KR101479671B1 - CMP-N-acetylneuraminic acid hydroxylase targeting vector and use of the same - Google Patents

Abstract

The present invention relates to CMP-acetylneuraminic acid hydratase targeting vectors and their applications.

Description

CMP-acetylneuraminic acid hydroxylase targeting vector and its application {CMP-N-acetylneuraminic acid hydroxylase targeting vector and use of the same}

The present invention relates to CMP-acetylneuraminic acid hydratase targeting vectors and their applications.

According to the National Organ Transplant Center, about 20,000 patients a year are waiting for organ transplants in Korea, but the number of donations is reported to be less than 10% of demand. In addition, in the United States, waiting people who need a long term are added every 16 minutes, but 11 of the waiting people die per day without surgery. Along with this situation, the development of life sciences technology is the background of development of heterologous transplantation technology.

Steady advances in animal genetics have enabled the production of commercially useful transgenic animals with the identification of the role of each gene by removing or inserting specific genes. Methods for producing transformed animals include random genetic manipulation using microinjection or viral infection, and embryonic stem cells or somatic cells. There is a gene targeting method that can be targeted.

Microinjection has been widely used to produce transgenic animals in a classical way of inserting foreign DNA into the nucleus of embryos (Harbers et al., Nature, 293 (5833): 540-2, 1981; Hammer et al. , Nature, 315 (6021): 680-683, 1985; van Berkel et al., Nat Biotechnol., 20 (5): 484-487, 2002; Damak et al., Biotechnology (NY) : 185-186, 1996). However, the production rate of fertilized egg-derived transformants with foreign DNA inserted by microinjection is very low to 2 to 3% (Clark et al., Transgenic Res., 9: 263-275, 2000) It is impossible to control the insertion position of a gene and to remove a specific internal gene.

Virus infections are also widely used for genetic manipulation of animals (Soriano et al., Genes Dev., 1 (4): 366-375, 1987; Hirata et al., Cloning Stem Cells, 6 (1) 36, 2004). The virus infection method is more efficient than the microinjection method because the gene to be inserted is introduced as an animal gene through a viral vector, but it is still impossible to insert a foreign gene into a specific position and to remove a specific internal gene. In addition, the maximum size of the gene to be inserted is limited to 7 kb, and the gene derived from the virus and the expressed protein are a problem (Wei et al., Annu. Rev. Pharmacol., Toxicol., 37: 119-141 Yanez et al., Gene Ther., 5 (2): 149-159, 1998).

In order to overcome the above-mentioned problems, a gene targeting technique capable of removing or inserting a specific gene can be used. Gene targeting technology was first used in gene function studies using mouse embryonic stem cells. By using homologous recombination, mouse embryonic stem cells that have been targeted to specific genes are inserted into the embryo at the blastocyst stage, and eventually production of a specific gene becomes possible. A number of specific gene targeted mice have been produced using these gene targeting methods in mouse embryonic stem cells (Brandon et al., Curr. Biol., 5 (6): 625-634, 1995; Capecchi et al. , Science, 244 (4910): 1288-1292, 1989; Thompson et al., Cell 56 (2): 313-321, 1989; Hamanaka et al., Hum. Genet., 9 (3): 353 Cells, 51 (3): 503-512, 1987; te Riele et al., Proc. Natl Acad Sci USA, 89 (11): 5182-5132, 1992; Mansour et al., Nature, 336 (6197): 348-352, 1988; Luo et al., Oncogene, 20 (3): 320-328, 2001). When gene targeting methods are applied to livestock, animal bioreactors that produce large quantities of therapeutic proteins, or diseases that can be used for xenogeneic organ transplantation by overexpression at specific sites, Model animal production is possible, which is expected to bring great economic benefits to the industry.

In order to produce genetically-targeted animals, the use of embryonic stem cells has been considered an essential element. However, the use of embryonic stem cells in livestock has been limited so far, despite reports of embryonic stem cell-like cell lines in pigs and cattle-containing livestock (Doetschman et al., Dev. Biol., 127 (1): 224 Iannaccone < / RTI > et al., Biol. Reprod., 54 (1): 100-110, 1996; Sukoyan et al., Mol. Reprod. Dev., 36 (2): 148-158, Development, 122 (8): 2339-2348, 1996; Thomson et al., Proc. Natl. Acad. Sci. USA, 92 (17): 7844-7848, 1995; Wheeler et al., Reprod. Fertil. Dev., 6 (5): 563-568, 1994). Instead, transgenic cloned livestock production has become possible, suggesting the possibility that common somatic cells can be used for gene targeting as nuclear donor cells (Brophy et al., Nat. Biotechnol., 21 (2): 157-162 Nature, 380 (6569): 64-66, 1996; Akira Onishi et al., Science, 289: 1188; Cloning Stem Cells, 3 (4): 221-231, 2001; McCreath et al., Nature, 405 (6790): 1066-1069, 2000).

On the other hand, mini - pigs which are similar in size and physiological characteristics to organs and capable of large - scale supply of organs due to fertility are considered as the best sources of heterologous organ transplantation.

Successful transplantation of pig organs relies on overcoming a series of immune rejection responses (super acute, acute vascular, cell mediated, and chronic immune rejection). It has been reported that a super acute immune rejection reaction occurring within a few minutes after transplantation can be overcome by eliminating a gene involved in the synthesis of alpha-1, 3-galactosyltransferase and overexpressing a human complement regulatory gene.

Specifically, in 2002, the world's first alpha-1,3-galactosyltransferase (hereinafter abbreviated as 'GT') gene was heterozygous ) Were produced (Yifan Dai et al., Nat. Biotechnology, 20: 251-255, 2002). The GT gene is a gene that causes a rapid immune rejection reaction during xenogeneic transplantation. When this gene is removed, it is possible to develop a model animal of interspecies organisms in which the vivo immune rejection has been partially resolved.

In 2003, the GT gene was homozygously removed from the company in 2003, and succeeded in cloning somatic cells to solve the current long-term shortage. (Carol J. Phelps, Science, 299: 411-414, 2003). In 2005, organs from cloned pig-derived pigs were transplanted into monkeys, and as a result, survival was delayed until 2-6 months after transplant without acute immune rejection (Kenji Kuwaki et al., Nature Medicine, 11 ): 29-31, 2005). However, despite the GT gene deletion, it has been reported that human complement genes are activated by heterologous antigens through different pathways, resulting in serious rejection of organ transplantation (Tanemura, M. et al., Biochem. Biophys. Res. Commun., 235: 359-364, 1997; Komoda, H. et al., Xenotransplantation, 11: 237-246, 2004). In order to overcome such a disadvantage, it is known that a decay-accerating factor (hereinafter abbreviated as DAF), a membrane co-factor protein (abbreviated as 'MCP' hereinafter) ), A method of producing a replicating pig that overexpresses human complement inhibitory genes such as CD59 has been used (Yoichi Takahagi, Molecular Reproduction and Development 71: 331-338, 2005 Cozzi, Eb et al., Transplant Proc. Adams, DH et al., Xenotransplantation, 8: 36-40, 2001).

On the other hand, N-glycolylneuraminic acid (hereinafter abbreviated as " Neu5Gc ") antigenic determinant present in most mammals except humans has also been reported to cause immune rejection upon heterologous transplantation Pam Tangvoranuntakul, Proc. Natl. Acad. Soc. USA 100: 12045-12050, 2003; Barbara Bighignoli, BMC genetics, 8: 27, 2007). Neu5Gc is a cytidine monophospho-N-acetylneuraminic acid hydroxylase (hereinafter referred to as " CMAH ") which is produced by N-acetylneuraminic acid Hereinafter abbreviated as " Neu5Ac ").

The complement is a protein complex (C1-C9) composed of proteins related to the immune function in vivo. When the antigen-antibody complex is formed, the complement binds to the cell membrane of the bacterium, (Opsonization), which promotes phagocytosis. Several regulatory proteins have been found that can regulate the activity of these complements and control the complement action by either blocking activation of the complement or promoting degradation of the activated complement. DAF in the host cell membrane may interfere with the binding of C2 and C4b, and MCP may promote degradation of C4b to prevent activation of the complement in the host cell, thereby preventing host cell destruction by complement. CD59 on the host cell surface can interfere with the binding of C7, C8 and C5b6, thus preventing the formation of membrane attack complexes.

In addition to the complement function regulatory genes, it has been reported that over-expression of the human CD39 gene inhibits thrombosis resulting from heterologous transplantation (US20080003212A, Karren, MD, The Journal of Clinical Investigation, 113: 1440-1446, 2004) .

Previous reports have shown that out-of-place expression of foreign genes causes obstacles to development and is fatal to the nervous system, which develops largely during the late embryonic development and early postnatal development (Gao et al., Neurochem. Res. , 24 (9): 1181-1188, 1999).

Korean Patent Publication No. 1020090104328 discloses a CD70-expressing neural stem cell capable of inhibiting the transplantation immune response and its use, and relates to the use of the CD70-expressing neural stem cell for the transplantation of organs, tissues or cells, including neural stem cells expressing CD70 A composition for inhibiting an immune response, and a method for suppressing an immune response of an individual using the composition.

Korean Patent Publication No. 1020010034847 discloses a binding molecule derived from an immunoglobulin that does not cause complement-mediated degradation, and includes (i) a binding domain capable of binding to a target molecule, and Binding molecules that are recombinant polypeptides comprising an effector domain having an amino acid sequence that is substantially homologous to all or part of the constant domain of the human immunoglobulin heavy chain; Characterized in that the binding molecule can bind to the target molecule without severe complement-dependent degradation or cell-mediated destruction of the target, more preferably the effector domain is capable of specifically binding to FcRn and / or Fc [gamma] RIIb ≪ / RTI > are disclosed. In general, the binding molecules are based on chimeric domains derived from two or more human immunoglobulin heavy chain CH2 domains. In a preferred embodiment, regions 233-236 and regions 327-331 have been modified, and further residues make the molecule null allotypic. The binding domain may be derived from any source suitable for (generally clinically) application to the molecule, for example, an antibody; enzyme; hormone; Receptor; Cytokines or antigens; Ligands; And adhesive molecules. In addition, nucleic acids, host cells, production processes and materials are disclosed, including, for example, B cell activation; Breast cell degranulation; There is disclosed a use for interfering with a pharmacological effect or for preventing a second binding molecule from binding to a target molecule

The present invention has been made in view of the above needs, and an object of the present invention is to provide a vector knocking out the heterologous antigenic determinant gene (CMAH).

Another object of the present invention is to provide a transgenic somatic cell using a vector with high efficiency and accuracy as compared with a conventional targeting vector.

It is another object of the present invention to provide a non-human cloned animal produced through nuclear transfer of the transgenic somatic cell.

It is still another object of the present invention to provide a method for producing a heterologous organ for grafting, which comprises removing the immune rejection reaction after raising the non-human cloned animal and extracting organs.

In order to accomplish the above object, the present invention provides a method of treating cancer, comprising sequentially administering CMP-acetylneuraminic acid hydroxylase 5 'arm, PGKneopolyA and CMP-acetylneuraminic acid hydroxylase 3' arm CMP-acetylneuraminic acid hydroxylase targeting vector.

In one embodiment of the present invention, the CMP-acetylneuraminic acid hydroxylase 5 'arm preferably has the nucleotide sequence shown in SEQ ID NO: 1, but is not limited thereto.

In another embodiment of the present invention, the PGKneopolyA preferably has the nucleotide sequence set forth in SEQ ID NO: 2, but is not limited thereto (PGK means 'Phosphoglycerate Kinase').

In another embodiment of the present invention, the CMP-acetylneuraminic acid hydroxylase 3 'arm preferably has the nucleotide sequence shown in SEQ ID NO: 3, but is not limited thereto.

In another embodiment of the present invention, the CMP-acetylneuraminic acid hydroxylase targeting vector has a cleavage map as shown in FIG. 4, but is not limited thereto.

In addition, the present invention relates to a method for producing CMP-acetyllauraminic acid hydrolase knockout vector comprising the step of transfecting the above-mentioned CMP-acetylneuraminic acid hydroxylase targeting vector of the present invention and a zinc- Lt; / RTI > cells.

In one embodiment of the present invention, the zinc-finger nucrease vector preferably has the cleavage map as shown in FIG. 1, but is not limited thereto.

The present invention also provides CMP-acetylnulaminic acid hydroxylase knockout cells produced by the method of the present invention.

The present invention also provides a method for producing an animal other than a human by nuclear transfer of the CMP-acetyllaurinic acid hydroxylase knockout cell.

The present invention also provides a method for producing a heterologous transplant for organ transplantation, wherein the immunological rejection reaction is eliminated by cultivating a cloned animal produced by the above method and then removing the organs.

The term "gene targeting vector" in the present invention refers to a vector capable of removing or inserting a desired gene at a specific gene position of a genome, and includes a specific gene to be targeted for homologous recombination Lt; / RTI > sequence.

The term "homologous " in the present invention indicates the degree of identity between the first region or the second region and the nucleic acid sequence of the corresponding gene, and is at least 90% identical, preferably at least 95% identical.

The term "antigenic determinant" of the present invention refers to a site recognized as an antigen by the immune system of the receptor upon transplantation of a dissimilar organs. N-glycolylneuraminic acid (hereinafter referred to as 'Neu5Gc' (Hereinafter abbreviated as " CMAH ") which is involved in the biosynthesis of Neu5Gc and which encodes an enzyme that biosyntheses the antigenic determinant. ).

The term "selection marker " in the present invention is used to select a cell transformed with a gene targeting vector into a cell, and is selected from the group consisting of drug resistance, nutritional requirement, tolerance to cytotoxic agents, Markers are used to give a possible phenotype, and in the environment in which the selective agent has been treated, only a cell expressing the specific marker is allowed to survive, thereby allowing a positive selection. The "selectable marker gene" Neomycin phosphotransferase (hereinafter abbreviated as " neo ") refers to a gene encoding a selectable marker. For example, neomycin phosphotransferase (hereinafter abbreviated as " neo ") is an antibiotic resistant gene that allows eukaryotic cells to survive in a medium containing an antibiotic neomycin To select stable transfected cells in eukaryotic cells.

"Transfection" means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosome integration completion. Transformation includes any method of introducing a nucleic acid molecule into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell as is known in the art. Transformation of eukaryotic cells by plasmid or naked DNA is sometimes referred to as 'transfection' in order to distinguish it from transformation as a means of tumorigenization of the cells. Is used.

In the present invention, 'Zinc-finger nucleases (ZFNs)' are artificial restriction enzymes produced by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. A zinc finger domain can be engineered to target desired DNA sequences, which targets zinc finger nucleases to unique sequences within the complex genome. Using endogenous DNA repair mechanisms, these materials can be used to accurately alter the genome of higher life.

In the present invention, for example, a nonspecific cleavage domain derived from the Type II restriction enzyme Fokl is typically used as a cleavage domain in ZFNs. The cleavage domain must be dimerized to cleave the DNA And thus a pair of ZFNs is required to target non-palindromic DNA sites. Standard ZFNs fuse the cleavage domain to the C-terminus of each zinc finger domain. To dimerize the two cleavage domains and cleave the DNA, the two individual ZFNs must bind to the DNA of the opposite strand at a limited distance from their C-terminus. The most commonly used linker sequence between the zinc finger domain and the cleavage domain needs to fall from 5 to 7 bp from the 5 'edge of each binding site.

Several other protein engineering techniques have been employed to improve the activity and specificity of the nuclease domains used in ZFNs. Directed evolution is employed to produce FokI mutants with increased cleavage activity. Only structural modifications are needed to modify the dimerized contact surface to activate FokI cleavage specificity, so that only the intended heterodimer species is activated. .

The DNA-binding domain of each ZFNs typically has between 3 and 6 zinc finger repeats, each of which can recognize between 9 and 18 basepairs. If the zinc finger domains are perfectly specific to their intended target site, even a pair of 3-finger ZNFs capable of recognizing a total of 18 basepairs can theoretically target a single locus in the mammalian genome.

Several strategies have been developed to manipulate Cys2His2 zinc fingers to bind to the desired sequence, including both phage display or "modular assembly" adopting cellular selection systems and selection strategies.

The simplest way to create a new zinc finger array is to combine small zinc finger "modules" of known specificity. The most common modular assembly procedure involves combining three separate zinc fingers that can recognize each 3-bp DNA sequence to produce a three-finger array capable of recognizing a 9 basepair target site. Another method is to use a 1-finger or 2-finger module to fabricate a zinc finger array with six or more individual zinc fingers.

Several selection methods are used to generate a zinc finger array that can target the desired sequence. Early selection attempts have used phage display to select proteins that combine a given DNA target from a pool of randomized zinc finger arrays of many pools. More recent attempts utilize yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. A more promising new method of selecting a new zinc finger array is to use a bacterial two-hybrid system and is named "OPEN." This system combines each zinc finger of a preselected pool selected to be coupled to a given triplet, The selection of the second round is used to obtain a 3-finger array that can bind to the bp sequence. This system was developed by the Zinc-Finger Consortium as an alternative to a commercial source of manipulated zinc finger arrays.

Hereinafter, the present invention will be described.

The present inventors succeeded in preparing a somatic cell with a G418 (Neo) gene inserted therein so that a CMAH gene knockout somatic cell can be efficiently selected while eliminating a CMAH gene involved in the synthesis of a Neu5Gc antigenic determinant.

The targeting vector and the transformed cell line produced by the present invention can be efficiently used for the production of edible cloned pigs by efficiently controlling the expression of genes involved in the immune rejection reaction.

The vector used in the present invention is a new technology for producing Zinc Finger Protein capable of recognizing the sequence of a deterministic gene in somatic cells and Fox1 protein having Nuclease function for eliminating the gene in the determinant.

The vector used in the present invention is a vector with high efficiency and accuracy as compared with a conventional targeting vector.

The CMAH gene targeted to the vector is preferably a CMAH gene derived from a mammal such as a cow, a sheep, a goat, a pig, a horse, a rabbit, a dog or a monkey, more preferably a pig derived CMAH gene, Of the CMAH gene is most preferable, but is not limited thereto.

In addition, the vector of the present invention includes a positive selectable marker gene.

Examples of positive selectable marker genes include neomycin phosphotransferase (Neo), hygromycin phosphotransferase (Hyg), histidinoldehydrogenase (hisD), puromycin (puromycin, Puro) and guanine phosphosribosyltransferase (Gpt), and the like, preferably Neo, but are not limited thereto.

When the gene targeting vector of the present invention is targeted into a host cell, homologous recombination occurs between the endogenous antigenic determinant synthetic gene on the host cell genome and the targeting vector, thereby changing the base sequence.

In another aspect, the present invention relates to a transformant into which said targeting vector has been introduced.

Such transformation includes any method of introducing the nucleic acid molecule into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell as is known in the art. Such methods include electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, -DMSO method, and the like.

In addition, the present invention provides a non-human cloned animal produced through nuclear transplantation of the transgenic somatic cell.

The non-human cloned animal may be a mammal similar in body to human, such as sheep, goat, pig, dog or the like, but it is more preferably a pig, among which a miniature pig is most preferable.

The nuclear transfer method used in the production of the cloned animal can use a method well known in the art, but more preferably, US 6,781,030B, US 6,603,059B, US 6,235,969B, US 7,355,094B, US7 , 071,372B, KR862298B, KR500412B, KR807644B, JP4153878B, US6,700,037B, US7,291,764B, US6,258,998B, US6,548,741B, WO03 / 089632A, US7,371,922B, It is more preferable to use the method described in KR500412B, KR807644, JP4153878B, US6,700,037B, US7,291,764B, US6,258,998B, US6,548,741B, WO03 / 089632A or US7,371,922B desirable. All of these patents are incorporated herein by reference.

In addition, the present invention provides a method for producing a heterologous organ for transplantation, which comprises culturing the non-human cloned animal and then extracting organs necessary for transplantation. The organs can be harvested by regulating the breeding period in consideration of the sex, age, body weight, height, etc. of the recipient, and then harvested through usual surgical operations. After harvesting, Or may be refrigerated quickly.

As can be seen from the present invention, the present invention relates to a method for efficiently cleaving a CMAH gene knockout somatic cell while removing a CMAH gene involved in Neu5Gc antigenic determinant synthesis, And the targeting vector and the transformed cell line prepared according to the present invention can be efficiently used for the production of edible cloned pigs by efficiently controlling the expression of genes involved in the immune rejection reaction.

Figure 1 is a map of a ZFN plasmid.
Figure 2 is a graph showing ZFN activity.
Figure 3 shows that ZFN targets pig CMAH exon 8 by ZFN targeting forward & reverse plasmid.
Figure 4 is a map showing a Donor DNA (CMAH neo targeting vector) map.
FIG. 5 is a diagram illustrating a CMAH targeting vector sequence. 5 ', white; PGK-neo-PolyA, gray; 3arm 'and does not include the pBSK-sequence (DNA is inserted in the XbaI-KpnI site of pBSK-)
FIG. 6 shows a screening strategy of CMAH knockout somatic cells in pigs. FIG.
7 is a photograph showing the result of CMAH neo vector transfection.

Hereinafter, the present invention will be described more specifically with reference to non-limiting examples. The following examples are provided to illustrate the present invention and the scope of the present invention is not construed as being limited by the following examples.

Example  One: ZFN Plasmid  build

The ZFN plasmid of the present invention was commercially obtained from Sigma, USA.

The constructs of the present invention contained the T7 promoter for use in transcription reactions with CMV driven bits. All ZFNs are triple FLAG at the N-terminus. Restriction enzymes Xho I and Xba I are cut immediately after the stop codon and used to straighten the template for mRNA production.

Example  2: ZFN  Active measurement

ZFN activity is measured by the yeast MEL-1 reporter assay (Doyon et al, N at Biotechnol , 2008,26 (6):. 702). ZFN cleavage activity was measured before induction (0 h, blue bars) and after induction of ZFN expression (6 h, red bars). The MEL1 level is positively correlated with ZFN activity producing double strand breaks at the desired target site. ZFNs displaying a> 50% signal compared to the positive control ZFN after induction (6 hours) are considered useful in the genome editing experiment (even ZFNs showing activity in the uninduced state (0h) may be superior).

Example  3: Donor DNA Production

CMAH  5 ' arm - PGKneopolyA -3 ' arm vector  build

1) PCR cloning of 5 '

  5'arm was first amplified by PCR using a sense primer (TCTAGACTCTCTATTTGGTGGCTCTGTTT; SEQ ID NO: 4) containing an XbaI restriction enzyme site and an anti-sense primer (GAATTCAGGAGTTTCTTCCTTTCTGTTTT; SEQ ID NO: 5) DNA was amplified by PCR amplification and then ligated to T-vector (Promega, Madison, WI, USA). The cloned DNA was confirmed to be CMAH gene region by nucleotide sequencing.

2) PCR cloning of 3 '

   3'arm was prepared by using a miniature mini-pig genome DNA as a template and an anti-sense primer (GGTACCAACAGGGACCTGCCAAGAGGCCA; SEQ ID NO: 7) containing a sense primer (CTCGAGCCTACAACCCAGAATTTACTGCC; SEQ ID NO: 6) containing a XhoI restriction enzyme site and a KpnI restriction enzyme site ) And then subcloned into T-vector. The cloned DNA was confirmed to be CMAH gene region by nucleotide sequencing.

3) Construction of CMAH 5'arm-PGKneopolyA-3'arm vector

The construction of the CMAH 5'arm-PGKneopolyA-3'arm vector was performed by first digesting the pKJ2 neo plasmid with EcoRI and XhoI to separate the PGKneoPolyA fragment (about 2 kb) and then ligating a vector of pBluscriptII SK- (Stratagene, San Diego , CA, USA) to obtain pBSK-PGKneoPoyA plasmid. 5 'was ligated to a vector obtained by digesting the pBSK-PGKneoPoyA plasmid with XbaI and EcoRI to obtain a fragment of 789 bp from the 5 plasmid (T-easy vector) PGKneoPolyA plasmid was constructed. Finally, the 3 'linkage is obtained by cleaving the 3plasmid (T-easy vector) obtained by PCR with XhoI and KpnI, securing a 763bp fragment, and then digesting the pBSK-5'arm-PGKneoPolyA plasmid with XhoI and KpnI To construct the final plasmid pBSK-5'arm-PGKneoPolyA-3'arm.

Example  4: ZFN Vector  And Donor DNA of transfection  And selection  Way

Minnesota mini pigs were maintained in the clean rooms of Finch University / Chicago Medical School (North Chicago, IL, USA) and donated by Dr. Kim Yoonbeom of Rosalind Franklin University (North Chicago, IL, USA). They were named SNU mini pigs. Porcine ear fibroblasts were obtained from a 10-day-old male SNU mini-pig. Ear fibroblasts were thawed and cultured in DMEM medium containing 15% FBS, 1 × non essential amino acid, 1 × sodium pyruvate, 10 ^-4 M β-mercaptoethanol, 100 units / ml penicillin and 100 μg / ml streptomycin.

The introduction of gene targeting vectors into miniature pig somatic cells was carried out by electroporation as follows. In the electroporation method, the cultured miniature pig somatic cells were collected by trypsin treatment, suspended in 5 × 10 ⁶ cells / 0.4 ml F10 culture medium, and then 4.5 μg of the linearized Donor DNA vector dissolved in 0.1 ml of F10 culture medium and 2.6 μg pZFN1 and pZFN2 DNA were mixed and the cell vector mixture was added to a 4 mm gap cuvette. The cuvette was mounted on a BTX Electro-cell manipulator (ECM 2001) and then subjected to electric shock at 480 V, 4 pulses, 1 ms. After the electric shock, the cuvette was allowed to stand on ice for 10 minutes, transferred to 10 ml of culture medium, suspended well, and then inoculated into 48 wells at 1250 cells per well. After 24 hours of DNA introduction, the cells were subjected to selection for 11 days using 300 μg / ml G418. The neo-positive clone somatic cells were cultured in a 24-well culture plate through a cloning cylinder. These transfected somatic cells were transferred to a 12-well plate at 90% confluent after 3-4 days. The cells were incubated in 6-well, 60-mm culture dish and 100-mm culture dish at 3-4 days intervals for cryopreservation or experiments.

Example  5: targeting Cell PCR  Selection

   PCR analysis for selection of knock-out cells was performed as follows. For the PCR, 100 ng of the genomic DNA isolated from the cells was used for the PCR, and primers were prepared using Takara Ex Taq using Neo3-1 primer (GCCTGCTTGCCGAATATCATGGTGGAAAAT; SEQ ID NO: 8) and CMAH Sc AS3 primer (AAGACTCCCACTTTAAAGGGTGGTGTGTAG; SEQ ID NO: 9) DNA was amplified. PCR was carried out at 98 ° C for 2 minutes, 1 cycle, 95 ° C for 30 seconds, 68 ° C for 30 seconds, 72 ° C for 2 minutes, 40 cycles, 72 ° C for 15 minutes, 1 cycle. After PCR, DNA was electrophoresed on 0.8% agarose gel to confirm the detection of DNA band of about 2kb.

CMAH neo vector transfection results ^{5X10 6 cell transfection (CMAH neo vector} , ZFN plasmid), to culture a 48well 528 gae, single colony 78 gae passage, 28 dog in Single colony 64 gae PCR analysis, 1 ^st PCR positive, 2 ^nd PCR The final 19 positive.

Number of transfected cells G418 ^R Colony number Number of G418 ^R colonies analyzed by PCR PCR - Positive Colonies 5X10 ⁶ 78 64 19

<110> Konkuk University Industrial Cooperation Corp. <120> CMP-N-acetylneuraminic acid hydroxylase targeting vector and use          of the same <160> 9 <170> Kopatentin 1.71 <210> 1 <211> 793 <212> DNA <213> Artificial Sequence <220> <223> 5'arm <400> 1 tctagactct ctatttggtg gctctgtttt attttcttcc tagctcatca ctctttgaaa 60 tgaacttatt tacttattca ttatttgctt ctttcactag aatgaatgct ccatgagagc 120 agggacctgc tttatcttgc tcgccactgt attctcagtg cctagaacta cgtctggcac 180 atagtaggtg ctcaataaat atcgatcaaa tgaaagaatg agcaaacgaa caaatgaaca 240 acatgtgagg taggcatcat gattccattc aacagaggag aaaaacagac ttaaggaatt 300 gaagtggtgg agctgcattt tgatcttgac tgactccaac atccatgctc ttgaccacgg 360 tgcatctcca gagtgtaatg aacatacttt acttttatat tccaccaaaa taacaaagcc 420 atgcccatgt tagtagagag ttaatcgaca gtgcccttaa aatatgcatg cacccagggt 480 acaactatgc atgctgccct gtgttttcag ttggatccaa atgaattgcc gtaaacaaag 540 gggggattca atgtctttga ctagtttggg atattttcct agtaaccaac tttgcaaaat 600 aaagccacta atgacaagga gctttgttct acttctgcat cactcaactg tcaattttta 660 tctcttgcaa gacttctaat ctactagaac ttttgttttt ctgtgatttc tgaacagaga 720 agactaatcc aaaccctgtc attccagagg aatggaaagc ccaattcatt aaaacagaaa 780 ggaagaaact cct 793 <210> 2 <211> 1642 <212> DNA <213> Artificial Sequence <220> <223> PGK-neo-PolyA <400> 2 gaattctacc gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca 60 gccccgctgg gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc 120 accggtaggc gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct 180 cccctagtca ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg 240 gaagtagcac gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg 300 gtaggccttt ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg 360 ctgggaaggg gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc 420 cgaaggtcct ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg 480 ttctcctctt cctcatctcc gggcctttcg acctgcagcc aatatgggat cggccattga 540 acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga 600 ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg 660 gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaggacga 720 ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt 780 tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct 840 gtcatctcac cttgctcctg ccgagaaagt attatccatc atggctgatg caatgcggcg 900 gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac atcgcatcga 960 gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg acgaagagca 1020 tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgcgcatgc ccgacggcga 1080 ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg aaaatggccg 1140 cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc aggacatagc 1200 gttggctacc cgtgatattg ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt 1260 gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga 1320 gttcttctga ggggatccgg atccgctgta agtctgcaga aattgatgat ctattaaaca 1380 ataaagatgt ccactaaaat ggaagttttt cctgtcatac tttgttaaga agggtgagaa 1440 cagagtacct acattttgaa tggaaggatt ggagctacgg gggtgggggt ggggtgggat 1500 tagataaatg cctgctcttt actgaaggct ctttactatt gctttatgat aatgtttcat 1560 agttggatat cataatttaa acaagcaaaa ccaaattaag ggccagctca ttcctcccac 1620 tcatgatcta tagatccctc ga 1642 <210> 3 <211> 769 <212> DNA <213> Artificial Sequence <220> <223> 3 'arm <400> 3 gcctacaacc cagaatttac tgcccctttg ctgggtattt cgtggaatcc cacccagcag 60 acaagtatgg ctggatattt tatataacgt gtttacgcat aagttaatat atgctgaatg 120 agtgatttag ctgtgaaaca acatgaaatg agaaagaatg attagtaggg gtctggagct 180 tattttaaca agcagcctga aaacagagag tatgaataaa aaaaattaaa taccatagtg 240 tgctattacc aattatgtat aatagtctta tacatctaac ttcaattcca atcactatat 300 gcttatacta aaaaacgaag tatagagcca accttctttg actaacagct cttccctagt 360 cagggacatt agctcaagta tagtctttat ttttcctggg gtaagaaaag aaggattggg 420 aagtaggaat gcaaagaaat aaaaaataat tctgtcattg ttcaaataag aatgtcatct 480 gaaaataaac tgccttacat gggaatgctc ttatttgtca ggtatattaa ggaaacaaac 540 atcaaaaatg acccaaatga actcaacaat cttatcaaga agaattctga ggtggtaacc 600 tggaccccaa gacctgagcc actcttgatc tgggtaggat gctaaaggac ccaacagaca 660 ggtttgactt gaatatttac agggaacaaa aatgattcct gaattttttc atgtttatga 720 gaaaataaag ggcataccta tggcctcttg gcaggtccct gttggtacc 769 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tctagactct ctatttggtg gctctgttt 29 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gaattcagga gtttcttcct ttctgtttt 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ctcgagccta caacccagaa tttactgcc 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ggtaccaaca gggacctgcc aagaggcca 29 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gcctgcttgc cgaatatcat ggtggaaaat 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aagactccca ctttaaaggg tggtgtgtag 30

Claims (10)

CMP-acetylneuraminic acid hydroxylase 5 ' arm,
A phosphoglycerate kinase neopolyA (PGKneopolyA) fragment consisting of the nucleotide sequence shown in SEQ ID NO: 2 and
CMP-acetylneuraminic acid hydroxylase targeting vector comprising a CMP-acetylneuraminic acid hydroxylase 3 'arm in sequence. 2. The CMP-acetylneuraminic acid hydroxylase targeting vector according to claim 1, wherein the CMP-acetylneuraminic acid hydroxylase 5 'arm has a nucleotide sequence as set forth in SEQ ID NO: 1. delete The CMP-acetylneuraminic acid hydroxylase targeting vector according to claim 1, wherein the CMP-acetylnulaminic acid hydroxylase 3 'arm has the nucleotide sequence as set forth in SEQ ID NO: 3. 2. The CMP-acetyllaurinic acid hydroxylase targeting vector according to claim 1, wherein the CMP-acetylneuraminic acid hydroxylase targeting vector has the cleavage map as shown in FIG. A method for producing CMP-acetylneuraminic acid hydroxylase knockout cells comprising transfecting a vector of claim 1 and a zinc fingernace vector into a cell. 7. The method of claim 6, wherein the zinc finger nuclease vector has the cleavage map as set forth in Figure 1. A CMP-acetylneuraminic acid hydroxylase knockout cell produced by the method of claim 6. A method for producing an animal other than a human by performing somatic cell nuclear transfer on the knockout cell of claim 8. A method for producing a heterologous transplant for transplantation, comprising the step of raising a cloned animal except for a human prepared by the method of claim 9 and then removing the organ.

Images