| F2 | SEQ ID NO.7 |
| R1 | SEQ ID NO.8 |
| R2 | SEQ ID NO.9 |
| Fa | SEQ ID NO.10 |
| Ra | SEQ ID NO.11 |
| Fb | SEQ ID NO.12 |
| Rb | SEQ ID NO.13 |
Wherein the F1/R1 target amplification product is a region I sequence;
F2/R2 target amplification product is a fusion gene natural breakpoint sequence;
the amplification product of Fa/Ra order isETV6 An mRNA sequence;
the amplification product of Fb/Rb purpose isNTRK3 mRNA sequences
2. Editing of gene fusions
(1) Preparation of recombinant AAV vectors. The preparation of the recombinant AAV vector is carried out according to the following steps: a) according to the design of the recombinant vector, a recombinant AAV expression plasmid was constructed by the following method: synthesizing the I region and the II region on the carrier by a chemical synthesis methodXbaI/NdeI after double digestion, was ligated to pAAV-CMV-GFP-WPRE plasmid (Yunzhou, China). The ligation products were transformed into T1 competent cells (purchased from Okinawa gold, China), bacterial clones were identified by PCR, and correctly ligated clones were selected. The correct clone is expanded and extracted to obtain large amount of high purity plasmid. 1-3. mu.g of pAAV helper substanceAdding particles (purchased from GeneMedi, China), 1-3 μ g of pAAV9 Rep-Cap plasmid (purchased from GeneMedi, China) and 1-3 μ g of expression plasmid into 20 μ L of Lipofectamine 3000 (purchased from Life technologies, USA), blowing, stirring, mixing, and standing at room temperature for 10 min; adding the reagent to 2X 106The cell culture was continued in HEK293T cells. b) Transfection was carried out for 72h, the supernatant was collected and filtered using a 0.22 μm filter. c) Collection of AAV viruses: 10mL of 40% sucrose was added to an ultracentrifuge tube, and the cell supernatant was then added to the tube and ultracentrifuged (30000 rpm, 3 h) at 4 ℃. After centrifugation, the supernatant was carefully discarded, and AAV virus was resuspended in an appropriate amount of PBS solution. Subpackaging the virus solution, and storing at-80 deg.C for long term.
(2) The two sgrnas were separately contacted with Cas9 protein (purchased from Life technologies, cat # a 36498) according to 1: 3 (mass ratio), standing at room temperature for 10min to respectively form ribonucleoprotein complex RNP1 and RNP 2. Mixing RNP1, RNP2 and 0.5X 106The cells are mixed and transfected by adopting an electroporation method, and the specific transfection conditions are as follows: 420V, 30 ms.
(3) After the electroporation is finished, the prepared recombinant AAV is mixed with the cells according to the multiplicity of infection of 100000, namely 0.5X 1011The recombinant AAV was copied and added to the cells, and cultured for 24 hours.
(4) The cells were single cell cloned as follows: a) the cells were digested and collected. b) According to the method of dilution by multiple ratio, the cells are accurately counted, the living cells are diluted to 5/mL by using the culture medium, and the cells are fully mixed. c) 10mL of the cell suspension was dispensed evenly into a 96-well plate, 0.1 mL per well.
(5) Culturing the cells in a cell culture box, adding a small amount of TrypLE Express enzyme (10 mu L, purchased from Life technologies, Inc., with the product number of 12604021) to digest the cells when the cell clones are formed, taking part of the cells as an amplification template, respectively using primer pairs F1/R1 and F2/R2, and amplifying the clones and performing Sanger sequencing verification; and (5) performing expanded culture on the rest cells for later use.
As shown in FIG. 4, the correct cell clones were selected to containETV6Genes andNTRK3the exact natural breakpoint of the gene, consistent with the natural sequence, and consistent with the effect designed in fig. 3.
3. Detection of fusion gene mRNA
And (3) carrying out amplification culture on the clone obtained in the step (3), extracting RNA and reverse transcription of the cell, carrying out PCR amplification by using cDNA as a template and adopting primers Fa and Rb, wherein a target amplification product is a fusion gene mRNA sequence, and sanger sequencing detects whether the fusion of the fusion gene at the RNA level is accurate.
As shown in FIG. 5, the method provided by the present invention can accurately connect the breakpoints occurring between exons and ensure that the sequences at the DNA level and RNA level are accurate.
Example 2 editing of fusion Gene ROR1-DNAJC6
ROR1-DNAJC6 isROR1The 9 th exon part of gene (ENST 00000371079.6) andDNAJC6fusion between introns 1 of the gene (ENST 00000371069.5), respectively selecting sequences of 200 bp at the upstream and downstream of a natural breakpoint for display, wherein the sequences are shown as SEQ ID NO.14 and specifically as follows:
TCTCTTCTGATTCAGATATCTGGTCCTTTGGGGTTGTCTTGTGGGAGATTTTCAGTTTTGGACTCCAG CCATATTATGGATTCAGTAACCAGGAAGTGATTGAGATGGTGAGAAAACGGCAGCTCTTACCATGCTCTGAAGACT GCCCACCCAGAATGTACAGCCTCATGACAGAGTGCTGGAATGAGATTCCTTCTAGG//aaacaacttcccaaggtt gtacagcgattacagggtgaagctgccacctgtttatcttagtgcactggagcctgaggtcattgcccactcagtt tgatgccagacagaccagagttgctcattaacacttcataaagccctctcatgttcctcataataaccagacattt ctaattataacttgagcagcaaatgttgtt
the italic part of the sequence isROR1The gene sequence, underlinedDNAJC6The gene sequence, "/" is the natural breakpoint position of the fusion gene, with the capital letters being exons and the lowercase letters being introns.
1. Design of related sgRNA and recombinant vector
(1) With reference to FIG. 6The requirements are specifically as follows: against upstream genesROR1sgRNA of (1) and targeting downstream geneDNAJC6The sgRNA of (a) is a region within 100bp upstream or downstream of the natural breakpoint of the two genes, respectively.
Aiming at the two genes, two sgrnas are respectively designed, which are respectively as follows:
to is directed atROR1sgRNA1 of gene: SEQ ID No. 15;
to is directed atDNAJC6Gene sgRNA 2: SEQ ID No. 16;
the sgRNA was directly obtained by a chemical synthesis method, and the sgRNA of this example was synthesized by tassel corporation.
(2) Referring to the requirements of FIG. 6: region I, homologous left arm, starting fromROR1The 100-bp region upstream of the natural breakpoint terminates atROR1The natural breakpoint of (a); zone II, homologous right arm, starting fromDNAJC6The natural breakpoint of (1), comprising a 100-and 1000-bp region downstream thereof.
Preparing a recombinant AAV vector, wherein the sequence of the region I is SEQ ID NO.17, and the sequence of the region II is SEQ ID NO. 18.
2. The editing of gene fusion is referred to in example 1. And taking the correctly identified clone, and performing sequencing verification.
FIG. 7 shows the correct cell cloneROR1Exon 9 of gene andDNAJC6the result of Sanger sequencing at the DNA level of intron 1 fusion of the gene.
3. Detection of fusion gene mRNA expression
FIG. 8 shows the correct cell cloneROR1Exon 9 of gene andDNAJC6RNA level Sanger sequencing results for intron 1 fusion of the gene.
As can be seen from FIGS. 7 and 8, the method of the present invention can precisely connect the break points between the exon interior and the intron, and ensure the sequence at the DNA level and the RNA level to be correct.
Example 3 editing of the fusion Gene COSF1347
COSF1347 isFGFR3Intron 17 of gene (ENST 00000440486.8) andBAIAP2L1fusion between intron 1 of Gene (ENST 00000005260.9), selected at the natural breakpointThe downstream sequences of 200 bp are displayed, and the sequences are shown as SEQ ID NO.19, and specifically as follows:
CTTCAAGCAGCTGGTGGAGGACCTGGACCGTGTCCTTACCGTGACGTCCACCGACgtgagtgctggct ctggcctggtgccacccgcctatgcccctccccctgccgtccccggccatcctgccccccagagtgctgaggtgtg gggcgggccttctggggcacagcctgggcacagaggtggctgtgcgaagaggggct//ctttccacctcggggttc agaaggggactttacgcgggaaggtactttccctccctccagctcccctcccccgcgtccttccacctctcccggt ctctcccactcctcccctggccctccacagcccctcttcttcctcccctggccctctccttcctcccagtccctcc ccatcccctcccccctacttttcctcctcc
the italic part of the sequence isFGFR3The gene sequence, underlinedBAIAP2L1The gene sequence, "/" is the natural breakpoint position of the fusion gene, with the capital letters being exons and the lowercase letters being introns.
1. Design of related sgRNA and recombinant vector
(1) With reference to the requirements described in FIG. 9, for upstream genesFGFR3sgRNA of (1) and targeting downstream geneBAIAP2L1The sgRNA of (a) is a region within 100bp upstream or downstream of the natural breakpoint of the two genes, respectively.
Aiming at the two genes, two sgrnas are respectively designed, which are respectively as follows:
to is directed atFGFR3sgRNA1 of gene: SEQ ID No. 20;
to is directed atBAIAP2L1sgRNA2 of gene: SEQ ID No. 21;
the sgRNA was directly obtained by a chemical synthesis method, and the sgRNA of this example was synthesized by tassel corporation.
(2) Referring to the requirements of FIG. 9: region I, homologous left arm, starting fromFGFR3The 100-bp region upstream of the natural breakpoint terminates atFGFR3The natural breakpoint of (a); zone II, homologous right arm, starting fromBAIAP2L1The natural breakpoint of (1), comprising a 100-and 1000-bp region downstream thereof.
Preparing a recombinant AAV vector, wherein the sequence of the I region is shown as SEQ ID NO. 22; the sequence of the II area is SEQ ID NO. 23.
2. The editing of gene fusion is referred to in example 1. And taking the clone which is identified to be correct for sequencing verification.
FIG. 10 shows the correct cell cloneFGFR3Intron 17 of the gene andBAIAP2L1the result of Sanger sequencing at the DNA level of intron 1 fusion of the gene.
3. Detection of fusion gene mRNA expression
FIG. 11 shows the correct cell cloneFGFR3Intron 17 of the gene andBAIAP2L1RNA level Sanger sequencing results for intron 1 fusion of the gene.
As can be seen from FIGS. 10 and 11, the method of the present invention can precisely connect the break points between introns and ensure the sequence at DNA level and RNA level.
Sequence listing
<110> Jingliang Gene technology (Shenzhen) Limited
<120> a method for editing gene fusion
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 400
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cagccccatc atgcaccctc tgatcctgaa cccccggcac tccgtggatt tcaaacagtc 60
caggctctcc gaggacgggc tgcataggga agggaagccc atcaacctct ctcatcggga 120
agacctggct tacatgaacc acatcatggt ctctgtctcc ccgcctgaag agcacgccat 180
gcccattggg agaatagcag atgtgcagca cattaagagg agagacatcg tgctgaagcg 240
agaactgggt gagggagcct ttggaaaggt cttcctggcc gagtgctaca acctcagccc 300
gaccaaggac aagatgcttg tggctgtgaa ggtaaacccc agaggcatgc cggcaccagg 360
aggagggctg gctgagggcc cagggaggga aggaagaggc 400
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggcttacatg aaccacatca 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
catcgtgctg aagcgagaac 20
<210> 4
<211> 500
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
accataaccc tcccaccatt gaactgttgc accgctccag gtcacctatc acgacaaatc 60
accggccttc tcctgacccc gagcagcggc ccctccggtc ccccctggac aacatgatcc 120
gccgcctctc cccggctgag agagctcagg gacccaggcc gcaccaggag aacaaccacc 180
aggagtccta ccctctgtca gtgtctccca tggagaataa tcactgccca gcgtcctccg 240
agtcccaccc gaagccatcc agcccccggc aggagagcac acgcgtgatc cagctgatgc 300
ccagccccat catgcaccct ctgatcctga acccccggca ctccgtggat ttcaaacagt 360
ccaggctctc cgaggacggg ctgcataggg aagggaagcc catcaacctc tctcatcggg 420
aagacctggc ttacatgaac cacatcatgg tctctgtctc cccgcctgaa gagcacgcca 480
tgcccattgg gagaatagca 500
<210> 5
<211> 500
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gatgtgcagc acattaagag gagagacatc gtgctgaagc gagaactggg tgagggagcc 60
tttggaaagg tcttcctggc cgagtgctac aacctcagcc cgaccaagga caagatgctt 120
gtggctgtga aggtaaaccc cagaggcatg ccggcaccag gaggagggct ggctgagggc 180
ccagggaggg aaggaagagg ctccctccat ttgagaagat agtgctcaat tggctttctc 240
agatgcaatc aaaggacttt gctccgaggt caatgaagtt tcctagggac caaaacaact 300
tcctttggct tccaaggtca agggctgcag cacttaaggg ggctatgcca ggggagcaag 360
tttattcttg taaatgaccc tggtcctttt ttagtggccc tgtggttacc tctgtcccag 420
gcctggccct ccacactcca cccttcacca tgtagtggct ttacaggacg tgctgtctgt 480
gcctggaaag tcacatggcc 500
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ctctgctcca cagataactg tgt 23
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gggaagccca tcaacctctc 20
<210> 8
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
gttatgtaac gcggaactcc ata 23
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ttgacctcgg agcaaagtcc 20
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tggcttacat gaaccacatc a 21
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
cggctgtcag aaagcaactg 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cgtggctgtc atcagtggtg 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
cctcacccag ttctcgcttc 20
<210> 14
<211> 400
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tctcttctga ttcagatatc tggtcctttg gggttgtctt gtgggagatt ttcagttttg 60
gactccagcc atattatgga ttcagtaacc aggaagtgat tgagatggtg agaaaacggc 120
agctcttacc atgctctgaa gactgcccac ccagaatgta cagcctcatg acagagtgct 180
ggaatgagat tccttctagg aaacaacttc ccaaggttgt acagcgatta cagggtgaag 240
ctgccacctg tttatcttag tgcactggag cctgaggtca ttgcccactc agtttgatgc 300
cagacagacc agagttgctc attaacactt cataaagccc tctcatgttc ctcataataa 360
ccagacattt ctaattataa cttgagcagc aaatgttgtt 400
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
gctggaatga gattccttct 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tgtaatcgct gtacaacctt 20
<210> 17
<211> 500
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
cacactctga tgttggctgc agcagtgatg aagatgggac tgtgaaatcc agcctggacc 60
acggagattt tctgcacatt gcaattcaga ttgcagctgg catggaatac ctgtctagtc 120
acttctttgt ccacaaggac cttgcagctc gcaatatttt aatcggagag caacttcatg 180
taaagatttc agacttgggg ctttccagag aaatttactc cgctgattac tacagggtcc 240
agagtaagtc cttgctgccc attcgctgga tgccccctga agccatcatg tatggcaaat 300
tctcttctga ttcagatatc tggtcctttg gggttgtctt gtgggagatt ttcagttttg 360
gactccagcc atattatgga ttcagtaacc aggaagtgat tgagatggtg agaaaacggc 420
agctcttacc atgctctgaa gactgcccac ccagaatgta cagcctcatg acagagtgct 480
ggaatgagat tccttctagg 500
<210> 18
<211> 500
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
aaacaacttc ccaaggttgt acagcgatta cagggtgaag ctgccacctg tttatcttag 60
tgcactggag cctgaggtca ttgcccactc agtttgatgc cagacagacc agagttgctc 120
attaacactt cataaagccc tctcatgttc ctcataataa ccagacattt ctaattataa 180
cttgagcagc aaatgttgtt taagataggt tatgagcccc aagttgaagg gatggctttt 240
ataccatgtt tgctgagtat gagctcaggt cagacaaaat attgggtgac caaattggca 300
aagaccattg tccctgtatt ccattttgct gtcagcagtg ctcttggttt attttctttt 360
ccatgaggaa actgaggcac agagctatca caggacttat tccatgtggt aatgttggga 420
tttgctccac attgttatga taccaagctg gaaatcttca ttctcctgct gccacatgtt 480
ccttactctg ggggggcctg 500
<210> 19
<211> 400
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
cttcaagcag ctggtggagg acctggaccg tgtccttacc gtgacgtcca ccgacgtgag 60
tgctggctct ggcctggtgc cacccgccta tgcccctccc cctgccgtcc ccggccatcc 120
tgccccccag agtgctgagg tgtggggcgg gccttctggg gcacagcctg ggcacagagg 180
tggctgtgcg aagaggggct ctttccacct cggggttcag aaggggactt tacgcgggaa 240
ggtactttcc ctccctccag ctcccctccc ccgcgtcctt ccacctctcc cggtctctcc 300
cactcctccc ctggccctcc acagcccctc ttcttcctcc cctggccctc tccttcctcc 360
cagtccctcc ccatcccctc ccccctactt ttcctcctcc 400
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
cagaggtggc tgtgcgaaga 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
ttccacctcg gggttcagaa 20
<210> 22
<211> 500
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
acgctggggg gctccccgta ccccggcatc cctgtggagg agctcttcaa gctgctgaag 60
gagggccacc gcatggacaa gcccgccaac tgcacacacg acctgtgagt ggcatccctg 120
gccctccact gggtcctcag gggtgggggt ccctccgggg ctgggcgggg gagggactgg 180
cagcccttca ggctgttccc gaataaggcg ggaagcggcg gggctcactc ctgagcgccc 240
tgcccgcagg tacatgatca tgcgggagtg ctggcatgcc gcgccctccc agaggcccac 300
cttcaagcag ctggtggagg acctggaccg tgtccttacc gtgacgtcca ccgacgtgag 360
tgctggctct ggcctggtgc cacccgccta tgcccctccc cctgccgtcc ccggccatcc 420
tgccccccag agtgctgagg tgtggggcgg gccttctggg gcacagcctg ggcacagagg 480
tggctgtgcg aagaggggct 500
<210> 23
<211> 450
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ctttccacct cggggttcag aaggggactt tacgcgggaa ggtactttcc ctccctccag 60
ctcccctccc ccgcgtcctt ccacctctcc cggtctctcc cactcctccc ctggccctcc 120
acagcccctc ttcttcctcc cctggccctc tccttcctcc cagtccctcc ccatcccctc 180
ccccctactt ttcctcctcc ttccctcccc tcctccctgt gcttcttccc tgtctctctt 240
tcccgccccg ctgtacctct ccctctgccc ctccgctccc cgttcactct ccctcctccc 300
ctgcccctcg acactgtccc tcccctcctc ctggttcttc cttctccccc gtgtgtctcc 360
ccctcctccc ctgtcccttc ttctccccag tctatccccc tccctccccc tccccctccc 420
cctcctcttg gttcttcctc cttccccgtg 450
Claims (5)
1. An editing method for a fusion gene, the editing method comprising:
(1) designing a sgRNA near the natural breakpoint of two genes involved in fusion;
(2) designing a recombinant AAV vector to enable two broken DNAs to undergo homologous recombination and repair;
the sgRNA is in a region within 100bp upstream or downstream of a natural breakpoint of the gene, and the natural breakpoint is in the exon, the exon boundary or an intron region;
the two genes are gene A and gene B, and the recombinant AAV vector comprises two structural regions:
the I region is a homologous left arm, starts from a 100-plus 1000 bp region at the upstream of the natural breakpoint of the gene A and ends at the natural breakpoint of the gene A;
the region II is a homologous right arm, starts from the natural breakpoint of the gene B and comprises a downstream 100-and 1000-bp region;
the fusion gene is a fusion gene COSF571, the sgRNA is SEQ ID NO.2 and SEQ ID NO.3, and the recombinant AAV vector I area is selected from: SEQ ID NO.4, and the recombinant AAV vector II region is selected from: SEQ ID No. 5;
or the fusion gene is a fusion gene ROR1-DNAJC6, the sgRNA is SEQ ID NO.15 and SEQ ID NO.16, and the recombinant AAV vector I is selected from: SEQ ID No.17, and the recombinant AAV vector II region is selected from: SEQ ID No. 18;
or the fusion gene is COSF1347, the sgRNA is SEQ ID NO.20 and SEQ ID NO.21, and the recombinant AAV vector I is selected from: SEQ ID No.22, and the recombinant AAV vector II region is selected from: SEQ ID NO. 23.
2. The method for editing a fusion gene according to claim 1, comprising the steps of:
(1) designing related sgRNA, and preparing a recombinant AAV vector;
(2) sgRNA transfected cells and recombinant AAV infected cells;
(3) and detecting mRNA of the fusion gene.
3. The editing method according to claim 2, wherein the step (2) comprises: mixing the two sgRNAs with the Cas9 protein respectively, and transfecting cells by adopting an electroporation method; after electroporation was complete, cells were infected with recombinant AAV.
4. The editing method according to claim 3, wherein the two sgRNAs are mixed with the Cas9 protein respectively in a mass ratio of 1: 3; the multiplicity of infection of the recombinant AAV was 100000.
5. Use of a reagent for detecting the fusion gene of claim 1 in the preparation of a medicament and/or a kit for diagnosing a tumor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111280023.9A CN113717991B (en) | 2021-11-01 | 2021-11-01 | Method for editing gene fusion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111280023.9A CN113717991B (en) | 2021-11-01 | 2021-11-01 | Method for editing gene fusion |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113717991A CN113717991A (en) | 2021-11-30 |
| CN113717991B true CN113717991B (en) | 2022-02-01 |
Family
ID=78686277
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111280023.9A Active CN113717991B (en) | 2021-11-01 | 2021-11-01 | Method for editing gene fusion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113717991B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110272900B (en) * | 2019-04-19 | 2024-03-26 | 中国人民解放军陆军军医大学 | sgRNA for preparing skeletal dysplasia pig model and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109957570A (en) * | 2019-04-04 | 2019-07-02 | 重庆医科大学 | The gRNA sequence and its application of targeting editor's bcr-abl fusion |
| WO2020127487A1 (en) * | 2018-12-21 | 2020-06-25 | Aarhus Universitet | Crispr gene therapy of fusion gene related cancers |
| CN112011615A (en) * | 2020-09-01 | 2020-12-01 | 上海睿璟生物科技有限公司 | Gene fusion kit for human thyroid cancer and detection method |
| CN112592979A (en) * | 2021-01-11 | 2021-04-02 | 长沙艾迪康医学检验实验室有限公司 | Primer, probe and method for one-tube screening of ETV6-NTRK3 fusion gene in tumor patient |
| CN113249490A (en) * | 2021-07-06 | 2021-08-13 | 迈杰转化医学研究(苏州)有限公司 | Probe library for detecting FGFR family gene inhibitor sensitivity and drug resistance variation and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3775238A1 (en) * | 2018-04-05 | 2021-02-17 | Juno Therapeutics, Inc. | Methods of producing cells expressing a recombinant receptor and related compositions |
-
2021
- 2021-11-01 CN CN202111280023.9A patent/CN113717991B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020127487A1 (en) * | 2018-12-21 | 2020-06-25 | Aarhus Universitet | Crispr gene therapy of fusion gene related cancers |
| CN109957570A (en) * | 2019-04-04 | 2019-07-02 | 重庆医科大学 | The gRNA sequence and its application of targeting editor's bcr-abl fusion |
| CN112011615A (en) * | 2020-09-01 | 2020-12-01 | 上海睿璟生物科技有限公司 | Gene fusion kit for human thyroid cancer and detection method |
| CN112592979A (en) * | 2021-01-11 | 2021-04-02 | 长沙艾迪康医学检验实验室有限公司 | Primer, probe and method for one-tube screening of ETV6-NTRK3 fusion gene in tumor patient |
| CN113249490A (en) * | 2021-07-06 | 2021-08-13 | 迈杰转化医学研究(苏州)有限公司 | Probe library for detecting FGFR family gene inhibitor sensitivity and drug resistance variation and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Analyzing Somatic Genome Rearrangements in Human Cancers by Using Whole-Exome Sequencing;Lixing Yang et al.;《The American Journal of Human Genetics》;20160505;第98卷;第843-856页 * |
| CRISPR Gene Editing of Murine Blood Stem and Progenitor Cells Induces MLL-AF9 Chromosomal Translocation and MLL-AF9 Leukaemogenesis;Evgenia Sarrou et al.;《International Journal of Molecular Sciences》;20200615;第21卷(第4266期);第1-15页 * |
| 应用CRISPR-Cas9技术高效构建MLL-AF9基因融合模型;陈淼;《中国优秀硕博士学位论文全文数据库(硕士) 医药卫生科技辑》;20180115(第1期);第E072-317页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113717991A (en) | 2021-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chalberg et al. | Integration specificity of phage ϕC31 integrase in the human genome | |
| CN104968784B (en) | Composition and application thereof comprising guide RNA and CAS protein-encoding nucleic acid or CAS protein | |
| WO2017173004A1 (en) | A method for in vivo precise genome editing | |
| RU2766685C2 (en) | Rna-guided human genome engineering | |
| EP3536796A1 (en) | Gene knockout method | |
| AU2018339164B2 (en) | Artificial genome manipulation for gene expression regulation | |
| JP2002535995A (en) | Gene repair involving induction of double-stranded DNA breaks at chromosomal target sites | |
| EP0656954A1 (en) | Method for producing tagged genes, transcripts, and proteins | |
| WO2024012300A1 (en) | Gene editing method and use | |
| CN113717991B (en) | Method for editing gene fusion | |
| CN112899237A (en) | CDKN1A gene reporter cell line and construction method and application thereof | |
| US20220304286A1 (en) | SYSTEMS AND METHODS FOR IN VIVO DUAL RECOMBINASE-MEDIATED CASSETTE EXCHANGE (dRMCE) AND DISEASE MODELS THEREOF | |
| Kannan et al. | Dynamic silencing of somatic L1 retrotransposon insertions reflects the developmental and cellular contexts of their genomic integration | |
| KR101863653B1 (en) | Knock in vector for expressing lactoferrin and knock in method using thereof | |
| CN110964744A (en) | Human osteosarcoma U-2OS tool cell line capable of stably expressing Cas9 protein and preparation method and application thereof | |
| CN110551762B (en) | CRISPR/ShaCas9 gene editing system and application thereof | |
| US20230295652A1 (en) | Artificial genome manipulation for gene expression regulation | |
| WO2020146732A1 (en) | Compositions and methods related to reporter systems and large animal models for evaluating gene editing technology | |
| CN110499335B (en) | CRISPR/SauriCas9 gene editing system and application thereof | |
| CN107881200A (en) | A kind of rapid screening method applied to model animal zebra fish transgenosis | |
| WO2019028686A1 (en) | Gene knockout method | |
| CN109385421A (en) | Gene knockout method | |
| CN110551763B (en) | CRISPR/SlutCas9 gene editing system and application thereof | |
| CN108949756B (en) | Construction method of zebra fish heart specific expression model and related vector | |
| CN113993375A (en) | Hemophilia B rat model |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: Unit 802, Unit 3, Building 1, Dabaihui Life and Health Industrial Park, No. 2028, Shenyan Road, Tiandong Community, Haishan Street, Yantian District, Shenzhen City, Guangdong Province, 518081 Patentee after: Jingliang Technology (Shenzhen) Co.,Ltd. Address before: 8 / F, block 3A, phase II, dabaihui life and Health Industrial Park, 2028 Shenyan Road, Tiandong community, Haishan street, Yantian District, Shenzhen City, Guangdong Province Patentee before: Jingliang gene technology (Shenzhen) Co.,Ltd. |
|
| CP03 | Change of name, title or address |