KR101068479B1 - alpha 1,3-galactosyltransferase gene targeting vector and uses thereof - Google Patents

alpha 1,3-galactosyltransferase gene targeting vector and uses thereof Download PDF

Info

Publication number
KR101068479B1
KR101068479B1 KR1020080074825A KR20080074825A KR101068479B1 KR 101068479 B1 KR101068479 B1 KR 101068479B1 KR 1020080074825 A KR1020080074825 A KR 1020080074825A KR 20080074825 A KR20080074825 A KR 20080074825A KR 101068479 B1 KR101068479 B1 KR 101068479B1
Authority
KR
South Korea
Prior art keywords
alpha
vector
gene
galactosyltransferase
region
Prior art date
Application number
KR1020080074825A
Other languages
Korean (ko)
Other versions
KR20100013227A (en
Inventor
이경광
강만종
이정웅
장미라
김혜민
이상미
김진회
성환후
심호섭
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020080074825A priority Critical patent/KR101068479B1/en
Publication of KR20100013227A publication Critical patent/KR20100013227A/en
Application granted granted Critical
Publication of KR101068479B1 publication Critical patent/KR101068479B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276—Knockout animals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/02—Animal zootechnically ameliorated
    • A01K2267/025—Animal producing cells or organs for transplantation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal

Abstract

본 발명은 상동 재조합 방법으로 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자를 제거할 수 있는 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터에 관한 것으로, 구체적으로는 (1)핵 국재화 신호(nuclear localization signal, NLS) 영역; (2) 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 4 내지 6 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 인트론 8 일부 및 엑손 9의 일부를 포함하는 제1영역; (3)양성 선별마커 영역; (4)돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 0.5 내지 2 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 9의 일부를 포함하는 제2영역; 및 (5)음성 선별마커 영역을 가지며, 상기 (1) 내지 (5)영역들이 5'말단에서부터 순서대로 구성되는 것을 특징으로 하는 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터, 상기 벡터가 도입된 세포 및 상기 벡터에 의해 넉 아웃된 형질전환 동물, 및 이의 제조방법에 관한 것이다.The present invention relates to an alpha 1,3-galactosyltransferase gene targeting vector capable of removing porcine alpha 1,3-galactosyltransferase gene by homologous recombination, and specifically (1) Localization signal (NLS) regions; (2) part of the intron 8 and exon of the swine alpha 1,3-galactosyltransferase gene as a 4-6 kb long nucleic acid sequence homologous to the swine alpha 1,3-galactosyltransferase nucleic acid sequence A first region comprising a portion of nine; (3) positive selectable marker regions; (4) a portion of exon 9 of the pig alpha 1,3-galactosyltransferase gene as a nucleic acid sequence 0.5 to 2 kb long that is homologous to the pig alpha 1,3-galactosyltransferase nucleic acid sequence A second region comprising; And (5) a negative selection marker region, wherein the (1) to (5) regions are configured in order from the 5 ′ end, and the alpha 1,3-galactosyltransferase gene targeting vector, wherein the vector And transgenic animals knocked out by the vector, and a method for producing the same.

알파 1,3-갈락토실트랜스퍼라아제, 상동 재조합, 유전자 타겟팅 벡터 Alpha 1,3-galactosyltransferase, homologous recombination, gene targeting vector

Description

알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터 및 그의 용도 {alpha 1,3-galactosyltransferase gene targeting vector and uses thereof}Alpha 1,3-galactosyltransferase gene targeting vector and uses approximately}

본 발명은 상동 재조합 방법으로 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자를 제거할 수 있는 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터에 관한 것으로, 구체적으로는 핵 국재화 시그널을 포함하여 타겟팅 효율이 증대된 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터, 상기 벡터가 도입된 세포 및 상기 벡터에 의해 넉 아웃된 형질전환 동물, 및 이의 제조방법에 관한 것이다.The present invention relates to an alpha 1,3-galactosyltransferase gene targeting vector capable of removing porcine alpha 1,3-galactosyltransferase gene by homologous recombination, and specifically, a nuclear localization signal. The present invention relates to an alpha 1,3-galactosyltransferase gene targeting vector having an increased targeting efficiency, a cell into which the vector is introduced, and a transgenic animal knocked out by the vector, and a method of preparing the same.

동물 유전학의 꾸준한 진보는 특정 유전자를 제거 또는 삽입함으로써 각 유전자의 역할 규명과 함께 상업적으로 유용한 형질전환 동물 생산을 가능케 하였다. 형질전환된 동물 제조를 위한 방법으로는 미세주입법(microinjection) 또는 바이러스 감염법(viral transfection) 등을 이용한 무작위적인 유전자 조작법과 배아줄기세포(embrynic stem cells) 또는 체세포(somatic cells)를 이용하여 특정 유전자를 타겟팅 시킬 수 있는 유전자 적중법이 있다. Steady progress in animal genetics Removal or insertion of specific genes enabled the identification of each gene's role and enabled the production of commercially useful transgenic animals. Methods for preparing transformed animals include random gene manipulation using microinjection or viral transfection and specific genes using embryonic stem cells or somatic cells. There is a gene targeting method that can target.

미세주입법은 외래 DNA를 수정란의 전핵에 삽입하는 고전적인 방법으로 형질전환 동물을 생산하기 위해 널리 이용되어 왔다(Harbers et al., Nature., 293(5833); 540-2, 1981: Hammer et al., Nature., 315(6021);680-683, 1985; van Berkel et al., Nat Biotechnol., 20(5);484-487, 2002; Damak et al., Biotechnology(NY), 14(2);185-186, 1996). 그러나 미세주입법으로 외래 DNA가 삽입된 수정란 유래의 형질전환된 산자의 생산 비율은 2 내지 3 % 로 효율이 매우 낮으며(Clark et al., Transgenic Res., 9;263-275, 2000), 외래 유전자의 삽입 위치 및 특정 내부 유전자의 제거가 불가능하다. Microinjection has been widely used to produce transgenic animals by the classical method of inserting foreign DNA into the pronucleus of fertilized eggs (Harbers et al., Nature., 293 (5833); 540-2, 1981: Hammer et al. , Nature., 315 (6021); 680-683, 1985; van Berkel et al., Nat Biotechnol., 20 (5); 484-487, 2002; Damak et al., Biotechnology (NY), 14 (2 ; 185-186, 1996). However, the rate of production of transformed eggs derived from fertilized eggs with foreign DNA inserted by microinjection was very low (Clark et al., Transgenic Res., 9; 263-275, 2000). The insertion position of the gene and removal of certain internal genes are impossible.

바이러스감염법 또한 동물의 유전자 조작을 위해 널리 사용된다(Soriano et al., Genes Dev., 1(4);366-375, 1987; Hirata et al., Cloning Stem Cells., 6(1);31-36, 2004). 바이러스 감염법은 삽입하고자 하는 유전자가 바이러스 벡터를 통하여 동물의 유전자로 도입되므로 미세주입법보다 좀더 효율적이나, 여전히 특정 위치로의 외래 유전자 삽입 및 특정 내부 유전자의 제거가 불가능하다. 또한, 삽입 하고자 하는 유전자의 최대 사이즈는 7 kb로 제한되며, 바이러스에 의해 발현되는 단백질이 문제된다(Wei et al., Annu Rev Pharmacol Toxicol., 37;119-141, 1997; Yanez et al., Gene Ther., 5(2);149-159, 1998). Viral infections are also widely used for genetic manipulation of animals (Soriano et al., Genes Dev., 1 (4); 366-375, 1987; Hirata et al., Cloning Stem Cells., 6 (1); 31 -36, 2004). Viral infection is more efficient than microinjection because the gene to be inserted is introduced into the animal's gene through the viral vector, but it is still impossible to insert foreign genes into specific positions and to remove specific internal genes. In addition, the maximum size of the gene to be inserted is limited to 7 kb, the protein expressed by the virus is a problem (Wei et al., Annu Rev Pharmacol Toxicol., 37; 119-141, 1997; Yanez et al., Gene Ther., 5 (2); 149-159, 1998).

위에서 언급한 문제점들 극복하기 위해서, 특정 유전자를 제거 또는 삽입할 수 있는 유전자 타겟팅 기술이 이용될 수 있다. 유전자 타겟팅 기술은 마우스 배아 줄기세포를 이용한 유전자 기능 연구에서 처음으로 사용되었다. 상동 재조합을 이용하여 특정 유전자가 타겟팅된 마우스 배아 줄기세포를 배반포 단계에 있는 배아 에 삽입함으로써 결국 특정 유전자가 조작된 산자 생산이 가능하게 된다. 이러한 마우스 배아줄기세포에 유전자 타겟팅법을 이용하면서, 많은 수의 특정 유전자 타겟팅된 마우스가 생산되었다(Brandon et al., Curr Biol., 5(6);625-634, 1995; Capecchi et al., Science, 244(4910);1288-1292, 1989; Thompson et al., Cell, 56(2);313-321, 1989; Hamanaka et al., Hum Mol Genet., 9(3);353-361, 2000; Thomas et al, Cell, 51(3);503-512, 1987; te Riele et al., Proc Natl Acad Sci USA, 89(11);5182-5132, 1992; Mansour et al., Nature, 336(6197), 348-352, 1988; Luo et al., Oncogene, 20(3);320-328, 2001). 유전자 타겟팅법이 가축에 적용될 때, 대량의 치료 단백질을 생산하는 동물생체 반응기(animal bioreactor) 또는 이종간 장기이식에 사용될 수 있는 질병 모델 동물 생산이 가능하며, 이는 산업적으로 큰 경제적인 이익을 가져올 것이다. To overcome the problems mentioned above, gene targeting techniques can be used that can remove or insert a particular gene. Gene targeting techniques were used for the first time in the study of gene function using mouse embryonic stem cells. By using homologous recombination, mouse embryonic stem cells targeted to specific genes are inserted into embryos in the blastocyst stage. Using gene targeting to such mouse embryonic stem cells, a large number of specific gene targeted mice have been produced (Brandon et al., Curr Biol., 5 (6); 625-634, 1995; Capecchi et al., Science, 244 (4910); 1288-1292, 1989; Thompson et al., Cell, 56 (2); 313-321, 1989; Hamanaka et al., Hum Mol Genet., 9 (3); 353-361, 2000; Thomas et al, Cell, 51 (3); 503-512, 1987; te Riele et al., Proc Natl Acad Sci USA, 89 (11); 5182-5132, 1992; Mansour et al., Nature, 336 (6197), 348-352, 1988; Luo et al., Oncogene, 20 (3); 320-328, 2001). When genetic targeting is applied to livestock, it is possible to produce animal bioreactors that produce large quantities of therapeutic proteins or disease model animals that can be used for cross-transplantation, which will bring significant economic benefits.

유전자 타겟팅된 동물을 생산하기 위해서, 배아줄기세포의 사용이 필수적인 요소로 여겨져 왔다. 그러나 돼지와 소를 포함한 가축에서 배아줄기세포와 유사한 세포주들이 보고되었음에도 불구하고, 현재까지 가축에서 배아 줄기 세포의 사용은 제한된다(Doetschman et al., Dev Biol., 127(1);224-227, 1988; Stice et al., Biol Reprod., 54(1);100-110, 1996; Sukoyan et al., Mol Reprod Dev., 36(2);148-158, 1993; Iannaccone et al., Dev Biol., 163(1);288-292, 1994; Pain et al., Development, 122(8);2339-2348, 1996; Thomson et al., Proc Natl Acad Sci USA., 92(17)7844-7848, 1995; Wheeler et al., Reprod Fertil Dev., 6(5);563-568, 1994). 대신에, 핵 공여 세포로서 일반 체세포가 유전자 타겟팅에 사용될 수 있다는 가능성이 제시되면서, 형질전환된 복제 가축 생산이 가능하게 되었다(Brophy et al., Nat Biotechnol., 21(2);157-162, 2003; Cibelli et al., Science, 280(5367);1256-1258, 1998; Campbell et al., Nature, 380(6569);64-66, 1996; Akira Onishi et al., Science, 289;1188-1190, 2000 Denning et al., Cloning stem cells, 3(4);221-231, 2001 McCreath et al., Nature, 405(6790);1066-1069, 2000). In order to produce genetically targeted animals, the use of embryonic stem cells has been considered an essential factor. However, although embryonic stem cell-like cell lines have been reported in livestock, including pigs and cattle, the use of embryonic stem cells in livestock is currently limited (Doetschman et al., Dev Biol., 127 (1); 224-227). , 1988; Stice et al., Biol Reprod., 54 (1); 100-110, 1996; Sukoyan et al., Mol Reprod Dev., 36 (2); 148-158, 1993; Iannaccone et al., Dev Biol., 163 (1); 288-292, 1994; Pain et al., Development, 122 (8); 2339-2348, 1996; Thomson et al., Proc Natl Acad Sci USA., 92 (17) 7844- 7848, 1995; Wheeler et al., Reprod Fertil Dev., 6 (5); 563-568, 1994). Instead, it has been suggested that normal somatic cells can be used for gene targeting as nuclear donor cells, enabling the production of transformed cloned livestock (Brophy et al., Nat Biotechnol., 21 (2); 157-162, 2003; Cibelli et al., Science, 280 (5367); 1256-1258, 1998; Campbell et al., Nature, 380 (6569); 64-66, 1996; Akira Onishi et al., Science, 289; 1188- 1190, 2000 Denning et al., Cloning stem cells, 3 (4); 221-231, 2001 McCreath et al., Nature, 405 (6790); 1066-1069, 2000).

또한, 유전자의 넉 아웃(knock-out)은 유전자 타겟팅 기술의 하나로서 생쥐에서 처음 위치 특이적으로 특정 유전자에 변이를 도입할 수 있는 기술로 보고되었다(Thomas, K.R. and Capecchi, M.R. Cell, 51, 3, 503-512(1987)). 이러한 기술은 다양한 유전자 변이 생쥐의 생산(Fujino, T 등, Proc Natl Acad Sci U S A. 100, 1, 229-234(2003))에 이용되고 있으며 이러한 기술은 가축의 양(McCreath, K.J. 등, Nature, 405, 1066-1067(2000))에서도 적용되고 있다. In addition, knock-out of genes has been reported as a technique for introducing mutations into specific genes in mouse-specific locations as one of gene targeting techniques (Thomas, KR and Capecchi, MR Cell, 51, 3, 503-512 (1987). This technique has been used in the production of a variety of genetically modified mice (Fujino, T et al., Proc Natl Acad Sci US A. 100, 1, 229-234 (2003)), and these techniques are used for livestock sheep (McCreath, KJ et al. 405, 1066-1067 (2000).

한편, 알파 1,3-갈락토실트랜스퍼라아제 유전자는 이종간 이식시 급속한 면역거부반응을 일으키는 원인 유전자로서, 이 유전자가 제거될 경우 생체거부반응이 제거된 이종간 장기 이식용 질환모델동물 개발이 가능하다. 2002년 영국의 PPL사로부터 세계 최초로 알파 1,3-갈락토실트랜스퍼라아제 유전자가 이형접합적으로(heterozygous) 제거된 체세포 복제 돼지가 생산되었다(Yifan Dai et al., Nat Biotechnology, 20;251-255, 2002). 2003년에 동 회사에서 알파 1,3-갈락토실트랜 스퍼라아제 유전자가 동형접합적으로(homozygous) 제거된 체세포 복제에 성공함으로써 현 장기부족현상을 해결해줄 수 있는 장기 이식용 질환모델동물 생산을 위한 획기적인 진보를 가져왔다(Carol J. Phelps, Science, 299;411-414, 2003). 이후, 좀 더 효율적으로 알파 1,3-갈락토실트랜스퍼라아제 유전자를 제거할 수 있는 프로모터-트랩(promoter trap)의 원리를 이용한 타겟팅법 등이 소개되었다(Sharon Harrison et al., Cloning and stem cells, 6(4);327-331, 2004). 2005년 알파 1,3-갈락토실트랜스퍼라아제가 제거된 복제 돼지 유래의 장기는 원숭이로 이식되었으며, 그 결과 급성 면역 거부반응 없이 이식 후 2-6 개월까지 생존이 지연됨을 보고하였다(Kenji Kuwaki et al., Nature medicine, 11(1);29-31, 2005). Meanwhile, alpha 1,3-galactosyltransferase gene is a gene that causes a rapid immune rejection reaction between xenotransplantation. If this gene is removed, it is possible to develop a disease model animal for xenotransplantation which has been rejected. Do. In 2002, UK-based PPL produced the world's first somatic cloned pig that had been heterozygous for its removal of the alpha 1,3-galactosyltransferase gene (Yifan Dai et al., Nat Biotechnology, 20; 251). -255, 2002). In 2003, the company succeeded in replicating somatic cells in which the alpha 1,3-galactosyltransferase gene was homozygous removed, producing a disease model animal for organ transplantation that can solve the current organ shortage. Has led to breakthroughs for the future (Carol J. Phelps, Science, 299; 411-414, 2003). Later, targeting methods using the promoter trap principle, which can more efficiently remove the alpha 1,3-galactosyltransferase gene, were introduced (Sharon Harrison et al., Cloning and stem). cells, 6 (4); 327-331, 2004). In 2005, cloned pig-derived organs from which alpha 1,3-galactosyltransferase was removed were transplanted into monkeys, resulting in delayed survival until 2-6 months after transplantation without acute immune rejection (Kenji Kuwaki). et al., Nature medicine, 11 (1); 29-31, 2005).

한편, 유전자 타겟팅은 상동유전자 재조합 현상을 이용하여 세포에 유전자 타겟팅 벡터를 도입하는 것으로 원하는 유전자 위치에 상동유전자 재조합이 일어난 세포를 선별할 수 있는 양성 선별마커와 상동유전자 재조합이 일어나지 않고 무작위적으로 벡터가 삽입된 세포를 선별하는 음성 선별마커를 사용하는 것이 일반적이다(Suzanne, L. 등, Nature, 336, 348-352(1988)). 이러한 양성 및 음성 선별마커를 이용한 방법은 주로 마우스 줄기세포를 이용하여 유전자 타겟팅 마우스 개발에 많이 이용되고 있으며 그 효율은 높은 것으로 알려져 있다(Templeton, N.S. 등, Gene Therapy, 4, 700-709(1997)). Gene targeting is to introduce a gene targeting vector into a cell using homologous recombination phenomena, a positive screening marker capable of selecting cells where homologous gene recombination has occurred at a desired gene position, and a homologous gene recombination without random homologous recombination. It is common to use negative screening markers to select cells into which cells have been inserted (Suzanne, L. et al., Nature, 336, 348-352 (1988)). The method using the positive and negative screening markers is mainly used for the development of gene targeting mice using mouse stem cells, and its efficiency is known to be high (Templeton, NS et al., Gene Therapy, 4, 700-709 (1997)). ).

그러나 가축인 양과 돼지에서의 유전자 타겟팅 효율은 유전자 종류와 동물 종에 따라 다양하게 보고되고 있다. 양의 α1(I) 프로콜라겐 유전자 위치를 넉 아 웃(knock-out)한 실험에서는 프로모터가 없는 neo 선별 마커를 이용하여 7.1-13.8%의 효율을 얻고 있으며 또한 똑같은 벡터에 양의 베타-락토글로불린 프로모터에 사람 α1-안티트립신을 발현시키기 위하여 neo 선별 마커 뒤에 삽입한 벡터에서는 67%의 유전자 타겟팅 효율을 나타내었다(McCreath, K.J. 등, Nature, 405, 1066-1069(2000)). 그러나 동일한 프로모터가 없는 neo 선별마커를 이용하여 알파 1,3-갈락토실트랜스퍼라아제 유전자와 프리온 단백질 유전자 위치를 양에서 유전자 타겟팅 하였을 경우 그 효율은 1.7%와 1%로 매우 낮았다(Denning, C. 등, Nature Biotechnology, 19, 559-562(2001)). However, gene targeting efficiencies in livestock sheep and pigs have been reported to vary according to gene type and animal species. In experiments knocking out positive α1 (I) procollagen gene positions, promoter-less neo selection markers yielded 7.1-13.8% efficiency and positive beta-lactoglobulin in the same vector. The vector inserted after the neo selection marker to express human α1-antitrypsin in the promoter showed a gene targeting efficiency of 67% (McCreath, KJ et al., Nature, 405, 1066-1069 (2000)). However, when the alpha 1,3-galactosyltransferase gene and the prion protein gene were genetically targeted using neo selection markers without the same promoter, the efficiency was very low (Denning, C). Et al., Nature Biotechnology, 19, 559-562 (2001).

그러나, 현재까지 돼지의 체세포에서 유전자 타겟팅 방법에 의하여 알파 1,3-갈락토실트랜스퍼라아제 유전자를 knock-out 시키는 효율은 5% 미만인 것으로 알려져 있다(Denning, C. and Priddle, H. Reproduction, 126, 1-11(2003)). 또한, 돼지에 있어서 양성 선별마커만을 이용하여 알파 1,3-갈락토실트랜스퍼라아제 유전자를 유전자 타겟팅한 경우에도 그 효율이 1.5 내지 5%인 것으로 보고되어 있다(Denning, C. and Priddle, H. Reproduction, 126, 1-11(2003)). However, to date, the efficiency of knocking out alpha 1,3-galactosyltransferase gene by gene targeting method in somatic cells of pigs is known to be less than 5% (Denning, C. and Priddle, H. Reproduction, 126, 1-11 (2003). In addition, the gene efficiency of alpha 1,3-galactosyltransferase gene using only a positive selection marker in pigs has been reported to be 1.5 to 5% (Denning, C. and Priddle, H). Reproduction, 126, 1-11 (2003).

이에, 본 발명자는 본 발명자는 핵 국재화 신호(nuclear localization signal, NLS), 양성 선별마커 및 음성 선별마커를 동시에 포함하는 유전자 타겟팅 벡터를 제조하였고, 이러한 벡터를 이용할 경우 알파 1,3-갈락토실트랜스퍼라아제 유전자의 타겟팅 효율을 현저하게 높일 수 있음을 발견하고 본 발명을 완성하였다.Accordingly, the inventors of the present invention have prepared a gene targeting vector including a nuclear localization signal (NLS), a positive selection marker, and a negative selection marker at the same time, and when using such a vector, alpha 1,3-galacto The present invention has been completed by discovering that the targeting efficiency of siltransferase gene can be significantly increased.

본 발명의 목적은 (1)핵 국재화 신호(nuclear localization signal, NLS) 영역; (2) 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 4 내지 6 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 인트론 8 일부 및 엑손 9의 일부를 포함하는 제1영역; (3)양성 선별마커 영역; (4)돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 0.5 내지 2 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 9의 일부를 포함하는 제2영역; 및 (5)음성 선별마커 영역을 가지며, 상기 (1) 내지 (5)영역들이 5'말단에서부터 순서대로 구성되는 것을 특징으로 하는 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터를 제공하는 것이다.It is an object of the present invention to provide a (1) nuclear localization signal (NLS) region; (2) part of the intron 8 and exon of the swine alpha 1,3-galactosyltransferase gene as a 4-6 kb long nucleic acid sequence homologous to the swine alpha 1,3-galactosyltransferase nucleic acid sequence A first region comprising a portion of nine; (3) positive selectable marker regions; (4) a portion of exon 9 of the pig alpha 1,3-galactosyltransferase gene as a nucleic acid sequence 0.5 to 2 kb long that is homologous to the pig alpha 1,3-galactosyltransferase nucleic acid sequence A second area comprising; And (5) having a negative selection marker region, wherein (1) to (5) regions are configured in sequence from the 5 ′ end to provide an alpha 1,3-galactosyltransferase gene targeting vector. will be.

본 발명의 또 다른 목적은 상기 벡터로 유전자 타겟팅된 세포를 제공하는 것이다.Still another object of the present invention is to provide a cell genetically targeted with the vector.

본 발명의 또 다른 목적은 상기 벡터가 도입되어 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 동물을 제공하는 것이다.Still another object of the present invention is to provide a transgenic animal in which the vector is introduced and knocked out of the alpha 1,3-galactosyltransferase gene.

본 발명의 또 다른 목적은 상기 벡터를 이용하여 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 제조하는 방법을 제공하는 것이다.Still another object of the present invention is to provide a method for producing somatic cells of pigs targeted to alpha 1,3-galactosyltransferase gene using the vector.

본 발명의 또 다른 목적은 상기 벡터를 이용하여 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 돼지를 제조하는 방법을 제공하는 것이다.Another object of the present invention to provide a method for producing a transgenic pig knocked out alpha 1,3-galactosyltransferase gene using the vector.

하나의 양태로서, 본 발명은 (1)핵 국재화 신호(nuclear localization signal, NLS) 영역; (2) 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 4 내지 6 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 인트론 8 일부 및 엑손 9의 일부를 포함하는 제1영역; (3)양성 선별마커 영역; (4)돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 0.5 내지 2 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 9의 일부를 포함하는 제2영역; 및 (5)음성 선별마커 영역을 가지며, 상기 (1) 내지 (5)영역들이 5'말단에서부터 순서대로 구성되는 것을 특징으로 하는 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터에 관한 것이다.In one aspect, the present invention provides a kit comprising: (1) a nuclear localization signal (NLS) region; (2) part of the intron 8 and exon of the swine alpha 1,3-galactosyltransferase gene as a 4-6 kb long nucleic acid sequence homologous to the swine alpha 1,3-galactosyltransferase nucleic acid sequence A first region comprising a portion of nine; (3) positive selectable marker regions; (4) a portion of exon 9 of the pig alpha 1,3-galactosyltransferase gene as a nucleic acid sequence 0.5 to 2 kb long that is homologous to the pig alpha 1,3-galactosyltransferase nucleic acid sequence A second region comprising; And (5) a negative selection marker region, wherein the regions (1) to (5) are configured in order from the 5 ′ end. The present invention relates to an alpha 1,3-galactosyltransferase gene targeting vector. .

본 발명에서 용어, "유전자 타겟팅 벡터" (gene targeting vector)란 게놈의 특정 유전자 위치로 목적하는 유전자를 제거 또는 삽입할 수 있는 벡터를 말하며, 상동 재조합 (homologous recombination)이 일어나도록 타겟팅하고자 하는 특정 유전자에 상동 염기 서열을 포함한다. 본 발명의 유전자 타겟팅 벡터는 벡터를 구성하는 유전자가 상동 재조합에 의해 게놈상의 알파 1,3-갈락토실트랜스퍼라아제 유전자에 5'→3' 배열로 삽입되는 알파 1,3-갈락토실트랜스퍼라아제 타겟팅 벡터이며, 원형(circular) 또는 선형(linear) 형태일 수 있다.As used herein, the term "gene targeting vector" refers to a vector capable of removing or inserting a gene of interest into a specific gene position of a genome, and to target a gene such that homologous recombination occurs. Contains homologous base sequences. In the gene targeting vector of the present invention, an alpha 1,3-galactosyltransfer in which a gene constituting the vector is inserted in a 5 '→ 3' array into an alpha 1,3-galactosyltransferase gene on the genome by homologous recombination. Laase targeting vector, which may be circular or linear.

본 발명의 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터는 핵 국재화 신호(nuclear localization signal, NLS) 영역을 포함한다. The alpha 1,3-galactosyltransferase gene targeting vector of the present invention comprises a nuclear localization signal (NLS) region.

상기 핵 국재화 신호 영역은 벡터의 5' 말단 쪽에 포함됨을 특징으로 한다. 전사 인자의 핵 중으로의 유입은 다양한 외부 및 내부 자극뿐 아니라 발생 신호에 반응하여 일어나는 과정이다. 그러므로, 벡터 내에 삽입된 핵 국재화 신호는 벡터가 세포 내로 도입된 후, 본 발명의 벡터가 핵 내로 유입될 수 있도록 이동을 돕게 되는데, 이를 통해 핵 내에 존재하는 게놈 상의 알파 1,3-갈락토실트랜스퍼라아제 유전자에 대한 타겟팅 효율을 높일 수 있다. 또한, 유전자 타겟팅 벡터를 세포에 도입시켜 세포 내 유전자를 타겟팅 할 때, 핵으로의 유입 효율을 높이기 위해 직접적인 전기천공법을 이용하게 되는데, 본 발명의 벡터는 핵 국재화 신호 영역을 포함하고 있어 세포 내에서 핵으로의 수송이 용이하므로, 통상적인 세포의 형질전환법인 리포좀 방법으로도 효율적으로 벡터를 도입시켜 유전자를 타겟팅시킬 수 있다. 특히, 본 발명자들은 핵 국재화 신호 영역이 벡터의 5' 말단에 포함되는 경우에, 핵 국재화 신호 영역을 포함하지 않거나 또는 3' 말단에 포함되는 경우보다 유전자 타겟팅 효율을 현저하게 높인다는 것을 입증하였다(도 5).The nuclear localization signal region is characterized by being included at the 5 'end of the vector. Influx of transcription factors into the nucleus is a process that occurs in response to a variety of external and internal stimuli as well as signals of occurrence. Therefore, the nuclear localization signal inserted into the vector assists the movement of the vector of the present invention into the nucleus after the vector has been introduced into the cell, thereby allowing alpha 1,3-galactos on the genome present in the nucleus. Targeting efficiency for the siltransferase gene can be improved. In addition, when a gene targeting vector is introduced into a cell to target an intracellular gene, direct electroporation is used to increase the efficiency of influx into the nucleus, and the vector of the present invention includes a nuclear localization signal region. Since it is easy to transport to the nucleus in the inside, the gene can be targeted by introducing the vector efficiently even in the liposome method, which is a transformation method of conventional cells. In particular, the inventors demonstrate that when the nuclear localization signal region is included at the 5 'end of the vector, the gene targeting efficiency is significantly higher than when the nuclear localization signal region is not included or at the 3' end. (FIG. 5).

본 발명의 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터는 알파 1,3-갈락토실트랜스퍼라아제 유전자의 핵산 서열에 상동인 서열을 가지는 제1영역과 제2영역을 포함한다. The alpha 1,3-galactosyltransferase gene targeting vector of the present invention includes a first region and a second region having a sequence homologous to the nucleic acid sequence of the alpha 1,3-galactosyltransferase gene.

본 발명의 "제1 영역"은 알파 1,3-갈락토실트랜스퍼라아제 유전자의 핵산 서열에 상동인 4 내지 6 kb 길이의 핵산 서열을 갖는 것을 특징으로 한다. 제1 영역의 길이는 유전자 타겟팅 효율을 결정하는 중요한 요소로, 바람직하게는 4.8 kb의 길이를 가진다. 또한, 제1 영역은 바람직하게 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 중 인트론 8의 일부 및 엑손 9의 일부를 포함한다. 여기서 일부란, 5' 말단 쪽 인트론 8의 제한효소 SmaI 인식부위부터 3' 말단 쪽 엑손 9의 제한효소 EcoRV 인식부위까지가 바람직하다."First region" of the present invention is characterized by having a nucleic acid sequence of 4 to 6 kb in length homologous to the nucleic acid sequence of the alpha 1,3-galactosyltransferase gene. The length of the first region is an important factor in determining gene targeting efficiency, and preferably has a length of 4.8 kb. In addition, the first region preferably comprises a portion of intron 8 and a portion of exon 9 in the porcine alpha 1,3-galactosyltransferase gene. Herein, a part of the restriction enzyme SmaI recognition site of the 5'-terminal intron 8 to the restriction enzyme EcoRV recognition site of the 3'-terminal exon 9 is preferable.

본 발명의 "제2 영역" 은 알파 1,3-갈락토실트랜스퍼라아제 유전자 핵산 서열에 상동인 0.5 내지 2kb 길이의 핵산 서열을 갖는 것을 특징으로 한다. 바람직하게는 1.9kb의 길이를 가진다. 이때, 제1 영역이 알파 1,3-갈락토실트랜스퍼라아제 유전자의 핵산 서열의 5'→3'배열에 있어 상부(upstream)에 해당하고 제2 영역이 하부(downstream)에 해당한다. 또한, 제2 영역은 바람직하게 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 중 엑손 9의 일부를 포함한다. 여기서 일부란, 엑손 9의 5'말단 쪽의 제한효소 EcoRV 인식부위부터 엑손 9의 3' 말단 쪽의 제한효소 PstI 까지가 바람직하다. 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자는 엑손 1 내지 엑손 9 및 인트론 일부가 알려져 있는데, 효소 활성의 대부분은 엑손 9 부위와 관련되어 있으므로, 이러한 부위가 타겟팅으로 제거되면 좀 더 효과적으로 효소 활성을 제거시킬 수 있을 것으로 기대된다.“Second region” of the invention is characterized by having a nucleic acid sequence of 0.5 to 2 kb in length that is homologous to the alpha 1,3-galactosyltransferase gene nucleic acid sequence. Preferably it has a length of 1.9kb. In this case, the first region corresponds to the upstream of the 5 ′ → 3 ′ sequence of the nucleic acid sequence of the alpha 1,3-galactosyltransferase gene, and the second region corresponds to the downstream. In addition, the second region preferably comprises a portion of exon 9 of the porcine alpha 1,3-galactosyltransferase gene. Herein, a part of the restriction enzyme EcoRV recognition region at the 5 'end of exon 9 to the restriction enzyme PstI at the 3' end of exon 9 is preferable. Porcine alpha 1,3-galactosyltransferase genes are known to have exon 1 to exon 9 and some introns, most of which are associated with exon 9 sites, so if these sites are removed by targeting, It is expected to be able to remove the activity.

본 발명에서 용어 "상동(homologous)"이란 제1 영역 또는 제2 영역과 이에 해당하는 알파 1,3-갈락토실트랜스퍼라아제 유전자의 핵산 서열과의 동일성 정도를 나타내는 것으로, 적어도 90% 이상 동일하고, 바람직하게는 95% 이상 동일하다. As used herein, the term “homologous” refers to a degree of identity between a first region or a second region and a corresponding nucleic acid sequence of an alpha 1,3-galactosyltransferase gene, which is at least 90% identical. Preferably, it is 95% or more the same.

또한, 상기 벡터로 타겟팅되는 알파 1,3-갈락토실트랜스퍼라아제 유전자는 특별히 한정되지 않으나, 바람직하게는 소, 양, 염소, 돼지, 말, 토끼, 개, 원숭이 등의 알파 1,3-갈락토실트랜스퍼라아제 유전자고, 보다 바람직하게는 미니어쳐 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자이다.In addition, the alpha 1,3-galactosyltransferase gene targeted by the vector is not particularly limited, but preferably alpha 1,3- such as cattle, sheep, goats, pigs, horses, rabbits, dogs, and monkeys. It is a galactosyltransferase gene, and more preferably the alpha 1,3-galactosyltransferase gene of a miniature pig.

또한, 본 발명의 벡터는 선별마커 영역을 포함하며, 바람직하게는 양성 선별마커 및 음성 선별마커를 동시에 포함한다. In addition, the vector of the present invention includes a selection marker region, and preferably includes a positive selection marker and a negative selection marker at the same time.

본 발명에서 용어 "선별마커(selection marker)"란 세포로 유전자 타겟팅 벡터로 형질전환된 세포를 선별하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있고, 양성 선별마커와 음성 선별마커가 있다. As used herein, the term "selection marker" is for selecting cells transformed with a gene targeting vector into cells, and selecting such drugs as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers that confer a possible phenotype can be used, with positive and negative screening markers.

본 발명에서 용어 "양성 선별마커"란 선택제 (selective agent)가 처리된 환경에서 선택 마커를 발현하는 세포만 생존하도록 하여 양성 선택을 가능하게 하는 마커로, 네오마이신 (Neomycin: Neo), 하이그로마이신 (hygromycin: Hyg), 히스티디놀 디하이드로게나제(histidinol dehydrogenase gene: hisD) 및 구아닌 포스포리보실트랜스퍼라제 (guanine phosphosribosyltransferase: Gpt) 등이 있으며, 바람직하게는 네오마이신 마커이지만, 이들로 제한되지 않는다.In the present invention, the term "positive selection marker" refers to a marker that allows only positive cells to express selection markers in an environment in which a selective agent is treated to enable positive selection. Neomycin (Neomycin: Neo), hygromycin (hygromycin: Hyg), histidinol dehydrogenase gene (hiD), and guanine phosphosribosyltransferase (Gpt), and are preferably neomycin markers, but are not limited to these. .

본 발명의 양성 선별마커는 제1영역과 제2영역 사이에 위치하는 것이 바람직하며, 제1영역의 3' 말단에 연결되고, 제2영역 상부(5') 쪽에 위치할 수 있다. 이러한 위치에 삽입됨으로써, 본 발명의 벡터가 세포 내로 타겟팅되어 상동재조합을 일으켜, 숙주 세포 게놈 상의 타겟 유전자와 재조합되었을 때, 게놈 내로의 삽입이 용이해지며, 이들의 발현을 통해 유전자 타겟팅 여부의 식별이 가능해지게 된다. The positive selection marker of the present invention is preferably located between the first region and the second region, and is connected to the 3 'end of the first region, and may be positioned toward the upper portion 5' of the second region. By inserting at such a position, when the vector of the present invention is targeted into a cell to homologous recombination, and when recombined with a target gene on the host cell genome, insertion into the genome is facilitated, and their expression identifies gene targeting. This becomes possible.

또한, 본 발명에서 용어 "음성 선별마커"란 무작위적 삽입 (random insertion)이 일어난 세포를 선별하여 제거하는 네가티브 선택을 가능하게 하는 마커로, 헤르페스 심플렉스 바이러스-싸이미딘 키나제 (Herpes simplex virus-thymidine kinase: HSV-tk), 하이포잔틴 포스포리보실 트랜스퍼라아제 (hypoxanthine phosphoribosyl transferase: Hprt), 싸이토신 디아미네즈 (cytosine deaminase), 디프테리아 톡신 (Diphtheria toxin) 등이 있으며, 바람직하게는 디프테리아 톡신(DT-A)이지만, 이로 제한되는 것은 아니다. 디프테리아 톡신 마커는 싸이미틴 키나제에 비해 몇 가지 장점을 가진다. 먼저, 싸이미틴 키나제는 gancyclovir (GANC) 처리를 요구하는 반면, 디프테리아 톡신은 어떤 처리도 요구하지 않는다는 점에서 편리하다. 또한, 싸이미틴 키나제/gancyclovir (GANC) 시스템은 싸이미틴 키나제 유전자가 없는 세포도 사멸될 가능성이 높다는 것이 이미 보고되어진 바 있다 (Yoshiyasu Kaneko et al., Cancer Letters, 96;105-110, 1995). 이러한 점에서, 음성 선별마커로서 디프테리아 톡신이 유리하다.In addition, in the present invention, the term "negative selection marker" refers to a marker that enables negative selection to select and remove cells in which random insertion has occurred, and the herpes simplex virus-thymidine kinase (Herpes simplex virus-thymidine). kinase (HSV-tk), hypoxanthine phosphoribosyl transferase (Hprt), cytosine deaminase, Diphtheria toxin, and the like, preferably diphtheria toxin (DT). -A), but is not limited to this. Diphtheria toxin markers have several advantages over thymidine kinases. First, thymidine kinases are convenient in that they require gancyclovir (GANC) treatment, while diphtheria toxin does not require any treatment. In addition, it has already been reported that the thymidine kinase / gancyclovir (GANC) system is likely to kill cells without the thymidine kinase gene (Yoshiyasu Kaneko et al., Cancer Letters, 96; 105-110, 1995). In this respect, diphtheria toxin is advantageous as a negative selection marker.

본 발명의 음성 선별마커는 제1영역의 5' 말단 쪽 또는 제2영역의 3' 말단 쪽에 위치할 수 있으나, 바람직하게는 제2영역의 3'말단 쪽이며, 본 발명의 벡터 상에서 제2영역의 3'말단에 연결되어 벡터의 3'말단 쪽에 위치하는 것이 더욱 바람직하다. The negative selection marker of the present invention may be located at the 5 'end side of the first region or the 3' end side of the second region, but is preferably the 3 'end side of the second region, and the second region on the vector of the present invention. More preferably connected to the 3 'end of the vector and positioned at the 3' end of the vector.

또한, 본 발명의 선별마커는 선별마커 유전자를 전사시키기 위한 별도의 프 로모터를 상기 벡터 내에 포함할 수 있다. 본 발명의 선별마커 전사를 위해 사용할 수 있는 프로모터로는 포스포글리세레이트 키나아제(phosphoglycerate kinase, PGK) 프로모터, 원숭이 바이러스 40(SV40), 마우스 유방 종양 바이러스(MMTV) 프로모터, HIV의 긴 말단 반복부(LTR) 프로모터, 몰로니 바이러스, 시토메갈로바이러스(CMV) 프로모터, 엡스타인 바 바이러스(EBV) 프로모터, 로우스 사코마 바이러스(RSV) 프로모터, RNA 폴리머라제 Ⅱ 프로모터, β-액틴 프로모터, 사람 헤로글로빈 프로모터 및 사람 근육 크레아틴 프로모터 등이 있으나, 이에 제한되는 것은 아니다. 본 발명의 양성 선별마커를 전사시키기 위한 프로모터는 포스포글리세레이트 키나아제(phosphoglycerate kinase, PGK) 프로모터를 양성 선별마커의 상부(upstream)에 연결되도록 벡터에 삽입시키는 것이 바람직하다. In addition, the selection marker of the present invention may include a separate promoter in the vector for transcription of the selection marker gene. Promoters that can be used for the selection marker transcription of the present invention include a phosphoglycerate kinase (PGK) promoter, monkey virus 40 (SV40), mouse breast tumor virus (MMTV) promoter, long terminal repeats of HIV ( LTR) promoter, molony virus, cytomegalovirus (CMV) promoter, Epstein bar virus (EBV) promoter, Loews sacoma virus (RSV) promoter, RNA polymerase II promoter, β-actin promoter, human heroglobin promoter and Human muscle creatine promoters, and the like, but is not limited thereto. The promoter for transcription of the positive selection marker of the present invention is preferably inserted into the vector so that the phosphoglycerate kinase (PGK) promoter is linked to the upstream of the positive selection marker.

본 발명의 구체적 실시예에서, 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 상동 영역, 핵 국재화 신호(nuclear localization signal, NLS), 양성 선별마커 및 음성 선별마커를 이용하여 벡터를 구축하였다. 본 발명에서는 Simian virus 40 genome에 포함되어 있는 72bp tandem repeat enhancer sequence인 핵 국재화 신호(nuclear localization signal, NLS)를 맨 앞에 위치시키며 다음에 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손9의 EcoRV 제한 효소 위치로부터 SmaI 위치까지 앞쪽 4.8kb(제1영역)를 5‘ 상동 영역으로 연결하고, 양성 선별마커로는 pohosphoglycerine kinase(PGK) 프로모터에 의하여 발현되는 neor 유전자를 연결하였다. 그 다음은 알파 1,3-갈락토실트랜스퍼라아제 유전자의 상동 영역으로 엑손9의 EcoRV 제한 효소 위치부터 PstI 위치까지 뒤쪽 1.9kb(제2영역)를 연결한다. 이를 음성 선별마커가 포함되어 있는 pMCDT-A(A+T/pau)벡터 내에 삽입하여 최종 벡터를 구축하였다. 이렇게 구축된 본 발명의 벡터는 5' 말단부터 핵 국재화 신호 영역-미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자에 상동인 제1영역-양성 선별마커 영역-미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자에 상동인 제2영역-음성 선별마커 영역의 순서로 구성된다. 이러한 벡터는 세포에 도입시 SalI 제한효소로 선형화시켜 이용할 수 있다. In a specific embodiment of the present invention, a vector is constructed using mini-pig alpha 1,3-galactosyltransferase gene homology region, nuclear localization signal (NLS), positive selection marker and negative selection marker. It was. In the present invention, the nuclear localization signal (NLS), which is a 72 bp tandem repeat enhancer sequence included in the Simian virus 40 genome, is placed at the front and then exon 9 of the alpha 1,3-galactosyltransferase gene. The front 4.8 kb (first region) was connected to the 5 'homology region from the EcoRV restriction enzyme position of the SmaI position, and the neo r gene expressed by the pohosphoglycerine kinase (PGK) promoter was connected as a positive selection marker. Next, the homologous region of the alpha 1,3-galactosyltransferase gene connects the rear 1.9 kb (second region) from the EcoRV restriction enzyme position of exon 9 to the PstI position. The final vector was constructed by inserting it into the pMCDT-A (A + T / pau) vector containing the negative selection marker. The constructed vector of the present invention is the first region-positive screening marker region-mini piglet alpha 1,3 homologous to the nuclear localization signal region-mini piglet alpha 1,3-galactosyltransferase gene from the 5 'end. -Second region-negative selection marker region homologous to the galactosyltransferase gene. Such vectors can be used by linearizing with SalI restriction enzymes when introduced into cells.

본 발명의 상기 벡터는 핵 국재화 신호 영역을 포함하지 않은 벡터나 핵 국재화 신호 영역을 3'말단 쪽에 포함한 벡터에 비해 유전자 타겟팅 효율이 높은 것을 확인할 수 있었다(도 5).The vector of the present invention was confirmed to have higher gene targeting efficiency than a vector containing no nuclear localization signal region or a vector including a nuclear localization signal region at the 3 'end (FIG. 5).

또 다른 양태로서, 본 발명은 상기 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터로 유전자 타겟팅된 세포에 관한 것이다.In another aspect, the present invention relates to cells genetically targeted with the alpha 1,3-galactosyltransferase gene targeting vector.

본 발명의 벡터로 타겟팅 될 수 있는 세포는 동물, 바람직하게는 돼지 유래의 체세포이다. 세포를 분리하거나 활성화할 수 있는 유용한 조직에는 간, 신장, 비장, 뼈, 골수, 흉선, 심장, 근육, 허파, 뇌, 정소, 난소, 소도(islet), 내장, 골수, 귀, 피부, 뼈, 쓸개 조직, 전립선, 방광, 배아(embryo), 면역계 및 조혈계 등이 있으나, 이로 제한되지 않는다. 세포 타입은 섬유아 세포, 상피 세포, 신경 세포, 배아 세포, 간 세포, 및 여포 세포 등이 있으나, 이로 제한되지 않는다. 바람 직하게는 섬유 아세포 또는 귀 조직 세포이다. Cells that can be targeted with the vectors of the invention are somatic cells derived from animals, preferably pigs. Useful tissues that can separate or activate cells include liver, kidney, spleen, bone, bone marrow, thymus, heart, muscle, lungs, brain, testes, ovaries, islets, intestines, bone marrow, ears, skin, bones, Gallbladder tissue, prostate, bladder, embryo (embryo), immune system and hematopoietic system and the like, but is not limited thereto. Cell types include, but are not limited to, fibroblasts, epithelial cells, neurons, embryonic cells, liver cells, and follicle cells. Preferably fibroblasts or ear tissue cells.

상기 세포 내로 본 발명의 벡터를 도입하는 방법은 핵산을 세포 내로 도입하기 위한 공지의 방법을 이용할 수 있으며, 당 분야에서 공지된 바와 같이 적합한 표준 기술, 예들 들어, 전기천공법(electroporation), 칼슘 포스페이트 공동-침전(calcium phosphate co-precipitation), 레트로바이러스 감염(retroviral infection), 미세주입법(microinjection), DEAE-덱스트란(DEAE-dextran) 및 양이온 리포좀(cationic liposome)법 등을 이용할 수 있으며, 이로 제한되지 않는다. 이 때 원형의 벡터를 적절한 제한효소로 절단하여 선형의 벡터 형태로 도입하는 것이 바람직하다. The method of introducing the vector of the present invention into the cell may use a known method for introducing a nucleic acid into the cell, and suitable standard techniques, such as electroporation, calcium phosphate, as known in the art Calcium phosphate co-precipitation, retroviral infection, microinjection, DEAE-dextran and cationic liposome methods can be used, including but not limited to It doesn't work. At this time, it is preferable to cut the circular vector with an appropriate restriction enzyme and introduce the linear vector.

또 다른 양태로서, 본 발명은 상기 벡터가 도입되어 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 동물에 관한 것이다.In another embodiment, the present invention relates to a transgenic animal in which the vector is introduced to knock out the alpha 1,3-galactosyltransferase gene.

본 발명에서 용어 "넉 아웃(knock-out)"이라 함은 염기서열 중 특정 유전자가 발현될 수 없도록 이를 변형시키거나 제거하는 것을 의미하는데, 본 발명의 타겟팅 벡터가 도입된 체세포를 이용하여 동물의 수정란에 핵이식시키고, 핵이식된 수정란을 착상시켜 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 개체를 생산해낼 수 있다. 이러한 개체는 세포의 유전적 물질이 핵수여 세포질로 그대로 전달되었기 때문에 유전적으로 완전히 동일한 복제 개체라고 할 수 있다.In the present invention, the term "knock-out" refers to modifying or removing a specific gene from a nucleotide sequence so that it cannot be expressed, and using the somatic cell into which the targeting vector of the present invention is introduced. Embryos can be nuclear transplanted and the transplanted embryos can be implanted to produce transgenic individuals knocked out of the alpha 1,3-galactosyltransferase gene. These individuals can be said to be genetically identical clones because the genetic material of the cell has been transferred to the nuclear donor cytoplasm.

본 발명의 벡터를 도입시켜 넉 아웃시킬 수 있는 동물은 바람직하게는 돼지, 더욱 바람직하게는 미니돼지이며, 본 발명의 벡터를 통해 알파 1,3-갈락토실트랜스 퍼라아제 유전자가 넉 아웃된 형질전환 돼지는 급성 면역반응을 일으키지 않아 이종장기이식에 효과적으로 이용될 수 있다.Animals capable of introducing and knocking out the vector of the present invention are preferably pigs, more preferably mini pigs, and traits in which the alpha 1,3-galactosyltransferase gene has been knocked out through the vector of the present invention. Transgenic pigs do not cause acute immune responses and can be effectively used for xenotransplantation.

또 다른 양태로서, 본 발명은 (1)제1항의 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터를 구축하는 단계; (2)돼지로부터 체세포를 분리 및 배양하는 단계; (3)구축된 단계(1)의 벡터를 상기 단계(2)에서 분리한 체세포에 도입하여 상동재조합을 유도하는 단계; 및 (4)상동재조합에 의해 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 선별하는 단계를 포함하는, 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 제조하는 방법에 관한 것이다.In still another aspect, the present invention provides a method for preparing a pig alpha 1,3-galactosyltransferase gene targeting vector of claim 1; (2) separating and culturing somatic cells from pigs; (3) introducing the vector of the constructed step (1) into the somatic cells isolated in the step (2) to induce homologous recombination; And (4) selecting the somatic cells of the pigs to which the pig alpha 1,3-galactosyltransferase gene is targeted by homologous recombination, wherein the alpha 1,3-galactosyltransferase gene is targeted. It relates to a method for producing somatic cells of pigs.

이하, 본 발명의 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 제조하는 방법을 단계별로 설명한다.Hereinafter, a step-by-step method for producing somatic cells of pigs targeted to the alpha 1,3-galactosyltransferase gene of the present invention will be described.

먼저, 단계 (1)은 본 발명의 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터를 구축하는 단계로서, 상기에서 설명한 바와 같이, 핵 국재화 신호(nuclear localization signal, NLS) 영역 - 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 4 내지 6 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 인트론 8 일부 및 엑손 9의 일부를 포함하는 제1영역 - 양성 선별마커 영역 - 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 0.5 내지 2 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 9의 일부를 포함하는 제2영역 - 음성 선별마커 영역을 가지며, 상기 영역들이 5'말단에서부터 순서대로 구성되도록 구축할 수 있다. 이렇게 구축된 본 발명의 타겟팅 벡터는 세포 내의 내재적 알파 1,3-갈락토실트랜스퍼라아제 유전자에 타겟팅되어 이들 유전자를 파괴시킬 수 있다.First, step (1) is a step of constructing a pig alpha 1,3-galactosyltransferase gene targeting vector of the present invention, as described above, a nuclear localization signal (NLS) region − 4 to 6 kb long nucleic acid sequence homologous to porcine alpha 1,3-galactosyltransferase nucleic acid sequence, part of intron 8 and exon 9 of porcine alpha 1,3-galactosyltransferase gene A first region comprising a positive-selective marker region-a pig's alpha 1,3-galactosyltransfer as a nucleic acid sequence 0.5 to 2 kb in length homologous to the pig's alpha 1,3-galactosyltransferase nucleic acid sequence It has a second region including a part of exon 9 of the lyase gene-negative selection marker region, the regions can be constructed to be configured in order from the 5 'end. The targeting vector of the present invention thus constructed can be targeted to the intrinsic alpha 1,3-galactosyltransferase gene in the cell to destroy these genes.

단계 (2)는 돼지로부터 체세포를 분리 및 배양하는 단계로서, 단계 (1)의 타겟팅 벡터를 도입시키기 위한 돼지의 체세포를 분리하고, 배양시켜 체세포를 생산하는 단계이다. 상기 돼지의 체세포는 돼지의 귀 조직에서 분리하는 것이 바람직한데, 귀 조직은 분만 10일령의 귀 조직을 사용하고 이들 조직을 1 내지 3mm 정도로 절단하여 배양할 수 있다.Step (2) is a step of isolating and culturing somatic cells from pigs, and isolating and culturing somatic cells of pigs for introducing the targeting vector of step (1) and producing somatic cells. Preferably, the somatic cells of the pig are separated from the pig's ear tissue, and the ear tissue may be cultured by cutting the tissue about 1 to 3 mm using the 10-day-old ear tissue.

이들의 조직 배양시에는 귀 조직이 배양액 안으로 완전히 잠기지 않도록 하는 것이 바람직하다. 또한, 상기 체세포 분리 및 배양을 위한 배지는 고농도의 글루코오스 및 FBS가 포함된 배지를 이용하여 귀 조직으로부터 체세포를 분리하고, FBS, 비필수 아미노산 및 항생제를 포함한 배지에서 계대 배양하는 것을 통해 체세포를 생산할 수 있으며, 바람직하게는 돼지의 귀 조직을 고농도의 글루코오스 및 15% FBS(fetal bovine serum)가 포함된 DMEM(Dulbecco's Modified Eagle Medium) 배지에 배양하여 체세포를 분리하고, 20% FBS, 1X 비필수 아미노산, 1X 피루브산나트륨, 10-4M 베타-머르캅토에탄올, 100Unit/ml 페니실린 및 100㎍/㎖ 스트렙토마이신이 포함된 DMEM 배지에서 계대 배양할 수 있다.When culturing these tissues, it is desirable that the ear tissues are not completely submerged into the culture medium. In addition, the medium for somatic cell isolation and culture is to isolate somatic cells from the ear tissues using a medium containing high concentration of glucose and FBS, to produce somatic cells through passage in a medium containing FBS, non-essential amino acids and antibiotics Preferably, the ear tissue of the pig is cultured in Dulbecco's Modified Eagle Medium (DMEM) medium containing high concentration of glucose and 15% fetal bovine serum (FBS) to isolate somatic cells, 20% FBS, 1X non-essential amino acids. , 1X sodium pyruvate, 10 -4 M beta-mercaptoethanol meoreu, 100Unit / ml penicillin and may be sub-cultured in DMEM medium containing 100㎍ / ㎖ streptomycin.

단계 (3)은 구축된 단계(1)의 벡터를 상기 단계(2)에서 분리한 체세포에 도입하여 상동재조합을 유도하는 단계로서, 본 발명의 타겟팅 벡터를 단계(2)에서 생산한 돼지의 체세포에 도입시켜 상동재조합을 유도하여 돼지의 체세포 게놈 상의 알파 1,3-갈락토실트랜스퍼라아제 유전자를 파괴시키는 단계이다.Step (3) is a step of inducing homologous recombination by introducing the constructed vector of step (1) into the somatic cells isolated in step (2), wherein the somatic cells of the pig produced in step (2) of the targeting vector of the present invention. Inducing homologous recombination to disrupt the alpha 1,3-galactosyltransferase gene on the pig somatic genome.

본 발명의 벡터를 돼지의 체세포에 도입시키는 방법은 상기에서 설명한 바와 같이 핵산을 세포 내로 도입하는 공지의 방법, 예를 들어, 전기천공법(electroporation), 칼슘 포스페이트 공동-침전(calcium phosphate co-precipitation), 레트로바이러스 감염(retroviral infection), 미세주입법(microinjection), DEAE-덱스트란(DEAE-dextran) 및 양이온 리포좀(cationic liposome) 등을 이용할 수 있으며, 바람직하게는 전기천공법이지만, 이에 제한되는 것은 아니다. 또한, 통상적인 유전자 타겟팅 벡터의 경우 유전자의 크기가 큰 편이라서 주로 전기천공법을 이용하여 체세포 내로 도입하지만, 본 발명의 벡터는 핵 국재화 신호 영역을 포함하고 있어, 핵 내로의 유입이 용이하므로 양이온 리포좀 법을 이용하더라도 효율적으로 세포 내 도입이 가능할 수 있다.The method of introducing the vector of the present invention into somatic cells of pigs is a known method for introducing nucleic acids into cells, as described above, for example, electroporation, calcium phosphate co-precipitation. ), Retroviral infection, microinjection, DEAE-dextran and cationic liposomes, and the like, but are preferably electroporated, but are not limited thereto. no. In addition, conventional gene targeting vectors are large in gene size and are mainly introduced into somatic cells using electroporation. However, since the vector of the present invention includes a nuclear localization signal region, the vector is easily introduced into the nucleus. Even using the cationic liposome method, it can be efficiently introduced into the cell.

또한, 본 발명의 단계 (3)은 벡터를 도입하기 전에 돼지의 체세포에 싸이미딘(thymidine)을 처리하는 단계를 추가로 포함할 수 있다. 싸이미딘은 세포의 주기를 S 기(phase)에서 블럭시켜 S 기로 동기화시킬 수 있는데, 이를 통해 S기로 동기화된 세포는 유전자 타겟팅 벡터의 타겟팅 효율을 훨씬 증가시켜줄 수 있다. 본 발명의 돼지 체세포에 처리하는 싸이미딘의 농도는 1 내지 5 mM 정도가 바람직하며, 더욱 바람직하게는 2 mM이며, 싸이미딘 처리 시간은 15 내지 18시간 정도가 바 람직하며, 더욱 바람직하게는 16시간이다.In addition, step (3) of the present invention may further comprise the step of treating thymidine to the somatic cells of the pig before introducing the vector. Cymidine can block the cycle of the cell in the S phase (synchronized to the S phase), which allows the cells synchronized with the S group can significantly increase the targeting efficiency of the gene targeting vector. The concentration of the thymidine to be treated in the porcine somatic cells of the present invention is preferably about 1 to 5 mM, more preferably 2 mM, the thymidine treatment time is preferably about 15 to 18 hours, more preferably 16 It's time.

단계 (4)는 상동재조합에 의해 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 선별하는 단계로서, 단계 (3)의 상동재조합에 의해 돼지 체세포의 게놈 상에 존재하는 내재적 알파 1,3-갈락토실트랜스퍼라아제 유전자가 파괴된 돼지의 체세포를 선별해내는 단계이다.Step (4) is a step of selecting the somatic cells of pigs targeted to the pig alpha 1,3-galactosyltransferase gene by homologous recombination, which is present on the genome of the somatic cells of the pig by homologous recombination of step (3). This step is to select the somatic cells of pigs in which the intrinsic alpha 1,3-galactosyltransferase gene is destroyed.

상기 체세포 선별은 벡터 내에 삽입되어 있던 선별마커 유전자를 이용할 수 있는데, 특히, 벡터 상에 존재하던 양성 선별마커가 돼지 체세포 게놈 상으로 도입되어 발현되면, 이들 양성 선별마커 발현을 인식할 수 있는 처리제를 이용하여 타겟팅 여부를 식별할 수 있게 된다. 본 발명의 선별마커로는 바람직하게는 네오마이신 마커를 이용할 수 있으며, 선별을 위한 처리제로는 항생제, G418을 이용할 수 있다. 선별을 위해 사용하는 G418의 농도는 200 내지 400㎍/㎖ 가 바람직하며, 더욱 바람직하게는 300 ㎍/㎖이다.The somatic cell selection may use a selection marker gene inserted into the vector. In particular, when a positive selection marker existing on the vector is introduced into and expressed on the porcine somatic cell genome, a treatment agent capable of recognizing the expression of these positive selection markers may be used. It can be used to identify whether targeting. As the selection marker of the present invention, a neomycin marker may be preferably used, and an antibiotic, G418, may be used as a treatment agent for selection. The concentration of G418 used for selection is preferably 200 to 400 µg / ml, more preferably 300 µg / ml.

또한, 유전자 타겟팅 벡터가 도입된 클론 체세포의 선별에 이용할 수 있는 배양은 15% 내지 20% FBS을 포함하는 DMEM을 사용할 수 있으며, 바람직하게는 20% FBS를 포함한다. 왜냐하면, 선별 시 세포의 증식을 촉진시키는 것이 보다 빠르게 세포를 선별할 수 있기 때문이다. 더욱 바람직하게는 20%의 FBS(fetal bovine serum, FBS), 비필수 아미노산, 피루브산나트륨, 베타-머르캅토에탄올이 포함된 DMEM 배지를 이용할 수 있다. 또한, 상기 단계(3)을 통해 상동재조합을 유도한 돼지 체세포를 G418 선별 배지에서 11 내지 12일간 배양한 후, 선별하는 것이 바람직 하다.In addition, the culture that can be used for selection of clonal somatic cells into which the gene targeting vector has been introduced may use DMEM including 15% to 20% FBS, and preferably 20% FBS. This is because promoting the proliferation of cells at the time of selection can result in faster cell selection. More preferably, DMEM medium containing 20% of FBS (fetal bovine serum, FBS), non-essential amino acids, sodium pyruvate, and beta-mercaptoethanol may be used. In addition, the pig somatic cells induced homologous recombination through step (3) is preferably incubated in G418 selection medium for 11 to 12 days and then selected.

또한, 본 발명의 벡터가 제대로 체세포 내의 알파 1,3-갈락토실트랜스퍼라아제 유전자에 타겟팅되었는지를 분석하기 위해 PCR 및 서던 블롯(Southern blot)을 이용할 수 있다.In addition, PCR and Southern blots can be used to analyze whether the vectors of the present invention are properly targeted to the alpha 1,3-galactosyltransferase gene in somatic cells.

상기 PCR 분석은 1차 및 2차 PCR을 통해 효율적으로 타겟팅된 세포를 분석해낼 수 있는데 먼저, 1차적인 PCR은 알파 1,3-갈락토실트랜스퍼라아제 유전자의 3' 상동영역(제2영역) 바깥 쪽에 있는 프라이머와 neor 유전자 상에 있는 프라이머를 이용함으로써, 벡터가 세포 내로 유입이 되었는지를 분석한다. 유전자 타겟팅은 상동염색체 중 한 곳에서 일어나므로 유전자 타겟팅이 일어난 상동염색체와 그렇지 않은 상동염색체가 세포에 존재하게 되므로 이들을 동시에 PCR 분석함으로써, 이들의 차이를 통해 타겟팅 여부를 좀더 정확하게 분석할 수 있게 된다. 이를 위해 1차 PCR에 의해 선별된 세포를 대상으로 2차 PCR을 수행할 수 있다. 2차 PCR을 위한 프라이머는 엑손 9번 EcoRV 위치의 앞쪽 프라이머와 3' 상동영역(제2영역) 바깥 쪽에 있는 프라이머를 이용할 수 있다. The PCR assay can analyze efficiently targeted cells through primary and secondary PCR. First, the primary PCR is a 3 'homologous region of the alpha 1,3-galactosyltransferase gene (second region). By using the outer primer and the primer on the neo r gene, the vector is introduced into the cell. Since gene targeting occurs in one of the homologous chromosomes, homologous chromosomes and homologous chromosomes that are not present in the cells are present in the cells, so that PCR can be analyzed at the same time, so that they can be analyzed more accurately. To this end, secondary PCR may be performed on cells selected by primary PCR. As a primer for the secondary PCR, a primer outside the 3 'homology region (second region) and the front primer of exon 9 EcoRV position may be used.

상기 유전자 타겟팅된 체세포 제조방법에 의해 본 발명의 벡터로 유전자 타겟팅된 돼지 체세포주를 GTKO 21 이라고 명명하였고, KCTC(Korean Collection for Type Cultures, 대한민국 대전 유성구 과학로 111번지 한국생명공학연구원)에 2008 년 7월 24일자로 기탁번호 제KCTC 11369BP호로 기탁하였다.Porcine somatic cell lines genetically targeted with the vector of the present invention by the method of producing a gene-targeted somatic cell was named GTKO 21, 2008 in KCTC (Korean Collection for Type Cultures, 111, Sciro-ro, Yuseong-gu, Daejeon, Korea) The deposit was made on July 24 with accession number KCTC 11369BP.

또 다른 양태로서, 본 발명은 (1)상기 체세포 제조방법에 의하여 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 수득하는 단계; (2)돼지 난자의 핵을 제거하고 상기 유전자 타겟팅된 세포를 도입하여 체세포 핵이식된 수정란을 제조하는 단계; 및 (3)상기 수정란을 착상시키는 단계를 포함하는, 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 돼지를 제조하는 방법에 관한 것이다.In another aspect, the present invention comprises the steps of (1) obtaining a somatic cell of a pig targeted to the alpha 1,3-galactosyltransferase gene by the somatic cell production method; (2) removing the nucleus of the pig egg and introducing the gene-targeted cell to produce a somatic cell nuclear transfer embryo; And (3) relates to a method for producing a transgenic pig knocked out alpha 1,3-galactosyltransferase gene, comprising the step of implanting the fertilized egg.

본 발명의 벡터는 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자로의 타겟팅이 최적화된 벡터이므로, 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 돼지 제조에 이용될 수 있으며, 상기 벡터로 타겟팅된 체세포를 돼지의 수정란에 핵 이식시키고, 이렇게 핵 이식된 수정란을 착상시켜 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 돼지를 생산해낼 수 있다.Since the vector of the present invention is a vector optimized for targeting to the alpha 1,3-galactosyltransferase gene of pigs, it can be used for the production of pigs knocked out of the alpha 1,3-galactosyltransferase gene. The somatic cells targeted by the vector may be nuclear-transplanted into a fertilized egg of a pig, and the nuclear-transplanted fertilized egg may be implanted to produce a pig knocked out of the alpha 1,3-galactosyltransferase gene.

난자의 핵, 즉 유전 물질을 제거하기 위해서는 물리적인 방법, 화학적인 방법 및 사이토칼라신(Cytochalasin) B를 사용한 원심분리법 등을 사용할 수 있으며, 바람직하게는 유리 마이크로피펫 (glass micropipette)을 사용하는 물리적인 핵 제거 방법을 사용할 수 있다.In order to remove the nucleus of the egg, that is, the genetic material, physical methods, chemical methods, and centrifugation using Cytochalasin B can be used. Preferably, the physical properties using glass micropipettes are used. Phosphorus nucleation can be used.

상기 유전자 타겟팅된 체세포를 핵이 제거된 난자 내로 도입시키는 방법은 세포막융합법, 세포질내 미세주입법 등을 이용할 수 있는데, 세포막융합법은 간단하며 대규모 수정란 생산에 적합하다는 장점이 있으며, 세포질내 미세주입법은 핵과 난자내 물질들과의 접촉을 극대화시킨다는 장점이 있다.The method of introducing the genetically targeted somatic cells into the nucleus from which the nucleus has been removed may use cell membrane fusion, intracellular microinjection, etc. The cell membrane fusion method is simple and suitable for large-scale fertilized egg production. Has the advantage of maximizing contact between the nucleus and the material in the egg.

체세포와 핵이 제거된 난자와의 융합은 전기자극을 통하여 세포막의 점도를 변화시켜 융합시키는 방법을 통하여 재조합할 수 있으며, 이때, 미세전류ㆍ전압을 자유롭게 조정할 수 있는 전기융합기를 이용할 수 있다.Fusion of the somatic cell and the nucleus from which the nucleus has been removed can be recombined by changing the viscosity of the cell membrane through electric stimulation and fusing. In this case, an electric fusion device capable of freely adjusting the microcurrent and voltage can be used.

핵이식된 수정란은 활성화시켜 이식 가능한 단계까지 발생시킨 후 대리모로 착상시키는 것이 바람직하다. 여기서 복제 수정란의 활성화는 수정란이 분열할 수 있도록 성숙과정에서 일시적으로 정지되어진 세포주기를 다시 가동시키는 것을 의미한다. 복제수정란 활성화를 위하여서는 세포주기 정지요소인 MPF, MAP 키나제 등의 세포신호전달물질의 활성을 저하시키는 것이 바람직하며, 이를 위해 복제 수정란 내 칼슘이온을 증가시키기 위해 세포막 투과도를 변형시키거나, 세포 외로부터 칼슘유입을 급격히 증가시키거나, 이노마이신(ionomycin) 및 6-DMAP 등의 화학적 물질을 이용하여 세포주기 정지요소의 활성을 직접적으로 저해시키는 방법 등을 이용할 수 있다.Nuclear transplanted embryos are preferably activated and developed to the implantable stage and implanted into surrogate mothers. Here, activation of a replication fertilized egg means reactivating a cell cycle that is temporarily stopped during maturation so that the fertilized egg can divide. In order to activate the fertilized eggs, it is desirable to reduce the activity of cell signaling materials such as MPF and MAP kinases, which are cell cycle arrest elements. To this end, the cell membrane permeability is modified to increase calcium ions in the cloned fertilized eggs or extracellular. Or a method of rapidly inhibiting the influx of calcium, or directly inhibiting cell cycle arrester activity using chemicals such as inomycin and 6-DMAP.

이러한 방법을 통해 생산된 돼지는 세포 내재적인 알파 1,3-갈락토실트랜스퍼라아제 유전자가 결손되어 있기 때문에, 이종간 장기이식시 급성 면역반응이 저해될 수 있다. Pigs produced through this method are deficient in the cellular intrinsic alpha 1,3-galactosyltransferase gene, and thus acute immune responses may be inhibited during organ transplantation.

본 발명의 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터는 핵 국재화 신호 영역을 포함하고 있어 타겟팅 세포의 핵 내로의 유입이 용이하여 타겟팅 효율이 높은 장점을 가진다. 이러한 타겟팅 벡터를 이용하여 생산된 알파 1,3-갈락토실트랜스퍼라아제 유전자기 넉 아웃된 형질전환 동물은 급속한 면역거부반응이 억제되어 이종 간의 장기이식에 유용하게 이용될 수 있다. The alpha 1,3-galactosyltransferase gene targeting vector of the present invention includes a nuclear localization signal region, so that targeting cells can be easily introduced into the nucleus and have high targeting efficiency. The transgenic animals knocked out of the alpha 1,3-galactosyltransferase gene group produced using such a targeting vector can be usefully used for organ transplantation between xenografts due to suppression of rapid immune rejection.

이하, 하기 실시예에 의해 본 발명을 좀더 구체적으로 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 실시하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다. Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for carrying out the present invention by way of example, but the scope of the present invention is not limited to these examples.

실시예Example 1. 미니돼지 알파 1,3- 1.Mini Pig Alpha 1,3- 갈락토실트랜스퍼라아제Galactosyltransferase 유전자  gene 타겟팅Targeting 벡터 구축 Vector building

돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자는 9개의 엑손으로 이루어져 있으며, 엑손 1 내지 엑손 9와 인트론의 일부 염기서열이 알려져 있다(Kihiro Koike et al., Transplantation, 70;1275-1283, 2000). 알파 1,3-갈락토실트랜스퍼라아제 유전자의 효소활성의 대부분은 엑손 9에 존재하므로 (Yifan Dai, Nature, 20;251-255, 2002), 본 실시예에서는 알파 1,3-갈락토실트랜스퍼라아제 유전자 영역과 핵 국재화 신호(localization signal, NLS), 양성 선별마커 및 음성 선별마커를 이용하여 엑손 9번 부위를 제거할 수 있는 유전자 타겟팅 벡터를 구축하였다. The alpha 1,3-galactosyltransferase gene in pigs consists of nine exons and some sequences of exons 1 to exon 9 and introns are known (Kihiro Koike et al., Transplantation, 70; 1275-1283). , 2000). Since most of the enzymatic activity of the alpha 1,3-galactosyltransferase gene is present in exon 9 (Yifan Dai, Nature, 20; 251-255, 2002), in this example alpha 1,3-galactosyl A gene targeting vector was constructed to remove exon 9 using a transferase gene region, a nuclear localization signal (NLS), a positive selection marker, and a negative selection marker.

구체적으로, 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 8과 9번을 포함하는 유전자 단편은 미니돼지 게놈 DNA을 이용하여 다음과 같이 long PCR에 의하여 동정하였다. PCR은 200ng 게놈 DNA, 1XPCR buffer, 2.5mM dNTP, 2.5 U i-Max II DNA 폴리머라제, 10 pmole 센스 프라이머 (AGGTCGTGACCATAACCAGATGGAAGGCTC, 서열번호 1) 및 안티센스 프라이머 (CTTGCACCATGAAAGGTCTCTGCAACTCCAGAA, 서열번호 2)를 이용하여 94℃ 40초, 68℃ 40초, 72℃ 10분의 조건에서 실시하였다. 증폭된 DNA 단편은 pGEM T-easy vector에 서브클로닝하였으며 시퀀싱을 실시하여 최종적으로 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자임을 확인하였다. Specifically, gene fragments including exons 8 and 9 of the mini pig alpha 1,3-galactosyltransferase gene were identified by long PCR using the mini pig genomic DNA as follows. PCR was performed at 200 ° C genomic DNA, 1 XPCR buffer, 2.5 mM dNTP, 2.5 U i-Max II DNA polymerase, 10 pmole sense primer (AGGTCGTGACCATAACCAGATGGAAGGCTC, SEQ ID NO: 1) and antisense primer (CTTGCACCATGAAAGGTCTCTGCAACTCCAGAA, SEQ ID NO: 2). It carried out on the conditions of the second, 68 degreeC 40 second, and 72 degreeC 10 minutes. The amplified DNA fragments were subcloned into the pGEM T-easy vector and sequenced to confirm that the gene was finally a mini pig alpha 1,3-galactosyltransferase gene.

또한, 핵 국재화 신호(Nuclear localization signal, NLS)는 Clontech pEGFP-N3 벡터(Clontech)를 이용하여 클로닝하였다. DNA는 10pg로 희석하여 사용하였고 10 pmol의 센스 프라이머 (CGGAGTTAGGGGCGGGACTA, 서열번호 3) 및 안티센스 프라이머 (CCAGCTGTGGAATGTGTGTC, 서열번호 4)를 이용하여 1×PCR-버퍼, 0.5U 택 폴리머라제(Taq polymerase, Promega), 각 200uM dNTP 조성으로 변성(denaturation) 94℃ 30초, 어닐링(nealing) 60℃ 30초, 연장(extension) 72℃ 30 초, 40 cycle의 반응조건으로 PCR을 수행하였다. PCR산물은 2% 아가로오스 겔에서 전기영동하여 확인하였으며 염기서열 결정을 위하여 pGEM T-easy vector(Promega)에 서브클로닝하였다. 염기서열 결정은 ABI PRISM 377 sequencer(Applied Biosystems)를 사용하여 결정하였다. 결정된 염기서열의 분석은 Genetyx-win(version 4.0)을 이용하여 분석하였다. In addition, the nuclear localization signal (Nuclear localization signal, NLS) was cloned using the Clontech pEGFP-N3 vector (Clontech). DNA was diluted to 10 pg and used in 1 × PCR-buffer, 0.5 U tack polymerase (Taq polymerase, Promega) using 10 pmol sense primer (CGGAGTTAGGGGCGGGACTA, SEQ ID NO: 3) and antisense primer (CCAGCTGTGGAATGTGTGTC, SEQ ID NO: 4). PCR was performed under reaction conditions of denaturation at 94 ° C. 30 seconds, annealing at 60 ° C. 30 seconds, extension at 72 ° C. 30 seconds, and 40 cycles. PCR products were identified by electrophoresis on 2% agarose gel and subcloned into pGEM T-easy vector (Promega) for sequencing. Sequencing was determined using ABI PRISM 377 sequencer (Applied Biosystems). Analysis of the determined nucleotide sequence was analyzed using Genetyx-win (version 4.0).

상기 방법으로 얻은 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 8과 9번을 포함하는 유전자 단편을 Not I 제한효소로 절단한 다음 pBluscriptII SK (-) vector에 서브클로닝하여 pBSK(-)GT DNA을 확보하였다. Gene fragments comprising exons 8 and 9 of the mini pig alpha 1,3-galactosyltransferase gene obtained by the above method were digested with Not I restriction enzyme and subcloned into pBluscriptII SK (-) vector to obtain pBSK ( GT DNA was obtained.

타겟팅 벡터의 5' 상동영역(제1영역) 및 3' 상동영역(제2영역)을 제작하기 위하여 pBSK(-)GT DNA을 Not I과 EcoR V 제한효소로 절단하여 5.4kb와 2.5kb의 단편을 각각 pBluscriptII SK (-) 벡터에 서브클로닝하여 pBSK(-)GT5.4 DNA와 pBSK(-)GT2.5 DNA을 확보하였다. 5' 상동영역을 구축하기 위하여 pBSK(-)GT5.4 DNA을 제한효소 SmaI으로 절단한 후 blunting하였으며 이 위치에 Sal I linker을 연결하였다. 또한 EcoR V site는 blunting하여 Not I linker을 연결하였다. 이렇게 제작된 4.8kb Sal I-Not I 단편은 pBluscriptII SK (+)의 Sal I-Not I site에 서브클로닝하여 pBSK(+)GT4.8 DNA을 제작하였다. PBSK (-) GT DNA was digested with Not I and EcoR V restriction enzymes to prepare 5 'homology region (first region) and 3' homology region (second region) of the targeting vector. Were subcloned into pBluscriptII SK (-) vectors, respectively, to obtain pBSK (-) GT5.4 DNA and pBSK (-) GT2.5 DNA. To construct the 5 'homology region, pBSK (-) GT5.4 DNA was digested with restriction enzyme SmaI and blunted to connect the Sal I linker to this position. The EcoR V site also blunted to connect the Not I linker. The 4.8 kb Sal I-Not I fragment thus prepared was subcloned to Sal I-Not I site of pBluscriptII SK (+) to prepare pBSK (+) GT4.8 DNA.

또한, 3' 상동영역을 구축하기위해서는 pBSK(-)GT2.5 DNA을 Pst I 제한효소로 절단하여 blunting 한 후 Xho I linker을 연결한 다음 pBluscriptII SK (-)의 EcoR V-Xho I site에 서브클로닝하여 pBSK(-)GT1.9 DNA을 구축하였다. In addition, in order to construct 3 'homology region, pBSK (-) GT2.5 DNA was cut and blunted by Pst I restriction enzyme, and then Xho I linker was connected, and then, the subsited at EcoR V-Xho I site of pBluscriptII SK (-). Cloning to construct pBSK (-) GT1.9 DNA.

양성선별마커인 neo 유전자는 pKJ2-neo plasmid을 EcoR I과 BamH I으로 절단한 후 Not I과 EcoR V linker을 연결하였다. 이렇게 확보된 neo 유전자의 Not I-EcoR V 단편과 pBSK(-)GT1.9 DNA의 EcoR V-Xho I 단편은 pBluscriptII SK (-)의 Not I-Xho I site에 3 fragment ligation을 실시하여 pBSK(-)GTneo1.9 DNA을 구축하였다. The neo gene, a positive selection marker, cleaved pKJ2-neo plasmid with EcoR I and BamH I and then linked Not I and EcoR V linker. The Not I-EcoR V fragment of the neo gene and the EcoR V-Xho I fragment of pBSK (-) GT1.9 DNA were subjected to 3 fragment ligation at the Not I-Xho I site of pBluscriptII SK (-). GTneo 1.9 DNA was constructed.

5' 상동영역을 연결하기 위하여 pBSK(+)GT4.8 DNA을 Sal I-Not I 제한효소로 절단한 4.8kb의 단편을 pBSK(-)GTneo1.9 DNA의 Sal I-Not I 제한효소 위치에 서브클로닝하였다. 이렇게 제조된 DNA를 pBSK(-)GT4.8neo1.9 DNA라고 명명하였으며, 이를 Sal I과 Not I 제한 효소로 처리한 후 단편을 음성 선별마커 디프레리아 톡신 유전자를 포함하고 있는 pMCDT-A(A+T/pau) 벡터의 Sal I-Not I site에 연결하여 기본적인 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터를 구축하였며, DT-A/pGT5'/neor/pGT3' vector로 명명하였다. 또한 NLS의 연결은 NLS을 Xho I과 Sal I 제한효소로 절단한 단편을 DT-A/pGT5'/neor/pGT3' vector의 Xho I-Sal I site에 연결하여 최종적인 본 발명의 벡터 DT-A/NLS/pGT5'/neor/pGT3'를 구축하였다. 상기 벡터는 Sal I 제한효소으로 절단시켜 선형화한 후 세포로의 유전자 도입에 이용하였다(도 1, 도 2). To connect the 5 'homology region, a 4.8 kb fragment of pBSK (+) GT4.8 DNA digested with Sal I-Not I restriction enzyme was placed at the Sal I-Not I restriction enzyme in pBSK (-) GTneo1.9 DNA. Subcloning. The DNA thus prepared was named pBSK (-) GT4.8neo1.9 DNA, and the fragment was treated with Sal I and Not I restriction enzymes, and then the fragment was prepared with pMCDT-A (A) containing a negative selection marker, the Dipreria toxin gene. + T / pau) constructs a basic mini-pig alpha 1,3-galactosyltransferase gene targeting vector by connecting to the Sal I-Not I site of the vector, DT-A / pGT5 '/ neo r / pGT3' We named it vector. In addition, the linkage of NLS is a vector DT- of the present invention by linking a fragment obtained by cutting NLS with Xho I and Sal I restriction enzymes to the Xho I-Sal I site of DT-A / pGT5 '/ neo r / pGT3' vector. A / NLS / pGT5 '/ neor r / pGT3' was constructed. The vector was linearized by cleavage with Sal I restriction enzyme and used for gene introduction into cells (FIG. 1, FIG. 2).

또한, 본 발명에서 제조된 벡터와 효율을 비교하기 위하여 일반적으로 사용되는 유전자 타겟팅 벡터를 제조하였다. In addition, a gene targeting vector generally used to compare efficiency with the vector produced in the present invention was prepared.

첫 번째 대조군 벡터로서 일반적으로 사용하는 핵 국재화 신호 영역이 포함되지 않고, 양성 선별마커와 음성 선별마커를 가지고 있는 벡터를 제작하였다. 이 벡터는 상기에서 기재한 방법과 같이 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자의 5' 상동영역의 Sam I 제한 효소 위치를 Sal I으로, 엑손 9에 존재하는 EcoR V 위치를 Not I으로 치환하여 사용하였다. 그리고 양성 선별마커는 PGK-neor 유전자를, 3' 상동영역은 엑손 9의 위치에 있는 Pst I 제한효소 위치를 Xho I으로 치환시켜 제조한 EcoR V-Xho I 1.9kb 단편을 이용하였다. 이렇게 얻어진 단편 5' 상동영역(Sal I-Not I, 4.8kb), PGK-neor 유전자, 3' 상동영역(EcoR V-Xho I)을 연 결한 후에 전체 연결된 단편을 Sal I과 Xho I으로 절단하여 음성 선별마커(디프테리아 톡신)를 포함하고 있는 pMCDT-A(A+T/pau)벡터의 SalI과 XhoI 제한효소 위치에 삽입하여 최종적인 첫 번째 대조군 벡터 DT-A/pGT5'/neor/pGT3'를 구축하였다(도 2). 세포에 도입시에는 salI 제한효소로 절단하여 선형화하여 이용하였다.As a first control vector, a vector having a positive selection marker and a negative selection marker was prepared, which does not include a nuclear localization signal region which is generally used. This vector is a Sal I and 5 I homologous region of the mini pig alpha 1,3-galactosyltransferase gene, Sal I, and EcoR V position of exon 9, as described above. Substituted with I was used. In addition, the EcoR V-Xho I 1.9 kb fragment prepared by replacing the PGK-neo r gene with the positive selection marker and Xho I at the 3st homology region with the position of Pst I restriction enzyme located at the position of exon 9 was used. The fragment 5 'homology region (Sal I-Not I, 4.8kb), the PGK-neo r gene, and the 3' homology region (EcoR V-Xho I) were obtained, and then the entire linked fragment was cut into Sal I and Xho I. The final control vector DT-A / pGT5 '/ neo r / pGT3 was inserted into the SalI and XhoI restriction enzyme positions of the pMCDT-A (A + T / pau) vector containing the negative selection marker (diphtheria toxin). 'Was built (FIG. 2). When introduced into the cells were cut and linearized with salI restriction enzyme.

두 번째 대조군 벡터로서, 음성 선별마커를 사용하지 않고 양성 선별마커와 핵 국재화 신호 영역만으로 구성된 벡터를 구축하였다. 이 벡터는 상기와 같은 방법으로 5' 상동영역(Sma I-Not I, 4.8kb), PGK-neor 유전자, 3' 상동영역(EcoR V-Xho I)을 연결하여 pBluescript SK 벡터에 삽입하고, NLS 영역을 3' 벡터의 3'말단쪽 xhoI 제한효소 위치에 삽입하여 최종적인 두 번째 대조군 벡터, pGT5'/neor/pGT3'/NLS 를 구축하였다(도 2). 세포에 도입시에는 ApaI 제한효소로 절단하여 선형화하여 이용하였다.As a second control vector, a vector consisting only of a positive selection marker and a nuclear localization signal region was constructed without using a negative selection marker. The vector is inserted into the pBluescript SK vector by connecting the 5 'homology region (Sma I-Not I, 4.8kb), the PGK-neo r gene, and the 3' homology region (EcoR V-Xho I) in the same manner as above. The NLS region was inserted at the 3 'terminal xhoI restriction site of the 3' vector to construct the final second control vector, pGT5 '/ neor r / pGT3' / NLS (Figure 2). When introduced into the cells were cut and linearized with ApaI restriction enzyme.

실시예Example 2. 미니돼지 귀 조직으로부터 체세포의 분리와 배양  2. Isolation and Culture of Somatic Cells from Mini Pig Ear Tissue

생후 10일된 수컷 시카고 미니돼지의 귀를 무균적으로 절제한 뒤 실체현미경하에서 피부와 연골 조직을 매스를 이용하여 제거한 후 조직을 2 x 2 mm 크기의 절편으로 절단하였다. 절단된 조직은 배양액에서 세척한 후 2 ml의 배양액이 있는 6 cm 디쉬에 약 8개 정도의 조직 절편을 넣고 5일간 37℃, 5%, CO2 배양기에서 배양하였다. 5일 후 배양된 세포는 1×106 cells/10cm 디쉬에 계대 배양하였으며 세포가 적당하게 자란 후 이들 세포는 1×106 cells/ml로 동결 보존하여 사용하였으며 제조된 세포는 전형적인 섬유아세포의 형태를 나타내었다. The ear of a 10-day-old male Chicago mini pig was aseptically removed, and then the skin and cartilage tissue were removed using a mass under a stereoscopic microscope, and the tissue was cut into 2 x 2 mm sections. The cleaved tissue was washed in the culture medium, and about 8 tissue sections were placed in a 6 cm dish containing 2 ml of culture solution, and cultured in 37 ° C., 5%, and CO 2 incubator for 5 days. After 5 days, the cultured cells were passaged in 1 × 10 6 cells / 10cm dishes. After the cells were grown properly, these cells were cryopreserved at 1 × 10 6 cells / ml. Indicated.

이때 사용한 배양액은 고농도 글루코오스가 포함된 DMEM(Dulbecco's Modified Eagle's Medium)을 기본으로 15%의 FBS(fetal bovine serum)가 포함된 배지를 이용하였다. 그러나 제조된 귀세포의 계대 배양에는 DMEM을 기본으로 20% FBS, 1×비필수 아미노산, 1×피루브산나트륨, 10-4M 베타-머르캅토에탄올, 100Unit/ml 페니실린 및 100㎍/㎖ 스트렙토마이신이 포함된 배지를 이용하였다(도 3).The culture medium used was a medium containing 15% FBS (fetal bovine serum) based on Dulbecco's Modified Eagle's Medium (DMEM) containing high concentration of glucose. However, sub-culturing of the produced ear cells in DMEM 20% FBS base, 1 × nonessential amino acids, 1 × sodium pyruvate, 10 -4 M beta-mercaptoethanol meoreu, 100Unit / ml penicillin and 100㎍ / ㎖ streptomycin the The included medium was used (FIG. 3).

실시예Example 3. 미니돼지 체세포에 유전자 타겟팅 벡터의 도입 3. Introduction of Gene Targeting Vectors to Mini-Pig Somatic Cells

미니돼지 체세포로의 유전자 타겟팅 벡터의 도입은 전기천공법을 이용하였다. 전기천공법에서는 배양한 세포를 트립신 처리에 의하여 회수한 후, 세포 수가 5×106 cell/0.4 ml F10 배양액이 되도록 현탁한 다음 0.1ml F10 배양액에 녹인 10㎍의 직선화 유전자 타겟팅 벡터를 혼합하여 4 mm 갭 큐벳에 세포 벡터 혼합액을 넣었다. 이 큐벳을 BTX Electro-cell manipulator(ECM 2001)에 장착한 다음 480V, 4 pulses, 2 ms 조건에서 전기 충격을 실시하였다. 전기 충격 후 큐벳을 얼음 위에 10분 간 방치 한 다음 10ml 배양액으로 옮겨 잘 현탁한 다음 10 cm 배양 디쉬로 옮겨 배양하였다. 넉 아웃(knock-out) 벡터는 주로 세포주기 S기에서 상동유전자 재조합에 의하여 삽입되므로 벡터 도입시 세포주기를 S기로 동기화하기 위하여 2 mM 싸이미딘(Thymidine)을 16시간 처리한 세포를 이용하여 벡터 도입을 실시하였다. 도입조건은 GFP 유전자를 이용하여 효율을 검증하였다(도 4). Introduction of gene targeting vectors into mini pig somatic cells was performed using electroporation. In the electroporation method, the cultured cells were recovered by trypsin treatment, suspended in a cell count of 5 × 10 6 cells / 0.4 ml F10, and then mixed with 10 µg linearized gene targeting vector dissolved in 0.1 ml F10 culture. The cell vector mixture was placed in a mm gap cuvette. The cuvette was mounted on a BTX Electro-cell manipulator (ECM 2001) and subjected to electric shock at 480 V, 4 pulses and 2 ms. After the electric shock, the cuvette was left on ice for 10 minutes, transferred to a 10 ml culture, suspended well, and then transferred to a 10 cm culture dish. The knock-out vector is mainly inserted by homologous recombination in the cell cycle S phase, so that the vector is treated with cells treated with 2 mM thymidine for 16 hours to synchronize the cell cycle with the S phase at the time of vector introduction. Introduction was carried out. Introduction conditions were validated using the GFP gene (Fig. 4).

실시예Example 4. 유전자  4. Gene 타겟팅Targeting 벡터가 도입된 클론 체세포의 선별과 배양 Screening and culturing cloned somatic cells

전기천공법을 이용하여 본 발명에서 제작된 3가지 벡터를 미니돼지 체세포에 도입하여 도입 효율을 검증하였다. 본 실시예에서는 유전자 타겟팅 벡터를 세포에 도입한 다음 48시간 후 300㎍/ml의 G418로 12일간 선별하였다. Three vectors prepared in the present invention were introduced into mini-pig somatic cells using the electroporation method to verify the introduction efficiency. In this example, the gene targeting vector was introduced into the cells, and after 48 hours, the cells were selected for 12 days with 300 µg / ml G418.

특히 본 선별 과정 중에는 20% FBS, 1×피루브산나트륨, 1×비필수 아미노산, 10-4M 베타-머르캅토에탄올, 100Unit/ml 페니실린 및 100㎍/㎖ 스트렙토마이신이 포함된 DMEM 배지를 이용하였다. 선별 11일째에 정상적인 형태를 보이는 클론 체세포은 cloning cylinder를 사용하여 각 클론 체세포를 따로 각각 배양하였으며 하루 뒤인 12일째 클론 체세포를 트립신 처리하여 세포를 24-well plate로 계대 하였다. 이렇게 계대된 체세포는 3-4일 후에 90% 컨플루언트 하면 12-웰 플레이트로 계대하였다. 그리고 3-4일 간격으로 6-웰, 60mm 배양 디쉬, 100mm 배양 디쉬로 계대 배양하여 동결보존하거나 실험에 이용하였다. In particular, DMEM medium containing 20% FBS, 1 × sodium pyruvate, 1 × non-essential amino acids, 10 −4 M beta-mercaptoethanol, 100 Unit / ml penicillin and 100 μg / ml streptomycin was used. On the 11th day of selection, cloned somatic cells showing normal morphology were cultured separately using cloning cylinders, and on day 12, the cloned somatic cells were trypsinized and passaged into 24-well plates. This passaged somatic cells were passaged into 12-well plates at 90% confluent after 3-4 days. Subsequent subcultured with 6-well, 60 mm culture dishes and 100 mm culture dishes every 3-4 days, cryopreservation or experiment was used.

본 발명에서 제작한 벡터를 미니돼지 체세포에 도입한 후 넉 아웃된 체세포를 선별한 결과는 본 발명의 유전자 벡터인 DT-A/NLS/ pGT 5'/neor /pGT 3' 벡터에서 8.56%의 유전자 타겟팅 효율을 얻었다. 이와 같은 결과는 핵 국재화 신호가 없는 DT-A/pGT5'/neor/pGT3' 벡터뿐만 아니라, 핵 국재화 신호를 3' 말단 쪽에 삽입시킨 DT-A/pGT5'/neor/pGT3'와 pGT5'/neor/pGT3'/NLS 벡터보다도 더 높은 타겟팅 효율임을 확인할 수 있었다(도 5). The result of screening the knocked out somatic cells after introducing the vector prepared in the present invention into mini pig somatic cells was 8.56% of the gene vector of the present invention, DT-A / NLS / pGT 5 '/ neo r / pGT 3' vector. Gene targeting efficiency was obtained. This result is not only DT-A / pGT5 '/ neo r / pGT3' vector without nuclear localization signal, but also DT-A / pGT5 '/ neo r / pGT3' with nuclear localization signal inserted at 3 'end. It was confirmed that the targeting efficiency is higher than pGT5 '/ neo r / pGT3' / NLS vector (Fig. 5).

실시예Example 5. 미니돼지 알파 1,3- 5. Mini Pig Alpha 1,3- 갈락토실트랜스퍼라아제Galactosyltransferase 유전자가  Gene 타겟팅된Targeted 돼지 체세포의 분석 Analysis of Porcine Somatic Cells

상기 실시예 4로부터 확보된 클론 체세포는 24-well plate에서 12-well plate로 계대할 때 1차 PCR로 유전자 타겟팅되었는지 확인하였으며 100mm 배양 디쉬로 계대 배양한 다음 게놈 DNA을 분리하여 2차 PCR 및 서던 블롯팅을 통해 분석하였다(도 6). The cloned somatic cells obtained in Example 4 were confirmed to be genetically targeted by primary PCR when passaged from a 24-well plate to a 12-well plate, and then passaged with a 100 mm culture dish, followed by secondary PCR and Southern Analysis via blotting (FIG. 6).

1차 PCR분석을 위하여 24-웰 플레이트에서 트립신 처리한 후 1 ml 배양액으로 현탁한 세포혼합액 중 200㎕을 0.5ml 튜브로 옮겼다. 이들 세포는 10000 rpm, 5분 원심하여 세포를 침전시킨 다음 상층액을 버리고 멸균 증류수 40㎕을 넣고 잘 혼합한다음 50㎍/ml proteinase K을 첨가하였다. 이렇게 처리된 세포는 55℃에서 130분간 처리하여 세포를 파괴한 다음 98℃에서 10분간 처리하여 proteinase K를 불활성화시켰다. 이렇게 준비된 세포 파괴액 20㎕, 10 p mole 센스 및 안티센스 프라이머, 1×PCR 버퍼, 2.5mM dNTP, 1.25U Ex 택 폴리머라제를 첨가하여 전체 50㎕의 PCR 반응액을 준비하였다. PCR 반응 조건은 94℃ 30초, 68℃ 30초, 72℃ 2분 30초의 조건에서 38 cycle을 수행하였다. 또한, 이때 사용된 센스 프라이머로는 neo 유전자에 존재하는 TCGTGCTTTACGGTATCGCCGCTCCCGATT(서열번호 5) 배열을 사용하였 고, 안티센스 프라이머로는 3‘ 상동영역의 바깥 쪽에 존재하는 GACACAAATGACCTAAACTGGAACACAAGC(서열번호 6) 배열을 이용하였다. 이렇게 하여 PCR이 완료되면 반응액 중 20㎕을 아가로오스 겔에서 전기영동하여 약 2kb의 밴드가 검출되는지 확인하였다(도 6A). For primary PCR analysis, 200 μl of cell mixture suspended in 1 ml culture following trypsin treatment in 24-well plates was transferred to 0.5 ml tubes. These cells were centrifuged at 10000 rpm for 5 minutes to precipitate the cells, discard the supernatant, add 40 µl of sterile distilled water, mix well, and add 50 µg / ml proteinase K. The treated cells were treated with 130 minutes at 55 ° C. to destroy the cells, and then treated at 98 ° C. for 10 minutes to inactivate proteinase K. 20 μl of the cell disruption solution thus prepared, 10 p mole sense and antisense primer, 1 × PCR buffer, 2.5 mM dNTP, and 1.25 U Ex tack polymerase were added to prepare a total of 50 μl of PCR reaction solution. PCR reaction conditions were performed 38 cycles at the conditions of 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 2 minutes 30 seconds. In addition, the sense primers used were TCGTGCTTTACGGTATCGCCGCTCCCGATT (SEQ ID NO: 5) array, which is present in the neo gene. In this way, when PCR was completed, 20 μl of the reaction solution was electrophoresed on an agarose gel to confirm that a band of about 2 kb was detected (FIG. 6A).

2차 PCR분석은 1차 PCR 분석에서 2kb의 밴드가 검출된 세포만을 계대 배양하여 100mm 배양 디쉬로 계대 배양한 다음 게놈 DNA을 분리하여 실시하였다. PCR 반응액은 20ng 게놈 DNA, 10 p mole 센스 및 안티센스 프라이머, 1×PCR 버퍼, 2.5mM dNTP, 2.5U i-MAXII DNA polymerase을 첨가하여 전체 20㎕가 되도록 준비하였다. PCR 반응 조건은 94℃ 30초, 68℃ 30초, 72℃ 3분 30초의 조건에서 33 cycle을 수행하였다. 또한 이때 사용된 센스 프라이머로는 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 9번 EcoR V 위치의 앞쪽에 존재하는 CATACTTCATGGTTGGCCACAAAGTC(서열번호 7)을 이용하였으며 안티센스 프라이머는 1차 PCR 분석에 이용한 안티센스 프라이머와 동일한 프라이머를 사용하였다. 이렇게 하여 PCR이 완료되면 반응액 중 5㎕을 아가로오스 겔에서 전기영동하여 약 3.4kb의 유전자 타겟팅된 밴드와 약 2.1kb의 정상 밴드가 검출되는지 확인하였다(도 6B). Secondary PCR analysis was performed by subcultured only cells where 2 kb of band was detected in the first PCR analysis, passaged with 100 mm culture dishes, and genomic DNA was isolated. PCR reaction solution was prepared by adding 20ng genomic DNA, 10 p mole sense and antisense primer, 1 × PCR buffer, 2.5mM dNTP, 2.5U i-MAXII DNA polymerase to make a total of 20µl. PCR reaction conditions were 33 cycles at 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 3 minutes 30 seconds conditions. In addition, the sense primers used were CATACTTCATGGTTGGCCACAAAGTC (SEQ ID NO: 7) located in front of the exon 9 EcoR V position of the alpha 1,3-galactosyltransferase gene, and the antisense primers were used for the first PCR analysis. The same primers as the antisense primers were used. In this way, when PCR was completed, 5 μl of the reaction solution was electrophoresed on an agarose gel to confirm that a gene targeted band of about 3.4 kb and a normal band of about 2.1 kb were detected (FIG. 6B).

서던 블롯(Southern blotting)은 20㎍의 게놈 DNA를 EcoR V 또는 BstE II 제한효소로 절단하고 0.8% agarose gel에서 전기영동 zeta-probe membrane으로 DNA을 전사시켰다. 멤브레인은 5×SSPE, 5×Denhardt's, 1% SDS(w/v), 50% fromamide(w/v)을 포함하는 용액에서 42℃, 16시간 혼성화(hybridization)를 실시하였다. 프로브는 엑손 8 부분을 포함하는 약 0.5kb 및 neo 유전자 약 0.6kb DNA단편을 random labelling kit(Amersharm 사)와 [α-32P]dCTP(110TBq/mmol, Amersham 사)를 이용하여 제조하였다. 멤브레인은 혼성화 후, 0.2%SSC, 0.1%SDS(w/v)에서 68℃, 30분, 3회 세척한 다음 방사능 사진촬영(autoradiography)을 실시하였다(도 6C).Southern blotting digested 20 μg of genomic DNA with EcoR V or BstE II restriction enzymes and transcribed the DNA with an electrophoretic zeta-probe membrane on a 0.8% agarose gel. The membrane was hybridized at 42 ° C. for 16 hours in a solution containing 5 × SSPE, 5 × Denhardt's, 1% SDS (w / v), and 50% fromamide (w / v). Probes were prepared using a random labeling kit (Amersharm) and [α- 32 P] dCTP (110 TBq / mmol, Amersham) of about 0.5 kb and about 0.6 kb of DNA containing the exon 8 moiety. After hybridization, the membrane was washed three times at 68 ° C. for 30 minutes at 0.2% SSC and 0.1% SDS (w / v), followed by autoradiography (FIG. 6C).

상기 분석 방법에 의해 확인된 본 발명의 DT-A/NLS/pGT5'/neor/pGT3' 벡터가 타겟팅된 돼지의 체세포주를 GTKO 21 이라고 명명하였고, KCTC(Korean Collection for Type Cultures, 대한민국 대전 유성구 과학로 111번지 한국생명공학연구원)에 2008 년 7월 24일자로 기탁번호 제KCTC 11369BP호로 기탁하였다.The somatic cell line of pigs targeted to the DT-A / NLS / pGT5 '/ neo r / pGT3' vector of the present invention identified by the above analysis method was named GTKO 21, and KCTC (Korean Collection for Type Cultures, Yuseong-gu, Daejeon, Korea) It was deposited with KCTC 11369BP on July 24, 2008, at the Korea Research Institute of Bioscience and Biotechnology.

본 발명의 타겟팅 효율이 증진된 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터는 이종이식시 급속한 면역거부반응을 일으키는 원인 유전자인 알파 1,3-갈락토실트랜스퍼라아제의 활성을 효과적으로 제거시킬 수 있어, 장기이식시 면역반응을 최소화할 수 있다. Porcine alpha 1,3-galactosyltransferase gene targeting vector having enhanced targeting efficiency according to the present invention can inhibit the activity of alpha 1,3-galactosyltransferase, a gene which causes rapid immunorejection reaction in xenotransplantation. Can be effectively removed, minimizing the immune response during organ transplantation.

또한, 본 발명의 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터는 면역거부반응이 억제된 복제 미니어쳐 돼지의 생산뿐만 아니라, 이종 간의 장기 이식분야에 유용하게 이용될 수 있다.In addition, the pig alpha 1,3-galactosyltransferase gene targeting vector of the present invention can be usefully used in the field of organ transplantation as well as in the production of cloned miniature pigs with suppressed immune rejection.

도 1은 본 발명에 따른 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터의 개락도이다. 1 is a schematic diagram of a mini pig alpha 1,3-galactosyltransferase gene targeting vector according to the present invention.

도 2는 본 발명에 기재된 미니돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터 3종류의 모식도이다. 2 is a schematic diagram of three types of mini-pig alpha 1,3-galactosyltransferase gene targeting vectors described in the present invention.

도 3은 본 발명에서 사용한 미니어처 돼지 체세포 준비 및 배양 사진이다. Figure 3 is a miniature pig somatic cell preparation and culture photograph used in the present invention.

도 4는 본 발명에서 미니돼지 체세포로의 유전자 도입 효율을 확인하기 위하여 GFP 유전자로 검증한 사진이다. Figure 4 is a photograph verified with the GFP gene in order to confirm the efficiency of gene introduction into somatic cells mini pigs in the present invention.

도 5는 본 발명의 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터와 대조군 벡터를 미니돼지 체세포에 도입하고 넉 아웃된 미니돼지 체세포를 동정한 결과를 비교 정리한 표이다. 5 is a table comparing and comparing the results obtained by introducing the alpha 1,3-galactosyltransferase gene targeting vector and the control vector of the present invention into mini-pig somatic cells and knocking out mini-pig somatic cells.

도 6은 본 발명의 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터를 미니돼지 체세포에 도입한 후, 넉 아웃된 미니돼지 체세포를 확인한 PCR 사진과 서던블롯 분석 결과의 사진이다. 6 is a PCR photograph and a Southern blot analysis result confirming knocked out mini pig somatic cells after introducing the alpha 1,3-galactosyltransferase gene targeting vector of the present invention into mini pig somatic cells.

<110> Korea Research Institute of Bioscience and Biotechnology <120> alpha 1,3-galactosyltransferase gene targeting vector and uses thereof <130> PA080043/KR <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> sense primer for amplifying alpha 1,3-galactosyltransferase gene <400> 1 aggtcgtgac cataaccaga tggaaggctc 30 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for amplifying alpha 1,3-galactosyltransferase gene <400> 2 cttgcaccat gaaaggtctc tgcaactcca gaa 33 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer for amplifying nls gene <400> 3 cggagttagg ggcgggacta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for amplifying nls gene <400> 4 ccagctgtgg aatgtgtgtc 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> sense primer for identifying gene targeting <400> 5 tcgtgcttta cggtatcgcc gctcccgatt 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for identifying gene targeting <400> 6 gacacaaatg acctaaactg gaacacaagc 30 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> sense primer for identifying gene targeting <400> 7 catacttcat ggttggccac aaagtc 26 <110> Korea Research Institute of Bioscience and Biotechnology <120> alpha 1,3-galactosyltransferase gene targeting vector and uses          the <130> PA080043 / KR <160> 7 <170> KopatentIn 1.71 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> sense primer for amplifying alpha 1,3-galactosyltransferase gene <400> 1 aggtcgtgac cataaccaga tggaaggctc 30 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for amplifying alpha 1,3-galactosyltransferase          gene <400> 2 cttgcaccat gaaaggtctc tgcaactcca gaa 33 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer for amplifying nls gene <400> 3 cggagttagg ggcgggacta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for amplifying nls gene <400> 4 ccagctgtgg aatgtgtgtc 20 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> sense primer for identifying gene targeting <400> 5 tcgtgcttta cggtatcgcc gctcccgatt 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for identifying gene targeting <400> 6 gacacaaatg acctaaactg gaacacaagc 30 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> sense primer for identifying gene targeting <400> 7 catacttcat ggttggccac aaagtc 26  

Claims (10)

(1) 핵 국재화 신호(nuclear localization signal, NLS) 영역; (2) 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 4 내지 6 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 5' 말단 쪽 인트론 8의 제한효소 SmaI 인식부위부터 3' 말단 쪽 엑손 9의 제한효소 EcoRV 인식부위까지를 포함하는 제1영역; (3) 양성 선별마커 영역; (4) 돼지의 알파 1,3-갈락토실트랜스퍼라아제 핵산 서열에 상동인 0.5 내지 2 kb 길이의 핵산 서열로서 돼지의 알파 1,3-갈락토실트랜스퍼라아제 유전자의 엑손 9의 5' 말단 쪽 제한효소 EcoRV 인식부위부터 엑손 9의 3' 말단 쪽 제한효소 PstI 인식부위까지를 포함하는 제2영역; 및 (5) 음성 선별마커 영역을 가지며, 상기 (1) 내지 (5) 영역들이 5' 말단에서부터 순서대로 구성되는 것을 특징으로 하는 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터.(1) a nuclear localization signal (NLS) region; (2) a 5 'terminal intron of the swine alpha 1,3-galactosyltransferase gene as a 4-6 kb long nucleic acid sequence homologous to the swine alpha 1,3-galactosyltransferase nucleic acid sequence A first region comprising a restriction enzyme SmaI recognition site of 8 to a restriction enzyme EcoRV recognition site of exon 9 at the 3 'end; (3) positive selection marker regions; (4) 5 ′ of the exon 9 of the pig alpha 1,3-galactosyltransferase gene as a nucleic acid sequence 0.5 to 2 kb long that is homologous to the pig alpha 1,3-galactosyltransferase nucleic acid sequence A second region comprising a terminal restriction enzyme EcoRV recognition region to a 3 'terminal restriction enzyme PstI recognition region of exon 9; And (5) a negative selection marker region, wherein the (1) to (5) regions are configured in order from the 5 ′ end. 5. The alpha 1,3-galactosyltransferase gene targeting vector. 제1항에 있어서, 제1영역이 4.8kb의 길이를 가지고, 제2영역이 1.9kb의 길이를 가지는 것을 특징으로 하는 벡터.The vector of claim 1, wherein the first region has a length of 4.8 kb and the second region has a length of 1.9 kb. 제1항에 있어서, 상기 양성 선별마커가 네오마이신 (Neomycin: Neo), 하이그로마이신 (hygromycin: Hyg), 히스티디놀 디하이드로게나제(histidinol dehydrogenase gene: hisD) 및 구아닌 포스포리보실트랜스퍼라제 (guanine phosphosribosyltransferase: Gpt)로 이루어지는 군으로부터 선택되는 것을 특징으로 하는 벡터.The method of claim 1, wherein the positive selection marker is Neomycin (Neoomycin: Neo), hygromycin (Hyg), histidinol dehydrogenase gene (hiD) and guanine phosphoribosyltransferase ( guanine phosphosribosyltransferase (Gpt). 제1항에 있어서, 상기 돼지는 미니돼지인 것을 특징으로 하는 벡터.The vector of claim 1, wherein the pig is a mini pig. 제1항에 있어서, 상기 음성 선별마커가 디프테리아 톡신 (Diphtheria toxin), 헤르페스 심플렉스 바이러스-싸이미딘 키나제 (Herpes simplex virus-thymidine kinase: HSV-tk), 하이포잔틴 포스포리보실 트랜스퍼라아제 (hypoxanthine phosphoribosyl transferase: Hprt) 및 사이토신 디아미네즈 (cytosine deaminase)로 이루어진 군으로부터 선택되는 것을 특징으로 하는 벡터.The method of claim 1, wherein the negative selection marker is Diphtheria toxin, Herpes simplex virus-thymidine kinase (HSV-tk), hypoxanthine phosphoribosyl transferase (hypoxanthine phosphoribosyl) transferase: Hprt) and a vector characterized in that it is selected from the group consisting of cytosine deaminase. 제1항에 있어서, 상기 벡터는 도 2에 개시된 DT-A/NLS/pGT'5/neor/pGT3'인 벡터.The vector of claim 1, wherein the vector is DT-A / NLS / pGT'5 / neo r / pGT3 'disclosed in FIG. 2. 제1항의 벡터로 유전자 타겟팅된 세포.Cells genetically targeted with the vector of claim 1. 제1항의 벡터가 도입되어 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 돼지.A transgenic pig, wherein the vector of claim 1 is introduced to knock out the alpha 1,3-galactosyltransferase gene. (1)제1항의 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자 타겟팅 벡터를 구축하는 단계; (2)돼지로부터 체세포를 분리 및 배양하는 단계; (3)구축된 단계(1)의 벡터를 상기 단계(2)에서 분리한 체세포에 도입하여 상동재조합을 유도하는 단계; 및 (4)상동재조합에 의해 돼지 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 선별하는 단계를 포함하는, 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 제조하는 방법.(1) constructing the pig alpha 1,3-galactosyltransferase gene targeting vector of claim 1; (2) separating and culturing somatic cells from pigs; (3) introducing the vector of the constructed step (1) into the somatic cells isolated in the step (2) to induce homologous recombination; And (4) selecting the somatic cells of the pigs to which the pig alpha 1,3-galactosyltransferase gene is targeted by homologous recombination, wherein the alpha 1,3-galactosyltransferase gene is targeted. How to make somatic cells of pigs. (1)제9항의 방법에 의하여 알파 1,3-갈락토실트랜스퍼라아제 유전자가 타겟팅된 돼지의 체세포를 수득하는 단계; (2)돼지 난자의 핵을 제거하고 상기 유전자 타겟팅된 세포를 도입하여 체세포 핵이식된 수정란을 제조하는 단계; 및 (3)상기 수정란을 착상시키는 단계를 포함하는, 알파 1,3-갈락토실트랜스퍼라아제 유전자가 넉 아웃된 형질전환 돼지를 제조하는 방법.(1) obtaining somatic cells of pigs targeted to the alpha 1,3-galactosyltransferase gene by the method of claim 9; (2) removing the nucleus of the pig egg and introducing the gene-targeted cell to produce a somatic cell nuclear transfer embryo; And (3) implanting the fertilized egg, wherein the method of producing a transgenic pig knocked out of the alpha 1,3-galactosyltransferase gene.
KR1020080074825A 2008-07-30 2008-07-30 alpha 1,3-galactosyltransferase gene targeting vector and uses thereof KR101068479B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020080074825A KR101068479B1 (en) 2008-07-30 2008-07-30 alpha 1,3-galactosyltransferase gene targeting vector and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020080074825A KR101068479B1 (en) 2008-07-30 2008-07-30 alpha 1,3-galactosyltransferase gene targeting vector and uses thereof

Publications (2)

Publication Number Publication Date
KR20100013227A KR20100013227A (en) 2010-02-09
KR101068479B1 true KR101068479B1 (en) 2011-09-29

Family

ID=42087291

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020080074825A KR101068479B1 (en) 2008-07-30 2008-07-30 alpha 1,3-galactosyltransferase gene targeting vector and uses thereof

Country Status (1)

Country Link
KR (1) KR101068479B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101048426B1 (en) * 2009-05-27 2011-07-11 한국생명공학연구원 Method for producing somatic cells obtained by adding the DAF gene to the position of the alpha 1,3-galactosyltransferase gene
KR101236724B1 (en) * 2010-11-23 2013-02-26 대한민국 Gene targeting knock-in vector containing overexpression cassette, the method for constructing the same and transgenic cloned animal carrying the vector for xenotransplantation
KR101435635B1 (en) * 2012-09-27 2014-08-29 전남대학교산학협력단 Knock-in vector and process for preparing transgenic animal for transplantation employing the same

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030014770A1 (en) 1994-04-13 2003-01-16 The General Hospital Corporation Alpha (1,3) galactosyl transferase negative swine
US6929909B2 (en) 2000-09-15 2005-08-16 Deltagen, Inc. Gene targeting vectors comprising conditional positive selection markers
US20070074297A1 (en) 2005-09-06 2007-03-29 Marius Hoener TAAR1 knock out animal
US7201899B2 (en) 1994-01-27 2007-04-10 Bresagen Limited Materials and methods for management of hyperacute rejection in human xenotransplantation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7201899B2 (en) 1994-01-27 2007-04-10 Bresagen Limited Materials and methods for management of hyperacute rejection in human xenotransplantation
US20030014770A1 (en) 1994-04-13 2003-01-16 The General Hospital Corporation Alpha (1,3) galactosyl transferase negative swine
US6929909B2 (en) 2000-09-15 2005-08-16 Deltagen, Inc. Gene targeting vectors comprising conditional positive selection markers
US20070074297A1 (en) 2005-09-06 2007-03-29 Marius Hoener TAAR1 knock out animal

Also Published As

Publication number Publication date
KR20100013227A (en) 2010-02-09

Similar Documents

Publication Publication Date Title
CN107988256B (en) Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig
AU2018203515B2 (en) Targeted genome editing in zygotes of domestic large animals
Yao et al. Tild-CRISPR allows for efficient and precise gene knockin in mouse and human cells
JP2021121220A (en) Genetically modified non-human mammals by multi-cycle electroporation of cas9 protein
US20200029538A1 (en) Genome editing method
KR101149475B1 (en) Genetically-modified cell line for producing cloned miniature pigs for xenotransplantation and method for preparing the same
JP2018531003A6 (en) Genetically modified animals with improved heat resistance
JP2018531003A (en) Genetically modified animals with improved heat resistance
JP2001513336A (en) Use of &#34;marina&#34; transposans in the production of transgenic animals
KR101068479B1 (en) alpha 1,3-galactosyltransferase gene targeting vector and uses thereof
WO2018126095A1 (en) Transgenic animals and method for bioproduction
KR101435635B1 (en) Knock-in vector and process for preparing transgenic animal for transplantation employing the same
Mao et al. CRISPR/Cas9‐mediated efficient and precise targeted integration of donor DNA harboring double cleavage sites in Xenopus tropicalis
CN104726495B (en) A kind of gene targeting based on TALEN mediations knocks out the carrier and recombinant cell of goat BLG
JP6267785B2 (en) CMP-acetylneuraminic acid hydroxylase targeting vector, transgenic animal for xenotransplantation into which the vector is introduced, and method for producing the same
KR101048426B1 (en) Method for producing somatic cells obtained by adding the DAF gene to the position of the alpha 1,3-galactosyltransferase gene
KR101479671B1 (en) CMP-N-acetylneuraminic acid hydroxylase targeting vector and use of the same
JP4903392B2 (en) Gene homo-modified mammalian cells, gene homo-modified non-human mammals, and methods for establishing and producing them.
KR101590247B1 (en) A method for preparing a Sal-like 1 gene knock-out cell using porcine Sal-like 1 gene targeting vector and TALEN targeting Sal-like 1 gene
KR101178946B1 (en) alpha 1,3-galactosyltransferase gene targeting vector
CN117586383A (en) Method for specifically improving lactoferrin gene expression quantity and application thereof
CN116179543A (en) CRISPR-specific targeting pig Cavin-1 gene-based sgRNA and application thereof
CN116769774A (en) UTY gene-targeted sgRNA, sheep fibroblast line integrating exogenous gene by utilizing same and application of UTY gene-targeted sgRNA
CN116478990A (en) Construction and application of sgRNA of targeting ZFX gene and sheep fibroblast line integrating exogenous gene by using sgRNA
KR101141733B1 (en) Transgenic cloned cow carrying a knock-out prion-encoding gene and method for producing the same

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20150915

Year of fee payment: 5

LAPS Lapse due to unpaid annual fee