KR101863653B1 - Knock in vector for expressing lactoferrin and knock in method using thereof - Google Patents

Abstract

The present invention relates to a knock-in vector for producing a therapeutic protein and a knock-in method using the knock-in vector. As a 5'-arm, there is provided a microorganism which comprises a microorganism having a nucleotide sequence of SEQ ID NO: A 5 'end fragment comprising the promoter of genomic DNA, exons 1 and 2; A gene encoding a therapeutic protein; And a 3'-arm, which comprises exon 3, 4, 5 and 6 of a sub-beta-casein genomic DNA consisting of a polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 2, Lt; / RTI > vector.

Description

Knock-in vectors for expressing lactoferrin and knock-in vectors using the knock-

The present invention relates to a knock-in vector and a knock-in method using the same, and more particularly, to a knock-in vector for lactoferrin expression and a knock-in method using the knock-in vector.

A transgenic animal is an artificially introduced foreign gene in the genome of an animal. It was first developed in 1982 by the Palmiter and Brinster groups of the United States in 1982, , Transgenic livestock were developed by the Hammer group to produce human growth hormone in rabbits, pigs and sheep, both of which are domestic animals. Methods for producing transgenic animals include microinjection, retroviral vector, animal cloning using embryonic stem cells and somatic cells. In the early transgenic animal, the foreign gene is mainly transferred to the nucleus embryo And then embryos were transplanted into the surrogate mother. In this method, a vector carrying a foreign gene is randomly inserted into a genome by linking a general promoter with a gene to be expressed, so that the production efficiency of the transformant is very low as 2 to 3% There is a problem that the gene is not expressed locally or locally in a promoter-specific manner. In order to overcome this problem, a method of producing a cloned animal using somatic cells after manipulating a specific gene in somatic cells of a livestock using a gene targeting method has been proposed, but this is also known to be low in efficiency. In this regard, Korean Patent No. 1507600 discloses a knock-in vector produced using sobetalkase for the production of a therapeutic protein.

However, in the case of the above-mentioned prior art, it is difficult to obtain a transgenic embryo and production efficiency is low because it is a method of introducing a vector into a somatic cell and then producing a cloned animal using somatic cells genetically-matched by homologous gene recombination.

It is an object of the present invention to provide a knock-in method for producing transgenic animals and a method for producing recombinant protein by the method, . However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided, as a 5'-arm, a promoter of a sub-beta-casein genomic DNA consisting of a polynucleotide having a nucleic acid sequence represented by SEQ ID NO: 1, a 5'- snippet; A gene encoding a therapeutic protein; And a 3'-arm, which comprises exon 3, 4, 5 and 6 of a sub-beta-casein genomic DNA consisting of a polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 2, Is provided.

According to another aspect of the present invention, there is provided a microinjection step of microinjecting the knock-in vector and a CRISPR / Cas9 artificial enzyme into mammalian embryos; Culturing the microinjected embryo to a blastocyst; An amplification step of amplifying the DNA of the blastocyst embryo by PCR; And determining whether the amplified PCR product is present or not and inserting the vector into place of the sub-beta-casein genomic DNA.

According to another aspect of the present invention, there is provided a transformant for mass production of a therapeutic protein, wherein the knock-in vector is transformed into a host cell.

According to another aspect of the present invention, there is provided a method for producing a therapeutic protein, comprising introducing the knock-in vector into a cell to express a therapeutic protein.

According to one embodiment of the present invention as described above, it is possible to efficiently produce fertilized eggs of a transgenic animal according to accurate gene hits. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a schematic diagram showing a process of producing a transformant using a knock-in vector and a crystal gene scissors (CRISPR / Cas9) according to an embodiment of the present invention, in comparison with a nuclear replacement method.
Fig. 2 is a schematic diagram showing the structure and homologous recombination of pDT_A_RG1_bBCE3_hLF_EGFP KI vector I.
Fig. 3 is a schematic diagram showing the structure of a circular plasmid of pDT_A_RG1_bBCE3_hLF_EGFP KI vector I.
Fig. 4 is a schematic diagram showing a construction step of pDT_A_RG1_bBCE3_hLF_EGFP KI vector I.
FIG. 5 is a photograph showing the cloning of a vector pDT_A_RG1_bBCE3_hLF_EGFP KI vector I knock-in vector prepared using a sub-beta-casein according to an embodiment of the present invention.
FIG. 6 is a gel photograph of the cleavage activity of CRISPR / Cas9 in the bovine mammary gland cell line MAC-T cell by T7 endonuclease analysis.
FIG. 7 is a microphotograph showing the cleavage activity of CRISPR / Cas9 in a bovine mammary cell line, MAC-T cell, using a reporter gene.
8 is a photograph showing the expression of a marker gene GFP by microinjecting a knock-in vector for protein production and a CRISPR / Cas9 gene into a preprocentric embryo according to an embodiment of the present invention .
FIG. 9 is an electrophoresis image of a knock-in embryo produced according to an embodiment of the present invention, in which homologous recombination has occurred by PCR.

Definition of Terms:

As used herein, the term " knock-in vector "refers to a gene targeting gene that knockout a specific gene and express the exogenous gene Lt; / RTI > Since the foreign gene inserted by the knock-in vector can utilize all parts of the gene expression regulatory region located in the genome of the inserted position, it is likely to be expressed by the expression amount of the gene originally present at the position.

As used herein, the term "therapeutic protein" refers to a protein or polypeptide having therapeutic activity.

As used herein, the term "clustered regulatory interspaced short palindromic repeat (CRISPR) / Cas9" is a gene scissor, and the constituent sgRNA has the ability to recognize a specific DNA base sequence of 20 bp. Cas9 protein binds to sgRNA Have been reported to have the ability to cleave specific DNA. In the case of large-scale cattle, the specific part of the cow beta-casein gene is cleaved to produce a biotin-producing specific gene by homologous gene recombination, although the animal is produced more efficiently by CRISPR / Cas9 The results of the introduction are not reported.

As used herein, the term " lactoferrin "refers to a protein that has antimicrobial, antiviral, anti-cancer, and anti-inflammatory properties while functioning to regulate immune function.

  As used herein, the term "gene targeting" refers to a technique of introducing a gene mutated at a specific chromosomal location by homologous gene recombination, introducing the gene hit vector into a specific gene locus in a mouse stem cell by homologous gene recombination And then used to produce chimeric mice using the stem cells, which are mainly used for knock-out mouse production, and are distinguished by knock-out and knock-in.

 As used herein, the term "knock-out" refers to introducing a gene mutated by homologous gene recombination at a specific gene position to prevent expression of a specific gene.

 The term " knock-in "as used herein refers to the introduction of a foreign gene to be expressed at the position of a specific gene by homologous gene recombination. The foreign gene inserted includes a promoter and a phosphorus of a specific gene Lt; RTI ID = 0.0 > of the < / RTI > gene expression regulatory sequences.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention, there is provided, as a 5'-arm, a promoter of a sub-beta-casein genomic DNA consisting of a polynucleotide having a nucleic acid sequence represented by SEQ ID NO: 1, a 5'- snippet; A gene encoding a therapeutic protein; And a 3'-arm, which comprises exon 3, 4, 5 and 6 of a sub-beta-casein genomic DNA consisting of a polynucleotide having the nucleic acid sequence set forth in SEQ ID NO: 2, Is provided.

In the knock-in vector for producing a therapeutic protein, the therapeutic protein may be human lactoferrin, and the gene encoding human lactoferrin may be a polynucleotide having a nucleic acid sequence of SEQ ID NO: 3, A polyA signal can be further ligated to the 3 ' end of the gene encoding human lactoferrin.

 In the knock-in vector for producing a therapeutic protein, a reporter gene for confirming the expression of the fusion fluorescent protein may be further connected to the 3 'end of the gene encoding the human lactoferrin, (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP), cyan fluorescent protein protein, CFP), a blue fluorescent protein (BFP) or a far-red fluorescent protein.

 In the knock-in vector for producing the therapeutic protein, a negative selectable marker may be included together, and the negative selection marker may be a diphtheria toxin (DT-A) gene.

According to another aspect of the present invention, there is provided a microinjection step of microinjecting the knock-in vector and a CRISPR / Cas9 artificial enzyme into mammalian embryos; Culturing the microinjected embryo to a blastocyst; An amplification step of amplifying the DNA of the blastocyst embryo by PCR; And determining whether the amplified PCR product is present or not and inserting the vector into place of the sub-beta-casein genomic DNA.

In the knock-in method, the CRISPR / Cas9 artificial enzyme may target a nucleic acid sequence represented by SEQ ID NO: 15.

According to another aspect of the present invention, there is provided a transformant for mass production of a therapeutic protein, wherein the knock-in vector is transformed into a host cell.

According to another aspect of the present invention, there is provided a method for producing a therapeutic protein, comprising introducing the knock-in vector into a cell to express a therapeutic protein.

Conventionally, in order to produce a therapeutic protein, a knock-in vector was transformed into somatic cells and the transformed somatic cells were injected into the oocyte to induce nuclear replacement. However, this method is not a method in which knock- The production efficiency of transgenic embryos was very low. However, the present invention is based on the fact that a knock-in vector capable of targeting the exon 3 position of the sobeta-casein gene is microinjected into bovine precursor nucleus embryos with a crystal gene scissor (CRISPR / Cas9) (Fig. 1). As shown in Fig. 1, the selection rate of transgenic embryos is much higher than that of nuclear substitution.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1: Construction of a knock-in vector for microinjection

In order to construct a knock-in vector for microinjection for the production of a human therapeutic protein (lactoferrin) according to an embodiment of the present invention, a small molecule consisting of a polynucleotide having a nucleic acid sequence shown in SEQ ID NO: 1 (SEQ ID NO: 3) encoding a human therapeutic protein gene lactoferrin to be produced using a 5'-arm and knock-in vector comprising a part of intron 1 of beta-casein genomic DNA and a part of exon 2 ) And cloned a 3'-arm plasmid containing exons 4 to 6 of the sub-beta-casein genomic DNA consisting of the polynucleotide having the nucleic acid sequence shown in SEQ ID NO: 2. Also, a plasmid containing a polynucleotide (SEQ ID NO: 4) encoding a BGH polyA signal necessary for stable expression and transition from the nucleus to the cytoplasm was ligated to the 3'-arm portion of the gene and further cloned from the embryo into EGFP EGFP-polyA gene (SEQ ID NO: 16) as a marker for confirming the expression of the BGH polyA was cloned at the 3 'end of the BGH polyA.

1-1: Cloning of pBSK-bBCE3 5'_hLF plasmid

In order to clone a human lactoferrin gene linked to a 5'-arm according to an embodiment of the present invention, a knock-in vector (registration number: 10-1507600, manufactured by using a conventional patent, sobeta casein, 3, 2015 using the pMCDT-polyA-neo-βC3 'vector obtained from the 25th) as a template and LF 5 arm Not I S (RGEN) primer (SEQ ID NO: 5), LF 3 arm Xba I aS (RGEN) primer ( (SEQ ID NO: 6) and pfu-X DNA plymerase (SolGent) under conditions of 95 ° C for 20 seconds, 54 ° C for 40 seconds and 72 ° C for 1 minute to contain about 1 kb of 5'- arm and lactoferrin gene A total of about 3.12 kb fragment was obtained. The obtained fragment was digested with restriction enzymes Not I and Xba I and then subcloned into pBSK / Not I- Xba I vector to determine the entire nucleotide sequence.

1-2: Cloning of pBSK-b? CE4-E6 3 'plasmid

3'-arm of E2 / E8 plasmid pGEM-bBC which is secured to the conventional as a template bBC E3 3-arm S Hind Ⅲ sense primer (SEQ ID NO: 7), according to one embodiment of the invention, E6 bBC-Sal I PCR amplification was carried out using AS2 antisense primer (SEQ ID NO: 8) and Pfu DNA polymerase (BioFACT) for 35 cycles at 95 ° C for 20 seconds, 68 ° C for 40 seconds and 72 ° C for 1 minute. The fragment of about 2.08 kb obtained by the above amplification was digested with restriction enzymes Hind III and Sal I, and then subcloned into pBSK / Hind III- Sal I vector to confirm the entire nucleotide sequence. Information on all the primers used in the present invention, including the primers used in the cloning, is shown in Table 1 below.

primer The nucleic acid sequence (5 '-> 3') SEQ ID NO: LF 5 arm Not I S (RGEN) gcgcggccgctgtcaagagatgttgatggc 5 LF 3 arm Xba I AS (RGEN) gctctagattcggttttacttcctgaggaa 6 bBC-E3 3 arm S Hind III gcaagcttattgtggaaagcctttcaagc 7 bBC-E6 Sal I AS2 gcgtcgacctctgtttgctgctgttcctcac 8 CRISPR / Cas9 sense primer GCT GTG TCTATT CAA CAC AGG ATG ATA CTC 9 CRISPR / Cas9 anti-sense primer AAC ACT ATC TTA CCT CAC TGC TTG AAA GGC 10 M13_R_RG1_hLF 5 Sc S5 GGAAACAGCTATGACCATGGTAGTTTGCAAATCTGGGATTGAAGATGTG 11 M13_F_hLF Sc AS4 GGTTTTCCCAGTCACGACCCCGAGGAACAGCAGGACGAGGAAGACAAG 12 M13-F GGTTTTCCCAGTCACGAC 13 M13-R GGAAACAGCTATGACCATG 14

1-3: Subcloning of Knock-in Vector

In accordance with one embodiment of the present invention, the pBSK-bEBE3 5'-hLF plasmid was digested with Not I and Xba I into a vector obtained by digesting the previously obtained pBSK-tEndo-GFP KI vector III with restriction enzymes Not I and Xba I One insert (5'arm-hLF) was ligated to obtain pBSK-bBCE3_hLF_BGHpA_EGFP_BGHpA_bBCE7_3'arm plasmid. In addition, 3 'connected to the arm (arm) is cut into pBSK-bβCE4-E6 3'- arm for the insert of about 2.08 kb obtained by cutting the plasmid with Hind Ⅲ and Sal I pBSK-bBCE3_hLF_BGHpA_EGFP_BGHpA_bBCE7_3arm plasmid with Sal I Hind Ⅲ And ligated to the obtained vector to construct pBSK-RG1_bBCE3_hLF_GFP KI vector I (FIG. 2). Thereafter, the final vector DT-A_RG1_bBCE3_hLF_GFP KI in order to establish a vector I pBSK-RG1_bBCE3_hLF_GFP KI vector I and ligated to the insert was obtained by cutting with Not I and Sal I to pMCDT-A / Not I Sal vector knock-in vector ( DT-A_RG1_bBCE3_hLF_GFP KI vector I) (FIGS. 3 and 4).

Example 2: Validation of Knock-in Vectors

The DT-A_RG1_bBCE3_hLF_GFP KI vector I vector finally prepared in Example 1 was confirmed to be cloned normally. As a result, the prepared vector is synthesized into mRNA together with beta-casein exon 2 and lactoferrin gene, and lactoferrin polypeptide can be synthesized using the mRNA. The knock-in vector was digested with restriction enzymes Not I, Xba I, Hind III and Sal I, and the 5'-arm-lactoferrin gene, BGH polyA-CMV-EGFP-plyA fragment, 3'- arm and pMCDT- (Fig. 5).

Example 3: Purification of knock-in vector

In accordance with an embodiment of the present invention, the knock-in vector prepared above is cut into restriction enzyme Not I in order to microinject into the nucleus-containing embryos, treated with phenol and chloroform, and then precipitated with ethanol And the DNA was concentrated. Next, the knock-in vector was purified from agarose gel using a GIAquick Gel Extraction kit (Qiagen) by an electrophoresis method. For the final purification, RNase free water was used as an elution buffer and the concentration was adjusted to 10 to 25 ng / μl to microinject the final purified knock-in vector into the nucleus embryos.

Example 4: Securing CRISPR / Cas9 capable of cleaving the exon 3 position of the cow β-casein gene

In accordance with one embodiment of the present invention, sgRNA and expression vector, Cas9 mRNA and expression vector that recognize the cow beta-casein gene exon 3 position sequence (SEQ ID NO: 15) were all purchased from Toolgen.

4-1: Measurement of activity by T7 endonuclease I

In accordance with one embodiment of the present invention, the activity of CRISPR / Cas9 was verified in MAC-T cells, which are mammary gland cells. First, MAC-T cells were cultured in DMEM (Hyclone, Logan, USA), 10% FBS (Hyclone), 1% penicillin / streptomycin (Hyclone), 5 μg / ml insulin (Sigma, St Louis, USA) (1.6 × 10 ⁵ ) were seeded in a 6 mm culture dish. After 1 day, 1.625 μg of the sgRNA vector, 1.625 μg of the Cas 9 vector and 1.6 μg of Lipofectamin 2000 (Invitrogen, Waltham, Calif.) were cultured under the conditions of hydrocortisone USA) was used for transfection. After 48 hours, the cells were harvested and genomic DNA was isolated using G-DEX ™ IIc For Cell / tissue Genomic DNA Extraction Kit (Intron, Seongnam-si, Korea). (SEQ ID NO: 9), antisense primer (SEQ ID NO: 10) and Ex taq (Takara) for the site which can be cleaved by CRISPR / Cas9 to measure the activity of CRISPR / PCR was carried out under conditions of 56 ° C for 30 seconds and 72 ° C for 1 minute and 33 cycles. The activity of T7 endonuclease I was measured by treating the PCR product produced by the above amplification with QIAgen quick gel extract kit (QIAgen), using 1 μg DNA extracted at 95 ° C for 10 minutes, Treated at intervals of 2 ° C and treated at intervals of 0.1 ° C per second up to 25 ° C. 1 μl (10 units) of T7 endonuclease I (NEB, Ipswich, USA) was added to the DNA thus treated, treated at 37 ° C. for 30 minutes, and then electrophoresed on 2% agarose gel to obtain a fragment of 325 bp and 151 bp, it was confirmed that beta-casein exon 3 was cleaved by the CRISPR / Cas9 system (Fig. 6).

4-2: Measurement of activity of CRISPR / Cas9

In accordance with one embodiment of the present invention, the activity of CRISPR / Cas9 was verified using RFP-GFP reporter vector in MAC-T cells, cow stream cells. First, MAC-T cells were cultured in DMEM (Hyclone, Logan, USA), 10% FBS (Hyclone), 1% penicillin / streptomycin (Hyclone), 5 μg / ml insulin (Sigma, St Louis, USA) ml hydrocortisone (Sigma). The cells (2.5x10 ⁵ ) were seeded in a 6 mm culture dish, and after 1 day, 1.25 μg of sgRNA expression vector, 1.25 μg of Cas9 expression vector, 2.5 μg of exon 2 target or exon 7 target RFP-GFP reporter plasmid, and jetPEI transfection Transfection was performed using a reagent (polyplus-transfection, Illkirch, France). After 36 hours, the degree of RFP and GFP expression was confirmed by fluorescence microscopy (Nikon, Tokyo, Japan).

As a result, when exon 7 target RFP-GFP reporter plasmid and sgRNA / Cas9 were introduced with non-target site, only RFP was verified and it was confirmed that the non-target site was not cleaved, and exon2 target Only the RFP-GFP reporter plasmid and the Cas9 vector alone were confirmed as RFP. However, when exon 2 sgRNA expression vector and exon 2 target RFP-GFP reporter plasmid and Cas9 vector were introduced, expression of GFP was observed in RFP-expressing cells. Thus, CRISPR / Cas9 system used in this experiment specifically recognized exon 3 (FIG. 7).

Experimental Example 5: Microinjection of prenucleated embryos in a knock-in vector

The final concentration of the linearized knock-in vector was 10 ng / μl or 25 ng / μl, and the sgRNA and Cas9 (SEQ ID NO: 2) were prepared as described above according to an embodiment of the present invention. mRNA was used for the experiment so that the final concentration was 100 ng / μl.

5-1: Preparation of all nucleus embryos

According to one embodiment of the present invention, the small ovaries recovered from the slaughterhouse were transferred to a laboratory in a physiological saline solution containing 75 μg / ml potassium penicillin G at a temperature of 25-30 ° C., After follicles were washed, only follicles with a diameter of 3-6 mm were selected, and the follicles were collected under a stereomicroscope after being inhaled by a syringe equipped with an 18 gauge needle. The recovered oocytes were washed three times with Tyrode's lactate (TL) -Hepes solution, washed three times with in vitro maturation medium, and 10-15 follicles were added to 50 μl of in vitro maturation medium (TCM-199) And 5% CO ₂ for 24 hours. Fertilized oocytes were washed three times in Fert-TALP and transferred to fertilized culture medium (44 μl) in a volume of 10 ml. Frozen bovine spermatozoa were adjusted to a final concentration of 2 ㅧ 10 ⁶ / ml, / ml Heparin and PHE were added together and the modification was induced for 18 hours at 38.5 ℃ and 5% CO ₂ . Embryos confirmed to have a second polar body at 16-18 hours after in vitro fertilization were selected and prepared for microinjection.

5-2: Microinjection of knock-in vector

According to one embodiment of the present invention, the embryos identified with the second polar body 16-18 hours after in vitro fertilization were selected and used for microinjection. In order to microinject sgRNA, Cas9 mRNA and knock-in vector into the nucleus of embryo, the embryos were centrifuged at 12,000 rpm for 5 minutes to facilitate the observation of the nucleus by biasing the lipid to one side. Then, microinjection was performed on the nucleus of bovine embryo using a micro manipulator mounted on an inverted microscope. The microinjected embryos were washed in CR1-aa medium supplemented with 3 mg / ml BSA, and then transferred to 50 ㎕ colony by 10-15. The cells were cultured for 7 days under the conditions of 38.5 ℃ and 5% CO ₂ . The marker gene EGFP was expressed in all the blastocyst embryos and sgRNA, cas9 mRNA and knock-in vector were successfully injected into the nucleus embryo (FIG. 8).

Experimental Example 6: Knock-in Verification from Microinjected Embryos

In accordance with one embodiment of the present invention, knock-in assays from microinjected embryos with sgRNA, Cas9 mRNA and knock-in vectors were verified as follows. First, 10 μl of 1 × direct buffer (50 mM Tris-HCl, (pH 8.5), 1 mM EDTA, 0.005% SDS, 200 μg / ml Proteinase K) was added to the PCR tube with one embryo developed after blastocyst development Proteinase K was inactivated by treatment at 55 ° C for 2 hours and then at 95 ° C for 10 minutes, and 2 μl of 20% Tween20 was added to the final concentration of 2% before PCR. Using the prepared DNA solution as a template, PCR was carried out at 98 ° C. for 10 seconds and 68 ° C. for 1.5 minutes using M13_R_RG1_hLF 5 Sc S5 (SEQ ID NO: 11), M13_F_hLF Sc AS4 (SEQ ID NO: 12) and FX Neo polymerase (TOYOBO, KFX- (SEQ ID NO: 13), M13-R primer (SEQ ID NO: 13), and M13-R primer (SEQ ID NO: 13) were used as the template and 1 mu l of the first PCR product was used as a template. No. 14) and Go Taq polymerase under conditions of 30 cycles of 94 ° C for 30 seconds, 64 ° C for 30 seconds, and 72 ° C for 1.5 minutes in a total of 30 cycles. The amplified fragments were then subjected to electrophoresis on 1% agarose gel to confirm amplification (FIG. 9). Also, sgRNA, Cas9 mRNA and knock-in vector were amplified by PCR using 4 The knocked-in bands were detected and the knock-in efficiency was about 50%, which is shown in Table 2 below.

sgRNA / Cas9 mRNA / hLF vector
(ng / mu l) Number of injected embryos Number of blastocysts (%) Number of blastocysts expressing GFP (%) PCT analysis (%) Number of positive embryos (%) 100/100/25 111 18 14 3 2 100/100/25 30 5 5 5 2 total 141 23 (16.3) 19 (82.6) 8 4 (50)

In conclusion, knock-in vectors targeting sobeta-casein were microinjected into bovine precursor nucleus embryos with the CRISPR / Cas9 gene to allow the recombination of homologous genes in embryos to replace conventional somatic cell nucleus replacement As a result, a high implantation rate can be expected when transplanted into surrogate mothers, and it is possible to produce therapeutic proteins more efficiently due to the production of transgenic plants.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Knock in vector for expressing lactoferrin and knock in method          using <130> PD16-5360 <160> 16 <170> Kopatentin 2.0 <210> 1 <211> 1064 <212> DNA <213> Bos taurus <400> 1 gcggccgctg tcaagagatg ttgatggcaa gaacattttt ttttcaagaa cttataaaaa 60 tgcaacaaaa caaaccattt aatacatttt ggtcaaaaat agtatgtatt ttattttatg 120 ctacaaggag aagtagtcta aagtgaggac tgggcaagag aatctgacac cctggtaaat 180 caccgagaga taagtacaca gttctctgta gagaaaataa gcatagtgta tgatctctaa 240 aattatgtgg gacaaagggg agataacatt aggcatgtgg ggatgaagac tgagtacaga 300 agaaacaatc tagtcagtcc aagaaaacat gtggatcaat ggaacaaata gaagaaatgc 360 taaaatgaaa cagaagtctt actggaaata aaagatatga ggaagacaaa cattcatgaa 420 aatcacttag tttagtagag aaaagataaa aataaagtat taccttcttc ttcatataca 480 ttgtttgatc agatgcccct caataaaact gagtctccaa cagaactgaa actttaatat 540 tttgttcact gctctaatcc cagaatctaa gacatatctg gcaataaaaa ttaataaata 600 aatattttta ataagtaaat caatcactta atttttctgt aagtatctgt aacttctctt 660 ctgtctttcc aaaaaacact cataagtact gtgaataaga tgaaaagagt gaaataagat 720 ataggctgtt agctgaaaac atctggatag ctggcagtga aacattaact tgaaatgtaa 780 gattaatgag taatagtaaa ttttaacctt ggccgtatga taaaatgtct attaatattt 840 ttctaaaata cagggctttt tgtttttgcc atgaggtttg caggatcttg gttccctgat 900 gagggatcaa acctgggctc ccctggaagc acggagtctt agatatttgt attatacact 960 atctttggtt tcttttaaag ggaagtaatt ctacttaaat aagaaaatag attgacaagt 1020 aatacactat ttcctcatct tcccattccc aggaattgag agcc 1064 <210> 2 <211> 2089 <212> DNA <213> Bos taurus <400> 2 aagcttattg tggaaagcct ttcaagcagt gaggtaagat agtgttcatt cagaggcaat 60 ttcccaaatt tagagcaata aaatgctgta ttatcttttt gtgttacatt aatggcaacc 120 cactccagta ttcttgcctg gaaaatccca tagaggagga gcctggtagg ctgcagtcca 180 cggggtcgct aagagtcgga caggactgag cgacttccct ttcacttttc actttcatgc 240 cttggagaag gaaatggcaa cccactccag ttttcttgcc gggagaatcc cagggacggg 300 ggagcctggt gggctgccgt ctatggggtc gcacagagtt ggacacgact gaagcgactt 360 agcagtagca gcagcaggac agttaaggtt tctctaatag ctcagttggt aaagaatctg 420 gctgcagtgc aggagaccct ggttcgattc ctcaagatct gcaggagaag ggataggcta 480 cccattccag tgttctttaa gccaatgtgg ctatgtactg acgggtaact attgtcaatt 540 tccactctat atatttaaag gaataaatgt gtagaaggtt taatattcta gtaatttcta 600 aatgggtttg ttatttgaaa ttgtgtcatt gtgccctgct ttttttcctt aatgaactgt 660 acagtcctct tttctgtctt gaactttcta tgttaacctc cttccatgct ttggcattta 720 ttgagcactt tctgtttcag actttgacta ggaactgcag tacaaactag aaagagggat 780 gccctttgta aagtgtgagc agacatgcaa atggacatat tttattatta tacaagcaat 840 ccagtacaca agaggcagtg agaatgagtg tagtcctaaa tctgcctggt ggaatgaggt 900 agataataac cctatgccac tctttctggc tctgtcatca gctgttggtt aaatagtgca 960 tcaatatact ttgtctcttc acaaaggtca aaagatgctg ctgctgctgc taagtccctt 1020 cagtcatgtc tgactctgtg cgacctcata gatggcagcc tgccaggctc ccccatccct 1080 gggattctcc agacaagaat actggagtgg gttgccattt cctattccaa tgcataaaag 1140 tgaaaagtga aagtgaagtc gctcagtcgt gtccgactcc tagtgacccc gtggactgca 1200 gcctaccagg ctcctccatc catgggattt tccaggcaag agtactggag tgggttgcca 1260 ttgccatctc caaagatcct tataggaggg tatgtatttc ttataattca ttagaagcct 1320 aaacataacc agggaactaa gaatgattaa caagttcatg cgtggttatt attatatatt 1380 ttcaatgact attattcttt tagaaccaga tgaaaatatt agagatcatt tgttgtccta 1440 aggagagaac aggatgattg agagacatgt atgcatgcaa agttgcttca gccctttcca 1500 actctgtatg accctatgga ctgtaacctg ccaggttcct ctgtctatgg gattctccag 1560 gcaagaatac aggagtgggt tgtcatctcc tccagggcct aggaatcgac ctgcatctct 1620 tacgtctcct gcattggcag gcaggttctt taccactagc accacctggg aagcccgatt 1680 agtatctgtt aaatgcctct ttgagtacta tgctctctaa tcctcttttt cttgattgca 1740 tcatctttct ttttatacaa cagccttatt cagaagagtg gaacataaac tttcagccat 1800 aaaataatga tattatcaaa tgagctgtcc atattaatct attaaatttc ttcattttct 1860 gatttatgtt gacaaataag aatttttttt aaagctagac ctgattttat ttttattttt 1920 ccaaaggaat ctattacacg catcaataag gtaaaaccct catatttaaa tgtacatttt 1980 tttaaatttc atgtttgatt tttataaaca gcatttcttt atgtattttt tttttaacca 2040 gaaaattgag aagtttcaga gtgaggaaca gcagcaaaca gaggtcgac 2089 <210> 3 <211> 1973 <212> DNA <213> homo sapiens <400> 3 atgaaacttg tcttcctcgt cctgctgttc ctcggggccc tcggactgtg tctggctggc 60 cgtaggagaa ggagtgttca gtggtgcacc gtatcccaac ccgaggccac aaaatgcttc 120 caatggcaaa ggaatatgag aagagtgcgt ggccctcctg tcagctgcat aaagagagac 180 tcccccatcc agtgtatcca ggccattgcg gaaaacaggg ccgatgctgt gacccttgat 240 ggtggtttca tatacgaggc aggcctggcc ccctacaaac tgcgacctgt agcggcggaa 300 gtctacggga ccgaaagaca gccacgaact cactattatg ccgtggctgt ggtgaagaag 360 ggcggcagct ttcagctgaa cgaactgcaa ggtctgaagt cctgccacac aggccttcgc 420 aggaccgctg gatggaatgt gcctataggg acacttcgtc cattcttgaa ttggacgggt 480 ccacctgagc ccattgaggc agctgtggcc aggttcttct cagccagctg tgttcccggt 540 gcagataaag gacagttccc caacctgtgt cgcctgtgtg cggggacagg ggaaaacaaa 600 tgtgccttct cctcccagga accgtacttc agctactctg gtgccttcaa gtgtctgaga 660 gacggggctg gagacgtggc ttttatcaga gagagcacag tgtttgagga cctgtcagac 720 gaggctgaaa gggacgagta tgagttactc tgcccagaca acactcggaa gccagtggac 780 aagttcaaag actgccatct ggcccgggtc ccttctcatg ccgttgtggc acgaagtgtg 840 aatggcaagg aggatgccat ctggaatctt ctccgccagg cacaggaaaa gtttggaaag 900 gacaagtcac cgaaattcca gctctttggc tcccctagtg ggcagaaaga tctgctgttc 960 aaggactctg ccattgggtt ttcgagggtg cccccgagga tagattctgg gctgtacctt 1020 ggctccggct acttcactgc catccagaac ttgaggaaaa gtgaggagga agtggctgcc 1080 gt; tggagtggct tgagcgaagg cagcgtgacc tgctcctcgg cctccaccac agaggactgc 1200 atcgccctgg tgctgaaagg agaagctgat gccatgagtt tggatggagg atatgtgtac 1260 actgcaggca aatgtggttt ggtgcctgtc ctggcagaga actacaaatc ccaacaaagc 1320 agtgaccctg atcctaactg tgtggataga cctgtggaag gatatcttgc tgtggcggtg 1380 gttaggagat cagacactag ccttacctgg aactctgtga aaggcaagaa gtcctgccac 1440 accgccgtgg acaggactgc aggctggaat atccccatgg gcctgctctt caaccagacg 1500 ggctcctgca aatttgatga atatttcagt caaagctgtg cccctgggtc tgacccgaga 1560 tctaatctct gtgctctgtg tattggcgac gagcagggtg agaataagtg cgtgcccaac 1620 agcaatgaga gatactacgg ctacactggg gctttccggt gcctggctga gaatgctgga 1680 gacgttgcat ttgtgaaaga tgtcactgtc ttgcagaaca ctgatggaaa taacaatgag 1740 gcatgggcta aggatttgaa gctggcagac tttgcgctgc tgtgcctcga tggcaaacgg 1800 aagcctgtga ctgaggctag aagctgccat cttgccatgg ccccgaatca tgccgtggtg 1860 tctcggatgg ataaggtgga acgcctgaaa caggtgctgc tccaccaaca ggctaaattt 1920 gggagaaatg gatctgactg cccggacaag ttttgcttat tccagtctga aac 1973 <210> 4 <211> 239 <212> DNA <213> Artificial Sequence <220> <223> BGH polyA <400> 4 ggtcccgac tgtgccttct agttgccagc catctgttgt ttgcccctcc cccgtgcctt 60 ccttgaccct ggaaggtgcc actcccactg tcctttccta ataaaatgag gaaattgcat 120 cgcattgtct gagtaggtgt cattctattc tggggggtgg ggtggggcag gacagcaagg 180 gggaggattg ggaagacaat agcaggcatg ctggggatgc ggtgggctct atggaattc 239 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> LF 5 arm NotI S (RGEN) <400> 5 gcgcggccgc tgtcaagaga tgttgatggc 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> LF 3 arm XbaI AS (RGEN) <400> 6 gctctagatt cggttttact tcctgaggaa 30 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> bBC-E3 3 arm S Hind3 <400> 7 gcaagcttat tgtggaaagc ctttcaagc 29 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> bBC-E6 SalI AS2 <400> 8 gcgtcgacct ctgtttgctg ctgttcctca c 31 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CRISPR / Cas9 sense primer <400> 9 gctgtgtcta ttcaacacag gatgatactc 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> CRISPR / Cas9 anti-sense primer <400> 10 aacactatct tacctcactg cttgaaaggc 30 <210> 11 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> M13_R_RG1_hLF 5 Sc S5 <400> 11 ggaaacagct atgaccatgg tagtttgcaa atctgggatt gaagatgtg 49 <210> 12 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> M13_F_hLF Sc AS4 <400> 12 ggttttccca gtcacgaccc cgaggaacag caggacgagg aagacaag 48 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> M13-F <400> 13 ggttttcccc gtcacgac 18 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> M13-R <400> 14 ggaaacagct atgaccatg 19 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sgRNA target sequence <400> 15 ctggaagaac tcaatgtacc tgg 23 <210> 16 <211> 1578 <212> DNA <213> Artificial Sequence <220> <223> CMV-EGFP-polyA <400> 16 gaattctagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga 60 gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg 120 cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg 180 acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca 240 tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc 300 ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc 360 tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc 420 acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa 480 tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag 540 gcgtgtacgg tgggaggtct atataagcag agctggttta gtgaaccgtc agatccgcta 600 gcgctaccgg actcagatcc atcgccacca tggtgagcaa gggcgaggag ctgttcaccg 660 gggtggtgcc catcctggtc gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt 720 ccggcgaggg cgagggcgat gccacctacg gcaagctgac cctgaagttc atctgcacca 780 ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt 840 gcttcagccg ctaccccgac cacatgaagc agcacgactt cttcaagtcc gccatgcccg 900 aaggctacgt ccaggagcgc accatcttct tcaaggacga cggcaactac aagacccgcg 960 ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat cgagctgaag ggcatcgact 1020 tcaaggagga cggcaacatc ctggggcaca agctggagta caactacaac agccacaacg 1080 tctatatcat ggccgacaag cagaagaacg gcatcaaggt gaacttcaag atccgccaca 1140 acatcgagga cggcagcgtg cagctcgccg accactacca gcagaacacc cccatcggcg 1200 acggccccgt gctgctgccc gacaaccact acctgagcac ccagtccgcc ctgagcaaag 1260 accccaacga gaagcgcgat cacatggtcc tgctggagtt cgtgaccgcc gccgggatca 1320 ctctcggcat ggacgagctg tgggcgactg tgccttctag ttgccagcca tctgttgttt 1380 gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 1440 aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg 1500 tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg 1560 tgggctctat ggaagctt 1578

Claims (12)

A 5'-arm comprising a promoter of a sub-beta-casein genomic DNA comprising a nucleic acid sequence as set forth in SEQ ID NO: 1, a 5 'end fragment comprising a portion of exon 2; A gene encoding a therapeutic protein; And a 3'-arm, comprising a nucleic acid sequence as set forth in SEQ ID NO: 2 and comprising exon 4, 5 and 6 of the sub-beta-casein genomic DNA, and a CRISPR / A microinjection step of microinjecting Cas9 artificial enzyme into mammalian embryos;
Culturing the microinjected embryo to a blastocyst;
An amplification step of amplifying the DNA of the blastocyst embryo by PCR; And
Determining the presence or absence of the amplified PCR product and confirming that the vector is inserted into the site of the sub-beta-casein genomic DNA. The method according to claim 1,
Wherein the therapeutic protein is human lactoferrin. 3. The method of claim 2,
Wherein the gene encoding human lactoferrin is a polynucleotide consisting of a nucleic acid sequence represented by SEQ ID NO: 3. 3. The method of claim 2,
Wherein the polyA signal is additionally attached to the 3 ' end of the gene encoding the human lactoferrin. 3. The method of claim 2,
Wherein a reporter gene for confirming the expression of the fusion fluorescent protein is additionally connected to the 3 'end of the gene encoding the human lactoferrin. 6. The method of claim 5,
The fluorescent protein may be selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP) Which is a cyan fluorescent protein (CFP), a blue fluorescent protein (BFP), or a far-red fluorescent protein. The method according to claim 1,
Knock-in method comprising a negative selectable marker. 8. The method of claim 7,
Wherein the negative selection marker is a diphtheria toxin (DT-A) gene. delete The method according to claim 1,
Wherein the CRISPR / Cas9 artificial enzyme targets the nucleic acid sequence as set forth in SEQ ID NO: 15. A transformant for the mass production of therapeutic proteins, which is transformed into a host cell by the knock-in method according to any one of claims 1 to 8 and 10. A method for producing a therapeutic protein, comprising introducing into a mammalian embryo a mammal other than a human by a knock-in method according to any one of claims 1 to 8 and expressing a therapeutic protein .

Images