RU2807599C2 - Genetically modified sterile birds and method for their reproduction - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: transgenic construct for expression in the germ cell of a host bird has been proposed. This construct comprises (i) a first nucleotide sequence, wherein this first nucleotide sequence encodes an apoptosis-inducing enzyme, and this apoptosis-inducing enzyme is a caspase, and (ii) a second nucleotide sequence that targets this construct to avian germ cells, wherein this second nucleotide sequence targets the DAZL locus. Also a method is proposed for producing a surrogate host bird by modifying the germplasm of this bird using this construct, and a transgenic bird containing this construct and intended for use as a surrogate host bird.

EFFECT: invention provides selective destruction of germ cells of the host bird on demand without destroying other cells in the germ cell of the host bird and allows for highly efficient integration of donor germ cells.

11 cl, 23 dwg, 1 ex

Description

Field of technology

The present invention relates to methods for producing genetically modified birds and/or wild-type birds, such as chickens, from germ cells, and to birds produced using such methods.

State of the art

Obtaining bird breeds from isolated germ cells is currently a largely inefficient and difficult process. A particular problem associated with the production of genetically modified birds is the stable transmission of germ cells containing the genetic modification to the offspring of birds and subsequent generations of such birds. In particular, when using conventional methods, germ cell transfer is particularly inefficient due to competition in the formation of functional gametes between the donor germ cells, which may or may not be genetically modified, and the endogenous germ cells.

Although diploid germ cells can be transplanted from one bird to a host bird, the proportion of progeny derived from the resulting gametes varies, with all or part of the progeny produced from gametes derived from endogenous (host bird) germ cells (Nakamura et al. al (2010) Reprod Fert Dev 22(8): 1237–1246; Song et al (2014) Biol Reprod 90(1): 15). Endogenous (host) germ cells can be killed using radiation or chemotherapy reagents such as busulfan, but these toxic reagents can also kill the animal along with the endogenous germ cells. Tagami used chemical processing to produce sterile surrogate chicken hosts (Nakamura et al (2010) Biol Reprod 83(1):130-7). We and Nakamura used gamma irradiation to kill endogenous germ cells (MacDonald et al (2010) Plos One 5(11): e15518; Nakamura et al, (2012) J Reprod Dev 58(4): 432-437). However, although the number of progeny produced from donor germ cells increased after the treatment, not all progeny were produced from donor germ cells, and the treatment killed many host hens.

Transgenic lines of sterile mammals and fish have been created that express a gene product (nitroreductase, Ntr) in germ cells that will kill germ cells in the presence of a prodrug. The iC9 (inducible caspase 9) gene has been used to kill stem cells in humans and mice and to kill endothelial cells in transgenic mice. Such techniques cannot be expected to be directly transferable to birds, given the different results obtained using germ cell modification techniques when applied to mammals and birds. For example, the inventors' previous work produced a female germ cell-free chicken from a genetic mutation in the DDX4 gene using genome editing technology. (Taylor et al., Development 2017). The inventors did not expect the female hen to be sterile because, while male Ddx4 mutant mammals are sterile, female Ddx4 mutant mammals have normal reproductive capacity. Thus, germ cell modification techniques may have very different effects in mammals and birds. Sterility also depends on the stage of development at which endogenous germ cells die. In birds, sterile DDX4 females contain pre-hatching germ cells that can compete with donor germ cells injected into a genetically modified host embryo.

Brief description of the invention

The present invention solves many of the problems of the prior art. The inventors have unexpectedly shown that by using genetic engineering to express a recombinant protein in germ cells that will selectively kill host germ cells on demand, such as upon exposure to a specific prodrug or inducer, without killing other cells of the host chicken, highly efficient integration can be achieved donor germ cells. Germplasm (sex cells) from different bird species can be transferred to this host bird, and the genetics of the offspring will be formed from the transferred material (Fig. 1).

Although transgenic lines of sterile mammals and fish have been generated expressing this gene product, differences in protein activity and function between avian and mammalian species and differences in gene function and activity between avian and mammalian species mean that methods used in mammals cannot be expected to and fish may be transferable to birds, and thus cell modification techniques may have very different effects in birds and mammals. Sterility also depends on when endogenous germ cells die during development (the temporary nature of gene or protein activity). Many different loci in birds need to be analyzed to determine whether they will express the transgene at the appropriate stage of development, that is, whether the germ cells can be 100% removed during embryonic development.

Accordingly, the first aspect of the present invention relates to a transgenic bird containing a transgene in the germ cells of said bird, wherein the activity of a protein encoded by said transgene is induced by an exogenous inducing agent, and upon induction, the activity of said protein causes the death of said germ cells.

A second aspect of the invention relates to a transgenic construct comprising (i) a first nucleotide sequence, wherein the activity of a protein encoded by said first nucleotide sequence causes germ cell death in the presence of an exogenous inducing agent, and (ii) a second nucleotide sequence that targets said construct to avian germ cells.

The third aspect relates to a method of modifying avian germplasm, comprising introducing a transgenic construct into a fertilized egg of said bird and incubating said egg, wherein said transgenic construct is a transgenic construct according to the second aspect of the invention, and wherein said transgenic construct is inserted into the germ cells of said embryo.

The fourth aspect of the invention relates to a transgenic bird containing a transgenic construct according to the second aspect of the invention or obtained by a method according to the third aspect of the invention.

According to the invention, the bird can be any suitable bird. For example, a bird may belong to the order galliformes, aseriformes, passeriformes, gruiformes, struthioniformes, rheiformes, casuariformes, apyerygiformes, otidiformes ), columbiformes (pigeon-like), sphenisciformes (penguin-like), cathartiformes (cathartiformes), accipitriformes (hawk-like), strigiformes (owl-like), psittaciformes (parrot-like), charadriiformes (charadriformes) or falconiformes (falconiformes). Suitably, the bird is a chicken, turkey, duck, goose, quail, pheasant, grouse, guinea fowl, pigeon, ostrich, emu, songbird, parrot, finch, sparrow, penguin or falcon. In one embodiment, the bird is a chicken.

In the invention, the transgenic construct according to the invention and for use therein is targeted to germ cells. In one embodiment, the germ cells are primordial germ cells. In yet another embodiment, the germ cells are adult germ cells. Preferably, said construct targets a locus of the avian genome that is selectively expressed in primordial germ cells or germ cells in the gonad of an embryo, or in the testes and ovaries of an adult bird. Preferably, the locus is expressed only in primordial germ cells or germ cells in the gonad of an embryo or adult bird. In one embodiment, the transgenic construct targets one of the following loci, which in poultry are expressed only in germ cells: DAZL, DDX4, DMRT1, MIR383, TDRD15, TDRD5, FKB6, GASZ, DMRTB1, TDRD9, GTSF1, MOV10L1, STK31, RNF17 , FDFT1, GNG10, DDX43, KCNH7, SOX21 TUBA1B or PNLDC1. In yet another embodiment, the construct targets one or more of the following RNA encoding genes: MSTRG.9846 (2:40789480-40848190), MSTRG.10457(2:71880785-71991485), MSTRG.17017 (3:85453009-85462029 ). Suitably, the transgenic construct targets one of the following loci: DAZL, RNF17, TUBA1B, TUBA1C, STK31, FDFT1, gga-mir-6611. Preferably, the transgene targets loci that are expressed at the highest levels in chicken PGCs. Preferably, the transgene targets loci that are expressed at the highest levels in the PGC of certain birds, for example, goose, duck, etc.

Comparison of the RNA transcriptome of primordial germ cells of different avian species has identified genes that are expressed at high levels in the germ cells of most avian species. This analysis showed that DAZL has the highest level in most bird species, GTSF1 is the second highest in goose germ cells, and TDRD9 is the second highest in duck germ cells. Thus, different regions of the genome may function better in individual bird species. In fig. 21 shows the expression levels in chicken, duck and goose, respectively.

Suitably, the transgene targets loci that are expressed at the correct times during the avian growth and reproductive cycle to promote development of the bird and the avian reproductive system, but minimize competition between donor and host germ cells. For example, in embodiments of the invention, the inventors determined that due to the transient nature of the expression provided, sterile DDX4 females contained pre-hatching germ cells that could compete with the donor germ cells. The germ cells died only after hatching. It is understood that the ability to allow expression until an exogenous agent is applied, modulation of expression by providing an exogenous agent, and the ability to account for the temporal nature of expression may provide a more advantageous system than simply knocking out a sex gene in the host.

Suitably, the ablative cell death gene and the locus it targets can be selected for ablation of germ cells during embryonic development depending on the requirements.

An ablative cell death transgene must be active enough to ablate most germ cells during embryonic development. DDX4 may be selected as a second-preferred alternative to dazl as a locus in chickens. It is clear that providing a cell ablation transgene with enhanced apoptotic activity could overcome the ablation failure reported with nitroreductase. For example, increased iCaspase9 activity would allow use of the DDX4 locus. As will be appreciated by those skilled in the art, a screening assay can be used to identify amino acid changes in proteins that mediate ablation or potential ablation (Caspase9 or nitroreductase, or any other cell death inducing gene) and to make such proteins sufficiently active or more active to provide germ cell ablation at functionally useful levels/with increased efficiency, screening may be used. Such proteins can then be introduced into any of the listed germ cell-specific loci.

In embodiments of the invention, the caspase 9 gene (a mammalian amino acid version or a chicken sequence-modified version (aviCaspase9), i.e. a version similar in amino acid sequence to chicken protein) has been found to be particularly suitable for providing ablation of host proteins. cells. As noted in the Examples, aviCaspase9 was determined to not cause ablation of all germ cells when present in cell culture when introduced into the DDX4 locus of a chicken cell.

Suitably, a mammalian amino acid caspase 9 transgene may be proposed for germ cell ablation by targeting the DAZL locus. Suitably, the ablation produces substantially pure donor progeny, eg, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95%, greater than 97%, greater than 99%, 100%. Suitably, iCaspase9 can be used in chickens for sterilizing ablation. The iCaspase9 gene was found to provide complete sterilizing ablation in chickens (Fig. 23).

In a particular embodiment, the transgene may be a cDNA targeting the avian DAZL locus, in particular the C-terminal region of the avian DAZL locus. The inventors determined that DAZL is not only expressed at high levels in primordial germ cells and thus mediates selective cell ablation, but also provides sufficient expression of the toxic protein to mediate ablation. Moreover, the inventors have determined that in addition to the level of expression provided by the loci, the timing of expression (temporal pattern of expression) is important. DAZL is expressed early in the primordial germ cells of the avian embryo. Therefore, transient expression of DAZL is also beneficial for its use in the expression of toxic or apoptosis-inducing proteins. Suitably, iCaspase9 under the control of DAZL is particularly preferred. For example, we determined that the iCaspase9 transgene functions well at the chicken DAZL locus.

The level of expression provided by the construct and the timing of expression are considered important factors in the context of the expression of toxic or apoptosis-inducing proteins (eg caspases), as opposed to the use of knockouts where disruption of the locus may be sufficient. The extent of ablation produced by a transgene can be controlled by the genetic location of the transgene, for example when it is inserted at the 5' end of a gene, or inserted at the 3' end of a gene, or as an independent transgene whose expression is controlled by regulatory regions of genes expressed only in avian germ cells .

As described herein, the transgenic construct of the invention and for use therein comprises a first nucleotide sequence, when expressed, a protein causes germ cell death in the presence of an exogenous inducing agent. In some embodiments, the transgene encodes a protein whose activity or expression is induced by an exogenous inducing agent, wherein the expressed protein causes the death of said germ cells in the presence of the exogenous inducing agent.

Suitably, the transgene may comprise a portion that encodes an inducible dimerization domain and an apoptosis-inducing domain. Suitably, the inducible dimerization domain may be a chemically inducible dimerization domain. In the presence of a dimerization-inducing agent, such as a dimerization-inducing chemical, the expressed protein dimerizes, causing apoptosis of the endogenous germ cells.

Any suitable apoptosis-inducing domain may be used in the invention. In one embodiment, the apoptosis-inducing domain comprises or consists of a caspase gene encoding a caspase protein. Such caspase proteins are caspase 2, 3, 4, 6, 7, 8, 9 or 10. Such a caspase protein may contain amino acid sequences from mammals or birds or other vertebrates. In one embodiment, the caspase is caspase 9.

Accordingly, in a suitable embodiment, the inducible caspase 9 (iC9) gene may be expressed in germ cells of an avian, such as chicken. When exposed to a chemically induced dimerization (CID) drug, caspase 9 will dimerize and become activated and then cause apoptosis of germ cells containing the dimerized caspase 9.

Suitably, expression of said caspase gene can be induced by the use of a dimerization inducing agent via a dimerization inducing domain. Suitable dimerization inducing agents that can be used in the invention include ligand AP20187 (molecule B/B, Takara) or its chemical variants FK1012, AP1501, AP1903.

In one such embodiment, the transgene is a cDNA encoding an FKBP12 dimerization domain and a caspase 9 gene targeting a genetic locus selected from DAZL or DDX4, particularly DAZL or DDX4 in chicken.

In yet another embodiment, the transgene may encode a dimerization domain fused to an apoptosis-inducing domain, such as a caspase gene, which may result in dimerization of the encoded protein upon delivery of a stable dimerization inducer drug. For example, the transgene may encode a stabilized polypeptide linker (SPL) attached to a caspase molecule. The addition of a compound such as asunaprevir and telaprevir can stabilize the dimerization domain of caspase molecules, leading to activation of the caspase molecule and activation of cell death (Jacobs et al (2018) Nature Methods 15: 523-526).

In an alternative embodiment, the transgene may encode an enzyme that converts prodrugs into cytotoxic metabolites. In such an example, a prodrug (which acts as an exogenous inducing agent) may be introduced into endogenous germ cells, and expression of a transgene, such as a cDNA encoding a bacterial nitroreductase gene, may provide an enzyme that converts the prodrug to a cytotoxic metabolite.

Any suitable enzyme and prodrug activated by said enzyme may be used in such a system. For example, when the enzyme is a nitroreductase, the prodrug may be CB1954 or metronidazole.

In one such embodiment, the transgene is a cDNA encoding a nitroreductase gene targeting a genetic locus selected from DAZL or DDX4, in particular DAZL or DDX4 in chicken.

In one embodiment, the transgenic construct of the invention and for use therein comprises cDNA and a 2A or IRES (internal ribosome entry site) sequence such that the recombinant protein is expressed at similar levels to the endogenous gene. For example, the 2A peptide sequence can be linked to cDNA such that the recombinant protein is expressed at similar levels to the endogenous gene.

In one embodiment, a nucleotide sequence from a locus that in birds is expressed only in germ cells or germ cells (examples of such loci, including DAZL and DDX4, are given above), wherein the nucleotide sequence comprises regulatory regions and the first exon up to the first methionine coding, linked to cDNA. This region of DNA can be introduced into the bird by any suitable method that will ensure specific expression of the recombinant protein in the germ cells, for example, in a transposon.

Examples of DAZL and DDX4 repair templates for use in the invention are shown in FIG. 15, 16, 17 and 18. Such repair matrices constitute additional independent aspects of the invention.

In the methods of the invention, any suitable means may be used to target the transgenic construct to germ cells. Suitably, a CRISPR-based system, such as a CRISPR/cas or CRISPR/cfp-based system, can be used to target the transgene to germ cells. In such a system, guide RNA can target the construct to germ cells.

In accordance with a further aspect of the present invention, there is provided a kit comprising a transgenic construct according to the second aspect of the invention and a site-specific nuclease, such as Cas9, for targeting the construct to a genetic locus specifically transcribed in germ cells.

In an alternative embodiment of a CRISPR-based system for targeting a transgene construct to germ cells, a transposon-based system may be used to target the transgene construct to germ cells. In such a system, targeting can be achieved by incorporating into the transposon (i) regulatory regions from a gene selectively expressed, preferably exclusively expressed, in germ cells, together with (ii) said first nucleotide sequence. For example, such a transposon may contain regulatory regions from DDX4 or DAZL, a caspase 9 gene, and a dimerization domain (suitably DAZL and icaspase9). The first nucleotide sequence is expected to be expressed only in germ cells. Thus, when using an exogenous inducing agent, only germ cell death can be expected.

The transgenic construct according to the second aspect of the invention can be used to modify poultry germplasm. By targeting the transgene construct to germ cells and introducing an inducing agent, the transgene is activated such that it can selectively kill endogenous germ cells. Suitably, activation of the germ cell transgene causes a reduction in the number of germ cells by at least 10%, at least 20%, at least 30%, at least 50%, at least 70%, at least by 90%, up to 100% of normal values. Suitably, the process provides a bird that lacks endogenous germ cells.

Suitably, upon induction, the transgene may be expressed in the presence of an exogenous inducing agent at a level sufficient to cause germ cell death when cultured in vitro.

After or during the destruction of endogenous germ cells by, for example, activation of a protein encoded by an apoptosis-inducing domain or conversion of a prodrug to a cytotoxic metabolite by an enzyme encoded by a transgene, the cells (transplanted cells) may be administered to the germ cell-deprived bird (host bird). ), for example, germ cells from another bird of the same or a different bird species, so that the host bird produces offspring with the genetics of the transplanted cells. Suitably, the method may include the step of transplanting germ cells from a donor bird to a surrogate bird.

Suitably, induction of the activity of the protein encoded by the transgene can be stopped prior to transplantation of the donor cells.

Suitably, the transplanted cells from the donor bird may be obtained from frozen cells.

It is understood that germ cells transplanted into a surrogate host from a donor bird will have an increased chance of competing with endogenous germ cells that were present in the surrogate host due to the action of the transgene.

Suitably, the transplanted cells may be genome-edited germ cells. Suitably, the genome-edited germ cells may be derived from the same or a different avian species as the host bird.

Suitably, the method may include the step of providing the bird with the genome of the transplanted cells. Suitably, a surrogate bird host may be used to produce a plurality, for example a flock, of genome-edited birds from genome-edited germ cells of the same bird species or a different bird species.

In one aspect of the invention, a method is provided for producing a surrogate avian host, comprising inserting a transgenic construct into fertilized avian eggs and incubating said eggs until hatching, wherein said transgenic construct is inserted into the germ cells of said embryo and the protein expressed from the transgenic construct causes the death of said germ cells in the presence of an exogenous inducing agent. This method allows for the insertion of said transgenic construct not only into the germ cells of said embryo, but also into the germ cells of all offspring subsequently obtained from a bird derived from said embryo.

Suitably, the method may further comprise treating the resulting surrogate host with an exogenous inducing agent to cause the death of said endogenous germ cells. Suitably, the method further comprises transplanting exogenous germ cells into said surrogate host.

Suitably, the method further comprises mating male and female offspring from one or more of said surrogate host birds to produce offspring birds with germ cells having the genetic characteristics of the transplanted germ cells. Detection of progeny from transplanted germ cells can be accomplished by standard genomic sequencing methods.

A surrogate avian host can be used to transplant cells, particularly germ cells, from other avian species. The germ cells may be primordial germ cells, embryonic germ cells, gonocytes. Germ cells can be transplanted by transplanting the testes or ovaries of an adult. The surrogate host bird produces offspring with the genetics of the transplanted cells.

A surrogate bird host can be used to recreate bird species from frozen genetic material stored in the form of germ cells. The recreated bird species will have a genome of frozen germ cells.

Embodiments of the present invention will now be described by way of example only with reference to the accompanying drawings, in which:

Fig. 1. Scheme of transplantation of germ cells into a sterile host.

Fig. 2. Schematic showing NTR and iCaspase9 (iC9) targeting to the DDX4 locus. NTR repair template targeting the DDX4 locus and ic9 repair template targeting the DDX4 locus.

Fig. 3. Schematic showing the targeting of NTR and iCaspase9 (iC9) to the DAZL locus. NTR repair template targeting the DAZL locus and ic9 repair template targeting the DAZL locus.

Fig. 4. PGCs targeting the DAZL locus express approximately 4 times more GFP than cells targeting the DDX4 locus. GFP-containing PGCs targeting the Dazl locus express 3.8-fold more GFP fluorescence than GFP-containing PGCs targeting the Ddx4 locus. A. Flow cytometry analysis of GFP fluorescence B. Micrograph of targeted PGCs.

Fig. 5. 500 PGCs (control, CAG-NTR or Dazl-NTR) were cultured in the presence or absence of the nitroreductase prodrug CB1954 (n=2 for each prodrug concentration). After 10 days, the total number of cells in each well was counted. N=6 for each value from three independent experiments.

Fig. 6. 500 PGCs (dazl-GFP, dazl-caspase-human or dazl-caspase-chicken) were cultured in the presence or absence of the B/B dimerization inducer molecule. After 10 days, the total number of cells in each well was counted. N=6 for each value from three independent experiments.

Fig. 7. B/B treatment causes ablation of injected PGCs targeted by DAZL-iCasp9. Stage 16 HH embryos were injected with 3500 PGCs transfected with CRISPR reagents to insert the inducible caspase gene and GFP into the dazl locus, and 3500 PGCs transfected with a transposon to randomly insert a TdTomato expression cassette into the genome. After injection, embryos were injected with 50 μl of 1x penicillin/streptomycin with or without 25 nM B/B dimerization inducer drug. On day 8 of development, the gonads were dissected and observed under fluorescence. Images are representative of three independent injections for each treatment.

Fig. 8. Seven G1 progeny variants targeted by iCaspase9 and aviCaspase9

DAZL icaspase9, Dazl aviCaspase9 (chicken) were injected into fertilized eggs from DDX4 heterozygous male hens crossed with wild-type females. 3000 PGCs were injected into stage 16 HH embryos through holes made in the eggs, the eggs were sealed and incubated until hatching. Breeding of these founder hens produced seven G1 transgenic offspring containing the targeted transgene. The positive progeny numbers shown in the figure are 42, 4, 18. A. PCR with Caspase9-specific primers; MW, molecular weight markers, A, Targeted PGCs containing aviCaspase9, B, Targeted PGCs containing iCaspase9. B. PCR with GFP-specific primers.

Fig. 9. GFP expression on days 6 and 10 of G2 iCaspase9 and aviCaspase9 embryos.

G2 embryos positive by PCR for the iCaspase9 and aviCaspase9 genes were imaged for GFP fluorescence.

Fig. 10. GFP expression is germ cell specific in G2 iCaspase9 and aviCaspase9 day 10 embryos. Left panels; GFP fluorescence in B/B-injected iCaspase9 and aviCaspase9 embryos. Right panels: immunofluorescence for DDX4 protein (red).

Fig. 11. B/B-fed iCaspase9 and aviCaspase9 G2 embryos have no germ cells.

B/B was injected into the dorsal aorta of stage 16 (day 2.5) chick embryos. Embryos were incubated and examined at day 10 for GFP fluorescence and DDX4 expression. Left panels; GFP fluorescence in B/B-injected iCaspase9 and aviCaspase9 embryos. Right panels: immunofluorescence for DDX4 protein (red).

Fig. 12. Treatment of aviCaspase9 transgenic embryos with B/B causes ablation of host germ cells and allows transplanted donor cells to populate the host gonads. Stage 16 HH embryos containing the aviCaspase9 transgene targeting the DAZL locus were injected with 200 donor PGCs transfected with a transposon to randomly insert a TdTomato expression cassette into the genome. The injected cells were in 1 μl of a solution containing 0.5 mM (final concentration) of the B/B dimerization inducer drug. After injection, 50 μl of 1x penicillin/strethpomycin containing 15 μM (final concentration) B/B dimerization inducer drug was added to the eggs and incubated for 8 days. On day 10 of development, the gonads were dissected and observed under fluorescence. All germ cells in the aviCaspase9 embryo treated with the dimerization inducer drug were from donor cells with TdTomato; no endogenous (host) germ cells were detected.

Fig. 13. DNA synthesized for the human iCaspase9 transgene.

Fig. 14. DNA synthesized for the chicken iCaspase9 transgene.

Fig. 15. DNA sequence for the DDX repair template containing the nitroreductase gene optimized for chickens.

Fig. 16. DNA sequence for the DAZL repair template containing chicken aviCaspase9.

Fig. 17. DNA sequence for the DAZL repair template containing human iCaspase9.

Fig. 18. DNA sequence for the DDX4 repair template containing human iCaspase9.

Fig. 19. DNA for chicken-optimized nitroreductase gene. The top row of this table provides a single-letter amino acid code for each amino acid present in the E. coli Ntr sequence and codon-optimized Ntr sequences. The second row gives the sequence of bases in the E. coli Ntr sequence, and the third row of the table highlights the changes that were made when optimizing the Ntr gene for chicken. The highlighted bars show where three mutations were made to create the 3AAS Ntr construct: threonine at codon 41 was mutated to glutamine (CAG); asparagine at codon position 71 was mutated to serine (AGC), and phenylalanine at codon position 124 was mutated to threonine (ACC).

In fig. 20 provides a table of the RNA transcriptome of chick primordial germ cells compared to other chick embryonic tissues and pluripotent cells to identify genes that are expressed only in germ cells and at high levels at these embryonic stages. ESC - chicken embryonic stem cells, EGKX - cells of chicken embryos at the egg-laying stage, Nepluri - a set of 66 non-pluripotent tissues and cell lines of adult chickens.

Fig. 21. Expression of germ cell-specific genes in avian PGCs. The graph shows the relative expression of germ cell-specific genes in chick, goose, and duck PGCs. The mean of normalized expression values was obtained from the DESeq2 package. These expression values are normalized to the total number of reads for all samples. The reported expression of TDRD9 and TUBA1B is higher in duck PGCs, GASZ and RNF17 are expressed at high levels in goose PGCs, and the remaining genes are expressed at higher levels in chicken PGCs.

Fig. 22. 500 PGCs (dazl-GFP, dazl-iCaspase, dazl-aviCaspase, ddx4-iCaspase9) were cultured in the presence or absence of the B/B dimerization inducer molecule. After 10 days, the total number of cells in each well was counted. N=2 for each value.

In fig. 23 illustrates the use of caspase9 host cell ablation using donor PGCs from Chinese black silkies injected into iCaspase9 surrogate host embryos that hatch and are bred to produce pure offspring. A) The progeny (embryos) from the Dazl-iCaspase9 surrogate did not contain the GFP transgene, indicating that the majority of the host germ cells did not produce progeny (50% of the progeny from endogenous germ cells should be GFP+ if they were not ablated). Two progeny from the Dazl-aviCaspase9 surrogate contained a GFP transgene, indicating that some of the progeny were derived from endogenous germ cells. (A-C) The offspring (embryos and chicks) have black skin, indicating that they are descended from donor germ cells.

Detailed Description of the Invention

FK binding protein (FKBP) FKBP12 belongs to the immunophilin receptor family, and its amino acid sequences are highly conserved between mammals and chickens (Yazawa et al (2003) Comparative Biochem. Physiol: Mol. Integ. Physiol 136(2):391-399 ). It is a cytosolic receptor for the immunosuppressive drug FK506 and is a target for selective control of cell signaling through protein dimerization.

Dimeric variants of FKBP12, FK1012, were synthesized by Spencer and colleagues to mediate control of cellular signaling through dimerization or oligomerization of intracellular proteins (Spencer et al (1993) Science 262:1019-1024). Later, a specific binding pocket was created in FKBP12 by replacing the bulky phenylalanine with a smaller valine residue (FKBP12 _F36V ). Redesigned FK1012 ligands, including AP1903 and the closely related AP20187, have been designed with high affinity and selectivity for FKBP12 _F36V and minimal interaction with endogenous FKBPs (Clackson et al (1998) PNAS 95(18):10437-10442; Nör et al (2002) Gene Ther 9(7):444–51).

Caspase proteins, 2, 3, 4, 7, 8, 9 or 10, are naturally occurring proteins that are known to induce programmed cell death. Caspase 9 (Casp9) is activated upon dimerization and leads to cell apoptosis. Casp9 can be truncated to remove its dimerization domain (CARD). By fusing the FKBP12 _F36V dimerization domain to Casp9, cell ablation can be selectively induced upon ligand administration. This system is called the inducible caspase 9 (iCas9 (iC9)) system. AP20187 is marketed as a B/B homodimerization inducer drug. It was used to create a system that induces cell ablation. The fusion protein was used to eliminate cells in vitro (Carlotti et al (2005) Cancer Gene Ther 12(7):627-39). It has also been used to eliminate cells in vivo in mice, clawed frogs and zebrafish (Mallet et al (2002) Nat Biotechnol 20(12):1234-1239; Pajvani et al (2005) Nat Med 11(7):797- 803; Hamm et al (2009) Invest Ophthalmol Vis Sci 50(2):885–92; Weber et al (2016) Development 143(22):4279–4287; Shimokawa (2017) Nature 11; 545(7653):187 -192).

Example 1

Selective ablation of chick primordial germ cells (PGCs) through modification of the chicken genome with the inducible caspase 9 (iC9) transgene.

Preparation of DNA constructs used to obtain iCasp9-transfected PGCs

To specifically express inducible Casp9 in PGCs, genome editing using CRISPR/Cas9 technology was used to mediate sequence insertion at the following loci that are specifically expressed in PGCs:

DDX4: The chicken homologue of the vasa gene, an RNA helicase, is specifically expressed in germ cells from the DDX4 locus. Targeted insertion of exogenous genes into the DDX4 start codon (ATG) was undertaken to achieve germ cell-specific expression of the corresponding proteins.

DAZL: The DAZL locus controls the expression of the RNA-binding protein DAZL. DAZL expression is also germ cell specific and has been measured to be at least 10-fold higher than DDX4 expression (Jean et al. 2014). Targeted insertion of exogenous cDNAs at the stop codon (TGA) of the DAZL locus was used to achieve germ cell-specific expression of the corresponding proteins.

A diagram of the targeting strategy is shown in FIG. 2 and fig. 3.

Inducible caspase 9

Plasmid pMSCV-F-del Casp9.IRES.GFP (https://www.addgene.org/15567/), deposited in Spencer lab (Straathof et al (2005) Blood 105(11):4247-54), contains the sequence The cDNA for FKBP12 _F36V fused to truncated human Casp9 (truncated such that its dimerization domain was removed to reduce basal activity), with an HA tag fused to the C terminus of Casp9. This DNA sequence is referred to herein as iCasp9.

The iCasp9 sequence was chemically synthesized with the preceding P2A sequence, flanking BamH1 restriction sites, and with the BamH1 site removed by codon substitution within the sequence. The iCasp9 sequence flanked by the BamH1 site (human iCasp9) was synthesized in the pMA vector.

In addition, the Casp9 domain of human iCasp9 (amino acids 135-417 in NP_001220.2) was replaced with the homologous amino acid region of the chicken Casp9 protein sequence (amino acids 169-450 in XP_424580.6) to obtain the chicken iCasp9 sequence. The chicken iCasp9 sequence was chemically synthesized with a preceding P2A sequence, flanking BamH1 restriction sites, and with the BamH1 site removed by codon substitution within the sequence. The iCasp9 sequence flanked by the BamH1 site (chicken iCasp9) was synthesized in the pMA vector. This DNA sequence is referred to herein as aviCasp9.

Nitroreductase transgene

The nitroreductase gene is present in some species of bacteria and reduces the nitro group of certain chemical compounds to cytotoxic metabolites. The nitroreductase gene from E. coli has been codon optimized for expression in chickens. Three amino acid substitutions were made which were shown to provide higher specific activity (see FIG. 19) in the presence of the prodrug substrate CB1954.

DDX4-GFP repair template

The DDX4 repair template was originally constructed using Gibson cloning, which allows for the ligation of multiple overlapping double-stranded DNA fragments. Fragments for this plasmid were obtained by PCR (Invitrogen primers) or restriction digestion (NEB enzymes). Ribosomal slip 2A sequences were inserted between genes to avoid translation of the fusion proteins. These 2A peptides were designed with GSG linkers at their amino termini, the sequence of which includes a BamH1 restriction enzyme excision site allowing the insertion of additional 2A-linked genes.

The core fragment was generated using sequence from the pGEM-T vector (Promega), which contains ampicillin resistance cassettes and multiple cloning sites (MCS). The pGEM-T sequence is 3 kb, along with 3 kb. homology to the DDX4 start codon (left targeting arm), was derived from a previously constructed DDX4 targeting vector ( HOMOL pGEM-T left arm and ddx4+GFPpuropolyA right arm ), using Xcm1 and Nco1 to excise the 6 kb fragment. n., which was purified using gel purification.

Right targeting arm, consisting of 1.5 kb. homology from the DDX4 start codon was synthesized by PCR using genomic DNA obtained from chicken PGCs (Y2 cells obtained from eggs obtained from NARF (National Avian Research Facility, National Avian Research Center)). The forward primer for this reaction (CGGTGACGTCGAGGAGAATCCTGGACCTATGGAGGAGGATTGGGATACCGAACTCGAGCAGGAGGCGGCAGCGGC, 75 bp), SEQ ID NO: 7, contained a partial sequence for T2A with ribosomal skipping and codon replacement at the CRISPR/Cas9 targeting site so that the repair template could not be cut by the Cas9 protein. The reverse primer for this reaction (GAAATCCAGCTTCCAGTTCCCACCTGGCCAGACAAGGGGCTGCTTGG, 47 bp), SEQ ID NO: 8, contained a 20 bp overhang. from the pGEM-T vector sequence along with nucleotides that reinserted the cutting site for Xcm1 after the overhang.

The final fragment (800 bp) for the DDX4 repair template contained the sequence for eGFP, which was again synthesized by PCR from a previously constructed DDX4 targeting vector, HOMOL pGEM-T left arm and ddx4+GFPpuropolyA right arm . The forward primer (GGTGGGCTGCTGGCATTCGCCATGGTGAGCAAGGGCGAGGA, 41 bp), SEQ ID NO: 9, contained a 20 bp overhang for this reaction. from the left targeting arm along with nucleotides that reinserted the cutting site for Nco1 after the overhang. The reverse primer for this reaction (GATTCTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCTCCGGATCCCTTGTACAGCTCGTCCATGCC, 76 bp), SEQ ID NO: 10, contained the remaining T2A sequence plus 20 bp. ledge for partial T2A sequence in the right shoulder fragment.

For fragment ligation, a mixture of 100 ng of the main fragment along with equimolar amounts of other fragments was incubated with Gibson HiFi DNA Assembly Master Mix enzyme (NEB) for 1 hour at 50°C. XL-10 Gold competent cells were transformed with 2 μl of the ligated plasmid. Mini-preparations obtained from transformed cells were tested by restriction hydrolysis, and maxi-preparations were obtained.

The DAZL repair template was initially constructed using Gibson cloning with plasmid fragments generated by PCR (IDT primers) or restriction digestion (NEB enzymes). IDT allows the synthesis of primers >100 bp in length, which were necessary for this work. A repair matrix was also constructed that included the NTR gene optimized for chickens, the product of which can be used for selective cell ablation when a prodrug is administered.

The core fragment for the targeting template was the 3-kb pGEM-T sequence, which was derived from the DDX4-GFP repair template described above using Xcm1 and Not1 to excise the DNA.

Left targeting arm, consisting of 1.5 kb. homology up to (but not including) the DAZL stop codon was synthesized by PCR using genomic DNA obtained from chicken PGCs (Y2 cells). Direct primer for this reaction

(TCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTCTTCGTGGTT, 67 bp), SEQ ID NO: 11, contained a 25 bp overhang. from the pGEM-T vector sequence along with nucleotides that reinserted the cutting site for Not1 after the overhang. The reverse primer for this reaction (AGGCTGAAGTTAGTAGCTCCGGATCCAACACTTTTGAGCACTGCTCTT, 48 bp), SEQ ID NO: 12, contained a 25 bp overhang. from the P2A sequence with ribosomal slip.

The third fragment (600 bp) contained the P2A sequence followed by an NTR that was excised using BamH1 from the DDX4-GFP-NTR repair template, which in turn was constructed using the DDX4-GFP repair template (linearized using BamH1 and ligated to an insert containing the P2A-NTR sequence).

The fourth fragment (800 bp) contained the sequence for eGFP, which was synthesized by PCR from the DDX4-GFP repair template. Direct primer

(CAGAACATCACCCTGACCGAGGTGGGATCCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAAATCCTGGACCTATGGTGAGCAAGGGCGAGGA, 107 bp), SEQ ID NO: 13, contained a 25 bp overhang for this reaction. from the NTR gene and the sequence for T2A with ribosomal slip. The reverse primer for this reaction (CTTGTACAGCTCGTCCATGCCG, 22 bp), SEQ ID NO: 14, did not contain overhangs.

The fifth and final fragment for the DAZL-GFP targeting template was the right targeting arm, consisting of 1.5 kb. homologies from the DAZL stop codon (inclusive), synthesized by PCR using genomic DNA obtained from chicken PGCs (Y2 cells). The forward primer for this reaction (TCTCGGCATGGACGAGCTGTACAAGTGATGAACAAAGACTTTGAAGTACATAAATGTATTACTTTGATGTTAATACAGTTCAGTTTAGTAAGAT, 94 bp), SEQ ID NO: 15, contained a 25 bp overhang. into the eGFP gene and mutations at the PAM site for the corresponding CRISPR/Cas9 plasmid. The reverse primer for this reaction (CTCTTCGAAATCCAGCTTCCAGTTCCCACCTGGCAATACTATTAAAGCAATAGGT, 55 bp), SEQ ID NO: 16, contained a 25 bp overhang. in the pGEM-T vector sequence along with nucleotides that reinserted the cutting site for Xcm1 after the overhang.

For fragment ligation, a mixture of 100 ng of the main fragment along with equimolar amounts of other fragments was incubated with Gibson HiFi DNA Assembly Master Mix enzyme (NEB) for 2 hours at 50°C. XL-10 Gold competent cells were transformed with 2 μl of the ligated plasmid. Mini-preparations obtained from transformed cells were tested by restriction hydrolysis, and maxi-preparations were obtained.

BamH1 was used to excise the chicken-optimized NTR sequence from the DAZL-GFP repair template. Human and chicken 2A-iCasp9 sequences (iCasp9 and aviCasp9) were excised using BamH1 from their respective pMA vectors and inserted into the open DAZL-GFP repair template by T7 ligation. XL-10 Gold competent cells were transformed with 2 μl of the ligated plasmid. Mini-preparations obtained from transformed cells were tested by restriction digestion, and maxi-preparations were obtained for the DAZL-aviCasp9-GFP repair template (chicken) and the DAZL-iCasp9-GFP repair template (human).

Guide RNA (gRNA) sequences within 150 bp. from the stop codon of the DAZL locus were queried using the CRISPR design tool available at crispr.mit.edu. Forward and reverse oligonucleotides (IDT) for the top 5 guide RNAs (with the first two bases of the guide sequence replaced by GG) were synthesized with Bbs1 cohesive ends. Oligonucleotides were annealed by PCR and ligated into pSpCas9(BB)-2A-Puro (PX459) V2.0 (https://www.addgene.org/62988/) using PCR digestion/ligation mixture. Competent cells were transformed with 2 μl of the ligated plasmid, and maxi-preparations were obtained from transformed colonies. Maxi-preparations of DAZL-PX459 plasmids (nos. 1–5) were verified by PCR using a forward oligonucleotide and a reverse primer complementary to the PX459 plasmid at a distance of 400 bp. downstream of the cut site for guide insertion (Bpi1).

All DNA sequences are shown in Fig. 13-19.

Transfection process

Approximately 150,000 PGCs were transfected with 1 μg of DAZL-iCasp9-GFP repair template (chicken or human) and 1 μg of DAZL-PX459 -4 or -5 using Lipofectamine 3000. After 5 hours in Lipofectamine solution, PGCs were pelleted and resuspended in complete (FAOT) environment. After 24 hours, fresh medium was obtained for the PGCs and 2 μl of 0.1 mg/ml puromycin solution (final concentration 0.04 μg/ml) was added to each well. PGCs were incubated with puromycin for 48 hours, washed once, and resuspended in fresh medium. Cells were cultured for 1–2 weeks to achieve a population of 200,000–400,000 cells and then sorted using FACS to collect successfully modified (GFP-positive) cells. GFP-positive cells were obtained from PGCs transfected with DAZL-PX459 -4 or DAZL-PX459 -5, although only DAZL-PX459 -5 transfected PGCs were used to produce chickens.

DAZL-PX459 -4 contains the following guide sequence: GGTCCTATTCCAGGAGAGGA SEQ ID NO: 17. The PAM site for this guide sequence is located on the forward strand of the genome, at a distance of 44 bp. upstream of the stop codon of the DAZL locus.

DAZL-PX459 -5 contains as its guide sequence: GGCTTACTAAACTGAACTGT SEQ ID NO: 18. The PAM site for this guide sequence is located on the reverse strand of the genome, at a distance of 46 bp. downstream of the stop codon of the DAZL locus. While the PAM site sequence for the guide sequence in DAZL-PX459 -5 was mutated in the homology arm of the final repair template DAZL-iCasp9-GFP, it is noteworthy that the PAM site sequence for the guide sequence in DAZL-PX459 -4 was not mutated.

PGCs were cultured for three weeks to select cells that were stably targeted by GFP-expressing constructs. Female PGCs targeted by ddx4_GFP and dazl_GFP were purified by flow cytometry using FACS-ARIA gated for GFP fluorescence. Purified cells were expanded in culture and analyzed by flow cytometry to quantify the level of GFP fluorescence. GFP cells targeting the DAZL locus were 3.75 times more fluorescent than GFP cells targeting the DDX4 locus (Fig. 4).

Female PGCs targeted by DDX-Ntr, DDX-icaspase9, DAZL-Ntr, DAZL-icaspase9 (human), Dazl-icaspase9 (chicken) were purified in a similar manner.

PGCs containing the targeted nitroreductase gene were treated with the prodrug CB1954. Under the influence of the drug, PZK died. Cells containing NTRs targeting the dazl locus showed a decrease in cell number compared to control cells (Fig. 5).

PGCs containing the targeted icaspase9 gene were treated with a B/B dimerization inducer compound. Control non-targeted PGCs did not show a decrease in PGC numbers when treated with the drug. Cells containing human and chicken caspase9 genes targeted to the dazl locus showed significantly reduced numbers of PGCs (Fig. 6). Cells containing iCaspase 9, which targets the ddx4 locus, showed slightly fewer PTCs. These cells were mixed with control PGCs with red fluorescence and injected into chick embryos. Chick embryos were treated with a B/B dimerization inducer compound. In embryos, only red PGCs and control GFP PGCs were visually detectable. PGCs with Dazl icaspase9 were destroyed (Fig. 7).

Producing chicken targeted by Dazl icaspase9

Dazl iCaspase9 (human) or Dazl aviCaspase9 (chicken), or both in a mixture, were injected into fertilized eggs from DDX4 heterozygous (Z ^- Z) male chickens crossed with wild-type females. 3000 PGCs were injected into stage 16 HH embryos through holes made in the eggs, the eggs were sealed and incubated until hatching. Breeding hatched female founder hens (Z ^- W) produced transgenic offspring containing the targeted transgene (Fig. 8).

Ablation assay of Dazl-iCaspase9 and Dazl-aviCaspase9-targeted chick and germ cells using B/B dimerization inducer reagent

G1 Dazl-icaspase9 and Dazl-aviCaspase9 chickens were raised to sexual maturity and mated with wild-type chickens. Fertilized eggs from matings (G2 embryos) were incubated and examined for GFP expression in the gonads. Germ cells in the gonads of both Dazl-icaspase9 and Dazl-avicaspase9 G2 embryos contained GFP+ cells in the gonad (Fig. 9). Cryosections and immunostaining with an antibody to the germ cell marker DDX4 showed that the cells expressing GFP were germ cells (Fig. 10). G2 embryos were tested for germ cell ablation. 1.0 μl of 0.1 mM B/B dimerization inducer reagent (Takara Bio, Inc) was injected into the bloodstream of day 2.5 chick embryos (Hamburger and Hamilton (HH) stage 16). Embryos were incubated for 8 days, screened by PCR to identify iCaspase9 embryos, and examined for GFP expression in the gonads. Drug-treated G2 Dazl-iCaspase9 and Dazl-aviCaspase9 embryos had no visible GFP expression (Fig. 11). Cryosections and immunostaining with an antibody to the germ cell marker DDX4 demonstrate that there are almost no identifiable DDX4-positive or GFP+ cells in the gonads of Dazl-icaspase9 and Dazl-aviCaspase9 embryos (Fig. 11). To show that exogenous (donor) PGCs can colonize sterilized host G2 Dazl-aviCaspase9 embryos, donor red fluorescent germ cells and a B/B preparation were injected into the embryos. Embryos were incubated for 8 days and examined for fluorescence and germ cells. In the gonad of the G2 aviCaspase9 embryo, only donor germ cells were present; no endogenous (host) germ cells were detected. (Fig. 12).

Germ cell ablation in transgenic chickens

The iCaspase9 tragene was targeted to the DDX4 or DAZL locus in the PGC, and the cells were then exposed to a dimerization inducer drug. It was determined that cells containing a transgene inserted into the DAZL locus were inhibited/killed. Without being limited to any particular theory, the inventors believe that expression levels at stages of embryonic development are important for germ cell ablation.

This is illustrated in FIG. 22.

Using caspase 9 expression targeting the DAZL locus in PGCs, host germ cell ablation and progeny generation from a donor chicken breed were tested using donor chicken PGCs from a black-skinned Chinese silky breed. Donor PGCs were tested by injecting caspase-containing host embryos, which were then grown to sexual maturity and bred. As shown in FIG. 23, offspring from Dazl-Caspase9 hosts injected with PGCs from Chinese silkies and treated with B/B were found to have black skin, indicating that they were derived from donor germ cells.

In more detail, in this embodiment, PGCs of black-skinned Chinese silkies were mixed with a B/B dimerization inducer drug and injected into Dazl-Caspase host embryos while they were in the egg. The eggs were sealed and the embryos hatched and then bred with each other once they reached sexual maturity.

50% of the progeny should be GFP positive if they are derived from endogenous host GFP+ PGCs with caspase9. Some Dazl-aviCaspase9 host progeny were GFP+, and none of the Dazl-iCaspase9 progeny were GFP+ (shown in the table in Fig. 23 A).

In addition, embryonic progeny from the Dazl-Caspase host exhibited the black skin phenotype of Chinese silken chicken donor PGCs (shown in Fig. 23 B). Moreover, the hatched progeny from the Dazl-Caspase host exhibited the black skin phenotype of donor PGCs of Chinese silkies (shown in Fig. 23 C).

Although the invention has been specifically illustrated and described with reference to specific examples, those skilled in the art will appreciate that various changes in form and detail may be made thereto without departing from the scope of the present invention.

--->

LIST OF SEQUENCES

<110> The University Court of the University of Edinburgh

<120> GENETICALLY MODIFIED STERILE BIRDS AND THEIR METHOD

REPRODUCTION

<130> P191530.WO.01

<150>GB1816633.0

<151> 2018-10-12

<160> 18

<170> Patent In version 3.5

<210> 1

<211> 1317

<212> DNA

<213> Artificial sequence

<220>

<223> mutant site 2a-iCaspase9-Bam H1

<400> 1

ggatccggag ctactaactt cagcctgctg aagcaggctg gagacgtgga ggagaaccct

60

ggacctatgc tcgagggagt gcaggtggag actatctccc caggagacgg gcgcaccttc

120

cccaagcgcg gccagacctg cgtggtgcac tacaccggga tgcttgaaga tggaaagaaa

180

gttgattcct cccgggacag aaacaagccc tttaagttta tgctaggcaa gcaggaggtg

240

atccgaggct gggaagaagg ggttgcccag atgagtgtgg gtcagagagc caaactgact

300

atatctccag attatgccta tggtgccact gggcaccag gcatcatccc accacatgcc

360

actctcgtct tcgatgtgga gcttctaaaa ctggaatctg gcggtggttc cggagtcgac

420

ggatttggtg atgtcggtgc tcttgagagt ttgaggggaa atgcagattt ggcttacatc

480

ctgagcatgg agccctgtgg ccactgcctc attatcaaca atgtgaactt ctgccgtgag

540

tccgggctcc gcacccgcac tggctccaac atcgactgtg agaagttgcg gcgtcgcttc

600

tcctcgctgc atttcatggt ggaggtgaag ggcgacctga ctgccaagaa aatggtgctg

660

gctttgctgg agctggcgcg gcaggaccac ggtgctctgg actgctgcgt ggtggtcatt

720

ctctctcacg gctgtcaggc cagccacctg cagttcccag gggctgtcta cggcacagat

780

ggatgccctg tgtcggtcga gaagattgtg aacatcttca atgggaccag ctgccccagc

840

ctgggaggga agcccaagct ctttttcatc caggcctgtg gtggggagca gaaagaccat

900

gggtttgagg tggcctccac ttcccctgaa gacgagtccc ctggcagtaa ccccgagcca

960

gatgccaccc cgttccagga aggtttgagg accttcgacc agctggacgc catatctagt

1020

ttgcccacac ccagtgacat ctttgtgtcc tactctactt tcccaggttt tgtttcctgg

1080

agggacccca agagtggctc ctggtacgtt gagaccctgg acgacatctt tgagcagtgg

1140

gctcactctg aagacctgca gtccctcctg cttagggtcg ctaatgctgt ttcggtgaaa

1200

gggatttata aacagatgcc tggttgcttt aatttcctcc ggaaaaaact tttctttaaa

1260

acatcagtcg actatccgta cgacgtacca gactacgcac tcgacctcga cggatcc

1317

<210> 2

<211> 1315

<212> DNA

<213> Artificial sequence

<220>

<223> 2a-aviCaspase9

<400> 2

agggatccgg agctactaac ttcagcctgc tgaagcaggc tggagacgtg gaggagaacc

60

ctggacctat gctcgaggga gtgcaggtgg agactatctc cccaggagac gggcgcacct

120

tccccaagcg cggccagacc tgcgtggtgc actacaccgg gatgcttgaa gatggaaaga

180

aagttgattc ctcccgggac agaaacaagc cctttaagtt tatgcttggc aagcaggagg

240

tgatccgagg ctgggaagaa ggggttgccc agatgagtgt gggtcagaga gccaaactga

300

ctatatctcc agattatgcc tatggtgcca ctgggcaccc aggcatcatc ccaccacatg

360

ccactctcgt cttcgatgtg gagcttctaa aactggaatc tggcggtggt tccggagtcg

420

acggtgtctc tgtgaattgc agaccagcta ggatgcatgc tagtgcatgc caggtgtacc

480

agctgcgagc agacccttgt gggcactgcc tgatcttcaa caatgtcagc ttcagcagag

540

actctgatct gtcgactcga gctggctctg acatagactg tgagaagctg gagaagcgtt

600

tcaggtccct gtgcttccac gtccggaccc tgcggaacct caaagctcag gaaattgatg

660

tggagctgcg gaagctggcg cggctcgacc acagtgccct ggactgctgc ctcgtggtca

720

tcctctccca tggttgccag acaagccata ttcagtttcc cggagggatt tatggaacag

780

atggcaaaat cattccaatc gaaaggattg tgaactattt caatgggtcc cagtgcccga

840

gtttgagagg aaaacccaaa ctcttcttca tccaggcctg tggaggagaa caaaaggacc

900

aaggatttga ggtggattgt gaatcacccc aagatgaaac ttgccgacgt tccatagagt

960

cggatgcgat tcctttccag gctccatcag ggaatgagga cgagccagac gccgtcgcca

1020

gtttgcccac tcctggtgac atcttggtgt cctattcaac ttttccaggt tttgtgtcct

1080

ggagggacaa ggtgagtggc tcgtggtacg tggaaacctt ggacagcgta ctggaacatt

1140

acgcccgttc tgaagacctg cttaccatgc tacttcgggt gtcagacatc gtatccacca

1200

aggggaggta caagcagatc ccgggctgtt tcaacttcct tcgtaaaaaa ttcttcttcc

1260

tgtgcaaggt cgactatccg tacgacgtac cagactacgc actcgacgga tccaa

1315

<210> 3

<211> 5985

<212> DNA

<213> Artificial sequence

<220>

<223> Leftarm-GFP-2a-Nitroreductase-T2a-Right arm

<400> 3

tttttttctt tgagatgagt atcttattgc agctctgtgc ataccccttg aaaatccgta

60

ggtgatgtat ttatgttgac tgaaaatgga gtcattcaaa aattgatgac ttcttccttt

120

tctcttttta atctcgaaac ctgttctcag attcctttat cagaacaaaa agcacggctg

180

catgtttttc accgttcaca cgactgtgtt tagccagcgt atctaaatgc ataacatgat

240

ttgccataac ttgagcctgc cataatcaga gcctcatttt gaaagctgtc atggtctgaa

300

acatagcatg ggtaagatga ttttcacctt gatgatgcat gtttaactca tttcaacgag

360

aggtcaaatc catccaaaaa tgctaaatct atcaaccagt tttcatgttc aagttctggc

420

acaaattttc gttctgactc catacgtgat tagatttcat tttgcaaatc atgaaaacta

480

ttgccaaaac atacaatttt aagtcagcag ttttactgcc caaatttgca caagcacatg

540

taacgtgaca gacaaaaacc cactggacag agacaaaata ctgggtttgg ccagtatggt

600

ttggctaagc cacgtttttc agggcaagaa ttgcctcacc ttttttttata ttggaatcaa

660

attctcaagt gtaacagcct ggcgccatct cagctgccat taagtagcat gtgctgcaac

720

aagatgtcta ccacacactc tgctctgggt ggtggggggca caccagtgtg gacggcaacc

780

atgacacaag catagagtct tggcagaggt ccattgggtg catttatagt ggttcacact

840

ggggggttat cacagaatca tggaggttgg aaggtacctc cggggggtcat caaatccaac

900

cacttgacaa agcaggttcc ctaaagtaga ttgctcaaga acagtcacag cactgctgct

960

cacagaaaat ctctagttgg taaggttacc tttttttttg ttgtcgctcc cagttaaacc

1020

aaggtgggaa cacatccttt tcatagttgt attgtaggga tgtttatagc tattgctagg

1080

gaaaactgaa cagcgtgcaa ggaagtcagc actgacacag ctttcccacg tgagagagct

1140

atttcaaagc aagatcagca catatcccaa tctgtacttc ctcaaacaca gcccaaaacc

1200

gatagcaagg ccaagcagca gcactgctcc ttcaaggaaa ctgctgcata atctgaattt

1260

cagacggcag gaggaaacaa ggcagcagac tgatgaccta ccaccctgag tctcagctac

1320

atgcgatccg agccactcca actctgcttc ctgcagccct tccttcacgc tcatcttttg

1380

caccttaggc actcttataa ttcaagtact ttgtggcttt gggatatttg aagagcttgg

1440

tcagttagtc acaagtctgg ccacgtgcta tcatattagt ttgaaaagca atggagacac

1500

catctgctga tgctcaaagt ggttacaacc aaaacacaaa aaagcagagc tgtgggaaga

1560

attcaacatt ttgattatgc aagaagctag tcccagcctt gaaatccacc atctgcatca

1620

tgaaagacct aagtagttaa agccacagca gacatacagc ttctatttcc ttaccttctt

1680

catcattaac tacaggtctt ggaagatttt tgctgggaaa aagcttttat tgcaagaact

1740

gtaatttatt aacagggaaa catgaaataa atgtgtaaat tctcctgcac tcccactgtc

1800

attaaaaacg gctttaagaa agagtattca gtaactgcct gcattgtgtt gtgactttct

1860

actctgtgac acacagcctt ctgggcaaag cacatattct gccatgcatg tgggtcgtgc

1920

cttggaaaat gggaacccac attcactgag ggcctcttga tgagctttcc ccttgagaac

1980

agcgaggtct catggatatc ttctcttctc caagccaaat aagcccagat ccctcagctt

2040

tccttcatgg agaggctcca gccctctgat catgcctgca gcccttctct ggacctgctc

2100

cagcagcccc acacgctcct catgctggga ccccagatct gcacatggta ttgcacatgg

2160

ggcctcacaa cggcagagct gagagggaca attccctccc tcagccttta attctgcacg

2220

tacttaattt tgtctgtatt ttttttgcaa tagaatagcc tgcatgctag ttgctgtgtc

2280

gcacagctga attcactagg ttcctgtgaa acaaagggca atcccacagc cactgtagca

2340

cgtgaggagc cacacaggtg ctctaattcc tacaggacag gcctagggac agagcggccc

2400

taggactgcc ctcccgcacc tcctagcttc accttttgcc cgcgatcttt aagtaccctg

2460

aagcataaac agggaaagcg ccgcccgcag cctcaccctg cttcccgccc aacgcggcac

2520

cgcccaggcc gcagccgccc actaagagca ctagcgccac cttctcaccc cacccccacc

2580

acgcgttcct agcggccctg agagctgctg cgcatgcgcc gcctgacgat tcgccctccc

2640

attggctggc ggtcgaagca cggcggggggc acgcggtggc ggctatataa ggcgtctcgg

2700

aagacggcgc catgctattt ggagcggaga gtgaaagtta cagttcctgg tgctggtagg

2760

gagtgtggcg cggagcggag cgctgcggct catcggaacc acaatggagc catagcagag

2820

ccgggcgtgg gggcaagggc agtgcgtgct ggggagggct ccgtcgcgtg gccacgtcgc

2880

gagagccgtc gggatggtgg cgtcagggcg gggggtgctg ctaacgtgct cctggtcctg

2940

caggtgggct gctggcattc gccatggtga gcaagggcga ggagctgttc accggggtgg

3000

tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg

3060

agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca

3120

agctgcccgt gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca

3180

gccgctaccc cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct

3240

acgtccagga gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg

3300

tgaagttcga gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg

3360

aggacggcaa catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata

3420

tcatggccga caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg

3480

aggacggcag cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc

3540

ccgtgctgct gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca

3600

acgagaagcg cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg

3660

gcatggacga gctgtacaag ggatccggag ctactaactt cagcctgctg aagcaggctg

3720

gagacgtgga ggagaaccct ggacctatgg atatcatcag cgtggccctg aagagacaca

3780

gcaccaaggc cttcgatgcc agcaagaagc tgacccccga gcaggccgag cagatcaaga

3840

ccctgctgca gtacagcccc agcagccaga acagccagcc ctggcacttc atcgtggcca

3900

gcaccgagga aggcaaggcc agagtggcca agagcgccgc cggcaactac gtgttcagcg

3960

agagaaagat gctggatgcc agccacgtgg tggtgttctg cgccaagacc gctatggatg

4020

atgtgtggct gaagctggtg gtggatcagg aggatgccga tggcagattc gccacccccg

4080

aggccaaggc cgccaacgat aagggcagaa agttcaccgc cgatatgcac agaaaggatc

4140

tgcacgatga tgccgagtgg atggccaagc aggtgtacct gaacgtgggc aacttcctgc

4200

tcggcgtggc cgccctgggc ctggatgccg tgcccatcga gggcttcgat gccgccatcc

4260

tggatgccga gttcggcctg aaggagaagg gctacaccag cctggtggtg gtgcccgtgg

4320

gccaccacag cgtggaggat ttcaacgcca ccctccccaa gagcagactg ccccagaaca

4380

tcaccctgac cgaggtggga tccggagagg gcagaggaag tctgctaaca tgcggtgacg

4440

tcgaggagaa tcctggacct atggaggagg attgggatac cgaactcgag caggaggcgg

4500

cagcggcttc ccaggggcgt tctgaggagc aggcgtggat ggtgagctgt gtccagggga

4560

gggcggtgcg gcagggagcg gggcactggg atggcccggt ctgggaaggg gaggccgaga

4620

ggccttcgca gtgcttcctg cagctccccg agcagtgcga agaaggaggt gccgggctct

4680

gctgtgggag ccgaaggcac ggagctgcct ggggagggaa tggctgtgtg cctgaggtgc

4740

cagagaccgg caagggctgt acagagaggc aacggttttg tgtacaaatc atttgtatgg

4800

gaaaccacaa aatcttgaag ctttattaca tggcagcgaa atactttggt gtgaagtaaa

4860

ggataagata gaggagtgta atgagagaca gctaaataat attttactac ttgtgggatg

4920

agtgaatatc aggaggaact gctgtaaatt tcaggaggac ctgttgtgaa tcttcagtag

4980

ttggcgccgc tcttacacat cttacagatg ccccttgagc aaagggggat aaggagagat

5040

gaacgggtta tccaaacagg tgatgagcta aaagtacagt tgcctaaaga agtagtagca

5100

tgtgctatca gaatgataat tttgttagtt tggggttagt ttcctgtagt ggtagatagc

5160

cacaacaaga aaaccgctta agtttttgta aaacaaaaaa agcacgatcc agaagtaaaa

5220

aatatgggta gttttttttg atgttcctct ctcacctggt gctttggcat actaatatgt

5280

gtctaattgt attaaacagg agaaatttaa acctaggctt tgctggaaat aaaatgttac

5340

aatgctacaa tgtgaaaagt aggtgctatt ctgaactgtt ttgggtggag tatctgaatc

5400

tttgaataat ttaagaggga ctgacatatt taaaatactt aaggataatc tgtagccatg

5460

ctgtaaaaga acaacagaaa tgcagttggg aaggtgatgg aaatagtttt attcatgtta

5520

ctggtggtct gaaacctttc taagcttaaa ctgtagaaaa aaattgcttc aaaagattgc

5580

actattactt tgggcgacaa atgtttttaa ttggttttaa gtgtttgtta gcaaagtgaa

5640

gttgatgcca ccataagtct gacaggaggc aagataaact tgtcttcata ctgcttgtgt

5700

ataacttggt tttgatgaca tttgtgtgtg aacattatgc acttcagtgt agcgaagttt

5760

aagaaacttt gaacagaata acttgaaaga gtgtgcacat gggtgcagaa gtcactttat

5820

ttcagttggg agacttagca cctaaatgca ctgttagttc acatacactt tgcttggcct

5880

gaaggtaaca ttgtgatgtc gctttttttc cctgtaggct aactctggca gaccaaacag

5940

cccatccctc cgcttctcca gcagaccaag cagccccttg tctgg

5985

<210> 4

<211> 5155

<212> DNA

<213> Artificial sequence

<220>

<223> Left arm-2a-aviCaspase9-T2a-GFP-Right arm

<400> 4

cttcgtggct tggtgaagag atcttctgac ctcttcatca ccccctagaa ttaaggctgt

60

aatcatcatt tcagccatg cttaatccac tataatttct gcatgatttc agaaggctat

120

cttgcttcct tgaaactaat aatacctagt ttgtagtgtt tagggatgtg taaaatgtgt

180

ttatgtcaag attttagtta gtctgataag aattgtggaa gaattgcagc tactaaaaag

240

gcagactggg tagcacttcc caccttactc agatttagga gtctcaagac atgtagatgg

300

gtgaaattta ttattctttt ctctgcttgc ttttctggaa agctacctct atttggccag

360

cagttggctc tgaattcctt tctttaaagg agacctgact gctctcctgt ctgcctctta

420

cacagctgta ctggtgtgtc actgatagaa acgtttacct tgaaagtgac aagtgggggc

480

gttgataccc attaacaaca ttaaagggaa aatttcagga aacaagaaaa ctgagaggag

540

ttcagaatga aatgtaagcc ctgtgacaga ctcacactga tggtagtagg gtaactgatg

600

gagatgcatc tataacaatt ctaactttta tttcagaagt ctgtggacag gagcatacaa

660

acagtagtat cttgtctgtt taaccctgaa aaccgtctga ggaacacctt tgtatcacaa

720

gaagactact tcagggtatg tagtgaaagc aaaactaaat ctctaaaacc agctgatctt

780

aactttgttc atatacagga tgccatgaag acaaaggttt atctgtactt gcttgagatt

840

ttactttttg tatgtgcatt gagatgaatg actggttagc tctcagttgg ttaatactca

900

atgaaaattg cagaaattga gttcagtgga tttaagtgca ttgatacaag gctgcataag

960

aactgctgag cagtcagcta ttggatattt agagctaatc atccctcagg agcaatctgc

1020

tgaaaggtaa gcagattgca tcttgtaaac gagagagcag agttaaacgt ttgtggtctt

1080

tgctccactt aagtacccac agtggatgtc tatctgtact tttggttaaa aaatagataa

1140

tttctacaac agactgtagt taggtcagta cctggtcatc aggtattaat ggaaagcttt

1200

ttgctgtgca ttcaatcttc atagaggtct gctttccaat tacattctct ttgttttaag

1260

tataactttg aaactcaaat ataaaagcct gctacttttt tttgttctaa aaagacagat

1320

gtggactagg cacctgtact gtgaaaccag aatagagaag ctgttgggca gatttgaaga

1380

ggattgagta atatagagaa tgtcttgaga tatttgtgaa gcttttattg ctttgttgca

1440

attgttgtct agaaacatgg gctttttctg ttttttctcc tattccagga gaggagggcg

1500

catcacttca gaaaaggaag agcagtgctc aaaagtgttg gatccggagc tactaacttc

1560

agcctgctga agcaggctgg agacgtggag gagaaccctg gacctatgct cgagggagtg

1620

caggtggaga ctatctcccc aggagacggg cgcaccttcc ccaagcgcgg ccagacctgc

1680

gtggtgcact acaccgggat gcttgaagat ggaaagaaag ttgattcctc ccgggacaga

1740

aacaagccct ttaagtttat gcttggcaag caggaggtga tccgaggctg ggaagaaggg

1800

gttgcccaga tgagtgtggg tcagagagcc aaactgacta tatctccaga ttatgcctat

1860

ggtgccactg ggcacccagg catcatccca ccacatgcca ctctcgtctt cgatgtggag

1920

cttctaaaac tggaatctgg cggtggttcc ggagtcgacg gtgtctctgt gaattgcaga

1980

ccagctagga tgcatgctag tgcatgccag gtgtaccagc tgcgagcaga cccttgtggg

2040

cactgcctga tcttcaacaa tgtcagcttc agcagagact ctgatctgtc gactcgagct

2100

ggctctgaca tagactgtga gaagctggag aagcgtttca ggtccctgtg cttccacgtc

2160

cggaccctgc ggaacctcaa agctcaggaa attgatgtgg agctgcggaa gctggcgcgg

2220

ctcgaccaca gtgccctgga ctgctgcctc gtggtcatcc tctcccatgg ttgccagaca

2280

agccatattc agtttcccgg agggatttat ggaacagatg gcaaaatcat tccaatcgaa

2340

aggattgtga actatttcaa tgggtcccag tgcccgagtt tgagaggaaa acccaaactc

2400

ttcttcatcc aggcctgtgg aggagaacaa aaggaccaag gatttgaggt ggattgtgaa

2460

tcaccccaag atgaaacttg ccgacgttcc atagagtcgg atgcgattcc tttccaggct

2520

ccatcaggga atgaggacga gccagacgcc gtcgccagtt tgcccactcc tggtgacatc

2580

ttggtgtcct attcaacttt tccaggtttt gtgtcctgga gggacaaggt gagtggctcg

2640

tggtacgtgg aaaccttgga cagcgtactg gaacattacg cccgttctga agacctgctt

2700

accatgctac ttcgggtgtc agacatcgta tccaccaagg ggaggtacaa gcagatcccg

2760

ggctgtttca acttccttcg taaaaaattc ttcttcctgt gcaaggtcga ctatccgtac

2820

gacgtaccag actacgcact cgacggatcc ggagagggca gaggaagtct gctaacatgc

2880

ggtgacgtcg aggagaatcc tggacctatg gtgagcaagg gcgaggagct gttcaccggg

2940

gtggtgccca tcctggtcga gctggacggc gacgtaaacg gccacaagtt cagcgtgtcc

3000

ggcgagggcg agggcgatgc cacctacggc aagctgaccc tgaagttcat ctgcaccacc

3060

ggcaagctgc ccgtgccctg gcccaccctc gtgaccaccc tgacctacgg cgtgcagtgc

3120

ttcagccgct accccgacca catgaagcag cacgacttct tcaagtccgc catgcccgaa

3180

ggctacgtcc aggagcgcac catcttcttc aaggacgacg gcaactacaa gacccgcgcc

3240

gaggtgaagt tcgagggcga caccctggtg aaccgcatcg agctgaaggg catcgacttc

3300

aaggaggacg gcaacatcct ggggcacaag ctggagtaca actacaacag ccacaacgtc

3360

tatatcatgg ccgacaagca gaagaacggc atcaaggtga acttcaagat ccgccacaac

3420

atcgaggacg gcagcgtgca gctcgccgac cactaccagc agaacacccc catcggcgac

3480

ggccccgtgc tgctgcccga caaccactac ctgagcaccc agtccgccct gagcaaagac

3540

cccaacgaga agcgcgatca catggtcctg ctggagttcg tgaccgccgc cgggatcact

3600

ctcggcatgg acgagctgta caagtgatga acaaagactt tgaagtacat aaatgtatta

3660

ctttgatgtt aatacagttc agtttagtaa gatgtgtagt aaaaagtgta accttgttca

3720

aaaagttgct tcaagttgat gtttgtgttc tgttttacct gttccagaat agctattttt

3780

gcttgagaag tttgaagttg taagagttga aatatttcca ggttttatta ctagcttgca

3840

tgcttttcct gctaactaac tgaaatgcta atcttaagga atttatatgg ggaaggggaa

3900

aaaagaaaaa cactttgttt ggtacgtgtg gattttcttc tgagctttaa ggtacagttt

3960

gttgcatgtt aaaatttagt tcttattaaa ccacaacttt aagttactaa cgtcaaccag

4020

ttacctcttg cagttcaaaa gttgaagcag ttccttgtcc aagatggagt attttaaaac

4080

tgagctctta atcagtggaa cagaagacgt cacggtgtaa ctcaactgaa gccctttaag

4140

tcccggttct ctttagacta cctaatcaat gtctttgttt gctaacgaca gtttatctat

4200

gtgaatccta aaattcctat atgtaactta agatgcaaga atgtaattag ttacattggc

4260

tgctcagtgg agtatgactt ttttttttac tggattaatt ttagcaatac ctgtatctta

4320

aaattgtgag aaaatactgc atttaaaata tgcctaactt tgtgatgcaa tatgttaatc

4380

aaagaataca tgtaagcata ttttaataat aattatgtag attttagtca tgtattttga

4440

aacaattaaa atttttaatt ttgacttacc ttcccagtgt gagtgacatc ctaatataat

4500

acttctaaat cttaagctgc tttgagaaag gcatgcagcg tatttattga aggaattgaa

4560

gatttcttac cctacataag aattccagtt aggacaagtt tatagcaaca aactttcaca

4620

tttgctgtta gttctacctg cgattttgaa ggagtacaac tgagaacagc actcagtctt

4680

gtatgtgtgt tgggtcctag tctgattcat ttttcttatt actaccctta tacctcagtc

4740

tccaagtaaa aaaggaaata actcctcctt tgtagacgtg tatatgtgaa tgaatagaat

4800

ggcatgtccc acttcaaatg tctagaagta gatgttggtg aaacatgcaa taagagctga

4860

gttgctctgt acctggatag tgggctgtaa gatgcagcac aggagtgtcc caggactgtt

4920

gttcaggagt aggagtcagg ggagggaggc agggcttggg ggatagcaat aatagttggt

4980

gccgttctcc ataaaattac tcagaagcaa tgttctggca gcataaatcg acctaaagtt

5040

gttaactttt tctctgctca gaccgttccc tagcactaaa gatgctgtgt ccttaagtgt

5100

gtttccatac tatccatcac catgtttttc ccaacctatt gctttaatag tattg

5155

<210> 5

<211> 5161

<212> DNA

<213> Artificial sequence

<220>

<223> Left arm-2a-iCaspase9-T2a-GFP-Right arm

<400> 5

cttcgtggct tggtgaagag atcttctgac ctcttcatca ccccctagaa ttaaggctgt

60

aatcatcatt tcagccatg cttaatccac tataatttct gcatgatttc agaaggctat

120

cttgcttcct tgaaactaat aatacctagt ttgtagtgtt tagggatgtg taaaatgtgt

180

ttatgtcaag attttagtta gtctgataag aattgtggaa gaattgcagc tactaaaaag

240

gcagactggg tagcacttcc caccttactc agatttagga gtctcaagac atgtagatgg

300

gtgaaattta ttattctttt ctctgcttgc ttttctggaa agctacctct atttggccag

360

cagttggctc tgaattcctt tctttaaagg agacctgact gctctcctgt ctgcctctta

420

cacagctgta ctggtgtgtc actgatagaa acgtttacct tgaaagtgac aagtgggggc

480

gttgataccc attaacaaca ttaaagggaa aatttcagga aacaagaaaa ctgagaggag

540

ttcagaatga aatgtaagcc ctgtgacaga ctcacactga tggtagtagg gtaactgatg

600

gagatgcatc tataacaatt ctaactttta tttcagaagt ctgtggacag gagcatacaa

660

acagtagtat cttgtctgtt taaccctgaa aaccgtctga ggaacacctt tgtatcacaa

720

gaagactact tcagggtatg tagtgaaagc aaaactaaat ctctaaaacc agctgatctt

780

aactttgttc atatacagga tgccatgaag acaaaggttt atctgtactt gcttgagatt

840

ttactttttg tatgtgcatt gagatgaatg actggttagc tctcagttgg ttaatactca

900

atgaaaattg cagaaattga gttcagtgga tttaagtgca ttgatacaag gctgcataag

960

aactgctgag cagtcagcta ttggatattt agagctaatc atccctcagg agcaatctgc

1020

tgaaaggtaa gcagattgca tcttgtaaac gagagagcag agttaaacgt ttgtggtctt

1080

tgctccactt aagtacccac agtggatgtc tatctgtact tttggttaaa aaatagataa

1140

tttctacaac agactgtagt taggtcagta cctggtcatc aggtattaat ggaaagcttt

1200

ttgctgtgca ttcaatcttc atagaggtct gctttccaat tacattctct ttgttttaag

1260

tataactttg aaactcaaat ataaaagcct gctacttttt tttgttctaa aaagacagat

1320

gtggactagg cacctgtact gtgaaaccag aatagagaag ctgttgggca gatttgaaga

1380

ggattgagta atatagagaa tgtcttgaga tatttgtgaa gcttttattg ctttgttgca

1440

attgttgtct agaaacatgg gctttttctg ttttttctcc tattccagga gaggagggcg

1500

catcacttca gaaaaggaag agcagtgctc aaaagtgttg gatccggagc tactaacttc

1560

agcctgctga agcaggctgg agacgtggag gagaaccctg gacctatgct cgagggagtg

1620

caggtggaga ctatctcccc aggagacggg cgcaccttcc ccaagcgcgg ccagacctgc

1680

gtggtgcact acaccgggat gcttgaagat ggaaagaaag ttgattcctc ccgggacaga

1740

aacaagccct ttaagtttat gctaggcaag caggaggtga tccgaggctg ggaagaaggg

1800

gttgcccaga tgagtgtggg tcagagagcc aaactgacta tatctccaga ttatgcctat

1860

ggtgccactg ggcacccagg catcatccca ccacatgcca ctctcgtctt cgatgtggag

1920

cttctaaaac tggaatctgg cggtggttcc ggagtcgacg gatttggtga tgtcggtgct

1980

cttgagagtt tgaggggaaa tgcagatttg gcttacatcc tgagcatgga gccctgtggc

2040

cactgcctca ttatcaacaa tgtgaacttc tgccgtgagt ccgggctccg cacccgcact

2100

ggctccaaca tcgactgtga gaagttgcgg cgtcgcttct cctcgctgca tttcatggtg

2160

gaggtgaagg gcgacctgac tgccaagaaa atggtgctgg ctttgctgga gctggcgcgg

2220

caggaccacg gtgctctgga ctgctgcgtg gtggtcattc tctctcacgg ctgtcaggcc

2280

agccacctgc agttcccagg ggctgtctac ggcacagatg gatgccctgt gtcggtcgag

2340

aagattgtga acatcttcaa tgggaccagc tgccccagcc tgggagggaa gcccaagctc

2400

tttttcatcc aggcctgtgg tggggagcag aaagaccatg ggtttgaggt ggcctccact

2460

tcccctgaag acgagtcccc tggcagtaac cccgagccag atgccacccc gttccaggaa

2520

ggtttgagga ccttcgacca gctggacgcc atatctagtt tgcccacacc cagtgacatc

2580

tttgtgtcct actctacttt cccaggtttt gtttcctgga gggaccccaa gagtggctcc

2640

tggtacgttg agaccctgga cgacatcttt gagcagtggg ctcactctga agacctgcag

2700

tccctcctgc ttagggtcgc taatgctgtt tcggtgaaag ggatttataa acagatgcct

2760

ggttgcttta atttcctccg gaaaaaactt ttctttaaaa catcagtcga ctatccgtac

2820

gacgtaccag actacgcact cgacctcgac ggatccggag agggcagagg aagtctgcta

2880

acatgcggtg acgtcgagga gaatcctgga cctatggtga gcaagggcga ggagctgttc

2940

accggggtgg tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagttcagc

3000

gtgtccggcg agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc

3060

accaccggca agctgcccgt gccctggccc accctcgtga ccaccctgac ctacggcgtg

3120

cagtgcttca gccgctaccc cgaccacatg aagcagcacg acttcttcaa gtccgccatg

3180

cccgaaggct acgtccagga gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc

3240

cgcgccgagg tgaagttcga gggcgacacc ctggtgaacc gcatcgagct gaagggcatc

3300

gacttcaagg aggacggcaa catcctgggg cacaagctgg agtacaacta caacagccac

3360

aacgtctata tcatggccga caagcagaag aacggcatca aggtgaactt caagatccgc

3420

cacaacatcg aggacggcag cgtgcagctc gccgaccact accagcagaa cacccccatc

3480

ggcgacggcc ccgtgctgct gcccgacaac cactacctga gcacccagtc cgccctgagc

3540

aaagacccca acgagaagcg cgatcacatg gtcctgctgg agttcgtgac cgccgccggg

3600

atcactctcg gcatggacga gctgtacaag tgatgaacaa agactttgaa gtacataaat

3660

gtattacttt gatgttaata cagttcagtt tagtaagatg tgtagtaaaa agtgtaacct

3720

tgttcaaaaa gttgcttcaa gttgatgttt gtgttctgtt ttacctgttc cagaatagct

3780

atttttgctt gagaagtttg aagttgtaag agttgaaata tttccaggtt ttattactag

3840

cttgcatgct tttcctgcta actaactgaa atgctaatct taaggaattt atatggggaa

3900

ggggaaaaaa gaaaaacact ttgtttggta cgtgtggatt ttcttctgag ctttaaggta

3960

cagtttgttg catgttaaaa tttagttctt attaaaccac aactttaagt tactaacgtc

4020

aaccagttac ctcttgcagt tcaaaagttg aagcagttcc ttgtccaaga tggagtattt

4080

taaaactgag ctcttaatca gtggaacaga agacgtcacg gtgtaactca actgaagccc

4140

tttaagtccc ggttctcttt agactaccta atcaatgtct ttgtttgcta acgacagttt

4200

atctatgtga atcctaaaat tcctatatgt aacttaagat gcaagaatgt aattagttac

4260

attggctgct cagtggagta tgactttttt ttttactgga ttaattttag caatacctgt

4320

atcttaaaat tgtgagaaaa tactgcattt aaaatatgcc taactttgtg atgcaatatg

4380

ttaatcaaag aatacatgta agcatatttt aataataatt atgtagattt tagtcatgta

4440

ttttgaaaca attaaaattt ttaattttga cttaccttcc cagtgtgagt gacatcctaa

4500

tataatactt ctaaatctta agctgctttg agaaaggcat gcagcgtatt tattgaagga

4560

attgaagatt tcttacccta cataagaatt ccagttagga caagtttata gcaacaaact

4620

ttcacatttg ctgttagttc tacctgcgat tttgaaggag tacaactgag aacagcactc

4680

agtcttgtat gtgtgttggg tcctagtctg attcattttt cttattacta cccttatacc

4740

tcagtctcca agtaaaaaag gaaataactc ctcctttgta gacgtgtata tgtgaatgaa

4800

tagaatggca tgtcccactt caaatgtcta gaagtagatg ttggtgaaac atgcaataag

4860

agctgagttg ctctgtacct ggatagtggg ctgtaagatg cagcacagga gtgtcccagg

4920

actgttgttc aggagtagga gtcaggggag ggaggcaggg cttgggggat agcaataata

4980

gttggtgccg ttctccataa aattactcag aagcaatgtt ctggcagcat aaatcgacct

5040

aaagttgtta actttttctc tgctcagacc gttccctagc actaaagatg ctgtgtcctt

5100

aagtgtgttt ccatactatc catcaccatg tttttcccaa cctattgctt taatagtatt

5160

g

5161

<210> 6

<211> 6579

<212> DNA

<213> Artificial sequence

<220>

<223> Left arm-GFP-2a-iCaspase9-T2a-Right arm

<400> 6

tttttttctt tgagatgagt atcttattgc agctctgtgc ataccccttg aaaatccgta

60

ggtgatgtat ttatgttgac tgaaaatgga gtcattcaaa aattgatgac ttcttccttt

120

tctcttttta atctcgaaac ctgttctcag attcctttat cagaacaaaa agcacggctg

180

catgtttttc accgttcaca cgactgtgtt tagccagcgt atctaaatgc ataacatgat

240

ttgccataac ttgagcctgc cataatcaga gcctcatttt gaaagctgtc atggtctgaa

300

acatagcatg ggtaagatga ttttcacctt gatgatgcat gtttaactca tttcaacgag

360

aggtcaaatc catccaaaaa tgctaaatct atcaaccagt tttcatgttc aagttctggc

420

acaaattttc gttctgactc catacgtgat tagatttcat tttgcaaatc atgaaaacta

480

ttgccaaaac atacaatttt aagtcagcag ttttactgcc caaatttgca caagcacatg

540

taacgtgaca gacaaaaacc cactggacag agacaaaata ctgggtttgg ccagtatggt

600

ttggctaagc cacgtttttc agggcaagaa ttgcctcacc ttttttttata ttggaatcaa

660

attctcaagt gtaacagcct ggcgccatct cagctgccat taagtagcat gtgctgcaac

720

aagatgtcta ccacacactc tgctctgggt ggtggggggca caccagtgtg gacggcaacc

780

atgacacaag catagagtct tggcagaggt ccattgggtg catttatagt ggttcacact

840

ggggggttat cacagaatca tggaggttgg aaggtacctc cggggggtcat caaatccaac

900

cacttgacaa agcaggttcc ctaaagtaga ttgctcaaga acagtcacag cactgctgct

960

cacagaaaat ctctagttgg taaggttacc tttttttttg ttgtcgctcc cagttaaacc

1020

aaggtgggaa cacatccttt tcatagttgt attgtaggga tgtttatagc tattgctagg

1080

gaaaactgaa cagcgtgcaa ggaagtcagc actgacacag ctttcccacg tgagagagct

1140

atttcaaagc aagatcagca catatcccaa tctgtacttc ctcaaacaca gcccaaaacc

1200

gatagcaagg ccaagcagca gcactgctcc ttcaaggaaa ctgctgcata atctgaattt

1260

cagacggcag gaggaaacaa ggcagcagac tgatgaccta ccaccctgag tctcagctac

1320

atgcgatccg agccactcca actctgcttc ctgcagccct tccttcacgc tcatcttttg

1380

caccttaggc actcttataa ttcaagtact ttgtggcttt gggatatttg aagagcttgg

1440

tcagttagtc acaagtctgg ccacgtgcta tcatattagt ttgaaaagca atggagacac

1500

catctgctga tgctcaaagt ggttacaacc aaaacacaaa aaagcagagc tgtgggaaga

1560

attcaacatt ttgattatgc aagaagctag tcccagcctt gaaatccacc atctgcatca

1620

tgaaagacct aagtagttaa agccacagca gacatacagc ttctatttcc ttaccttctt

1680

catcattaac tacaggtctt ggaagatttt tgctgggaaa aagcttttat tgcaagaact

1740

gtaatttatt aacagggaaa catgaaataa atgtgtaaat tctcctgcac tcccactgtc

1800

attaaaaacg gctttaagaa agagtattca gtaactgcct gcattgtgtt gtgactttct

1860

actctgtgac acacagcctt ctgggcaaag cacatattct gccatgcatg tgggtcgtgc

1920

cttggaaaat gggaacccac attcactgag ggcctcttga tgagctttcc ccttgagaac

1980

agcgaggtct catggatatc ttctcttctc caagccaaat aagcccagat ccctcagctt

2040

tccttcatgg agaggctcca gccctctgat catgcctgca gcccttctct ggacctgctc

2100

cagcagcccc acacgctcct catgctggga ccccagatct gcacatggta ttgcacatgg

2160

ggcctcacaa cggcagagct gagagggaca attccctccc tcagccttta attctgcacg

2220

tacttaattt tgtctgtatt ttttttgcaa tagaatagcc tgcatgctag ttgctgtgtc

2280

gcacagctga attcactagg ttcctgtgaa acaaagggca atcccacagc cactgtagca

2340

cgtgaggagc cacacaggtg ctctaattcc tacaggacag gcctagggac agagcggccc

2400

taggactgcc ctcccgcacc tcctagcttc accttttgcc cgcgatcttt aagtaccctg

2460

aagcataaac agggaaagcg ccgcccgcag cctcaccctg cttcccgccc aacgcggcac

2520

cgcccaggcc gcagccgccc actaagagca ctagcgccac cttctcaccc cacccccacc

2580

acgcgttcct agcggccctg agagctgctg cgcatgcgcc gcctgacgat tcgccctccc

2640

attggctggc ggtcgaagca cggcggggggc acgcggtggc ggctatataa ggcgtctcgg

2700

aagacggcgc catgctattt ggagcggaga gtgaaagtta cagttcctgg tgctggtagg

2760

gagtgtggcg cggagcggag cgctgcggct catcggaacc acaatggagc catagcagag

2820

ccgggcgtgg gggcaagggc agtgcgtgct ggggagggct ccgtcgcgtg gccacgtcgc

2880

gagagccgtc gggatggtgg cgtcagggcg gggggtgctg ctaacgtgct cctggtcctg

2940

caggtgggct gctggcattc gccatggtga gcaagggcga ggagctgttc accggggtgg

3000

tgcccatcct ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg

3060

agggcgaggg cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca

3120

agctgcccgt gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca

3180

gccgctaccc cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct

3240

acgtccagga gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg

3300

tgaagttcga gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg

3360

aggacggcaa catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata

3420

tcatggccga caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg

3480

aggacggcag cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc

3540

ccgtgctgct gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca

3600

acgagaagcg cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg

3660

gcatggacga gctgtacaag ggatccggag ctactaactt cagcctgctg aagcaggctg

3720

gagacgtgga ggagaaccct ggacctatgc tcgagggagt gcaggtggag actatctccc

3780

caggagacgg gcgcaccttc cccaagcgcg gccagacctg cgtggtgcac tacaccggga

3840

tgcttgaaga tggaaagaaa gttgattcct cccgggacag aaacaagccc tttaagttta

3900

tgctaggcaa gcaggaggtg atccgaggct gggaagaagg ggttgcccag atgagtgtgg

3960

gtcagagagc caaactgact atatctccag attatgccta tggtgccact gggcacccag

4020

gcatcatccc accacatgcc actctcgtct tcgatgtgga gcttctaaaa ctggaatctg

4080

gcggtggatc cggagtcgac ggatttggtg atgtcggtgc tcttgagagt ttgaggggaa

4140

atgcagattt ggcttacatc ctgagcatgg agccctgtgg ccactgcctc attatcaaca

4200

atgtgaactt ctgccgtgag tccgggctcc gcacccgcac tggctccaac atcgactgtg

4260

agaagttgcg gcgtcgcttc tcctcgctgc atttcatggt ggaggtgaag ggcgacctga

4320

ctgccaagaa aatggtgctg gctttgctgg agctggcgcg gcaggaccac ggtgctctgg

4380

actgctgcgt ggtggtcatt ctctctcacg gctgtcaggc cagccacctg cagttcccag

4440

gggctgtcta cggcacagat ggatgccctg tgtcggtcga gaagattgtg aacatcttca

4500

atgggaccag ctgccccagc ctgggaggga agcccaagct ctttttcatc caggcctgtg

4560

gtggggagca gaaagaccat gggtttgagg tggcctccac ttcccctgaa gacgagtccc

4620

ctggcagtaa ccccgagcca gatgccaccc cgttccagga aggtttgagg accttcgacc

4680

agctggacgc catatctagt ttgcccacac ccagtgacat ctttgtgtcc tactctactt

4740

tcccaggttt tgtttcctgg agggacccca agagtggctc ctggtacgtt gagaccctgg

4800

acgacatctt tgagcagtgg gctcactctg aagacctgca gtccctcctg cttagggtcg

4860

ctaatgctgt ttcggtgaaa gggatttata aacagatgcc tggttgcttt aatttcctcc

4920

ggaaaaaact tttctttaaa acatcagtcg actatccgta cgacgtacca gactacgcac

4980

tcgacctcga cggatccgga gagggcagag gaagtctgct aacatgcggt gacgtcgagg

5040

agaatcctgg acctatggag gaggattggg ataccgaact cgagcaggag gcggcagcgg

5100

cttcccaggg gcgttctgag gagcaggcgt ggatggtgag ctgtgtccag gggagggcgg

5160

tgcggcaggg agcggggcac tgggatggcc cggtctggga aggggaggcc gagaggcctt

5220

cgcagtgctt cctgcagctc cccgagcagt gcgaagaagg aggtgccggg ctctgctgtg

5280

ggagccgaag gcacggagct gcctggggag ggaatggctg tgtgcctgag gtgccagaga

5340

ccggcaaggg ctgtacagag aggcaacggt tttgtgtaca aatcatttgt atgggaaacc

5400

acaaaatctt gaagctttat tacatggcag cgaaatactt tggtgtgaag taaaggataa

5460

gatagaggag tgtaatgaga gacagctaaa taatatttta ctacttgtgg gatgagtgaa

5520

tatcaggagg aactgctgta aatttcagga ggacctgttg tgaatcttca gtagttggcg

5580

ccgctcttac acatcttaca gatgcccctt gagcaaaggg ggataaggag agatgaacgg

5640

gttatccaaa caggtgatga gctaaaagta cagttgccta aagaagtagt agcatgtgct

5700

atcagaatga taattttgtt agtttggggt tagtttcctg tagtggtaga tagccacaac

5760

aagaaaaccg cttaagtttt tgtaaaacaa aaaaagcacg atccagaagt aaaaaatatg

5820

ggtagttttt tttgatgttc ctctctcacc tggtgctttg gcatactaat atgtgtctaa

5880

ttgtattaaa caggagaaat ttaaacctag gctttgctgg aaataaaatg ttacaatgct

5940

acaatgtgaa aagtaggtgc tattctgaac tgttttgggt ggagtatctg aatctttgaa

6000

taatttaaga gggactgaca tatttaaaat acttaaggat aatctgtagc catgctgtaa

6060

aagaacaaca gaaatgcagt tgggaaggtg atggaaatag ttttattcat gttactggtg

6120

gtctgaaacc tttctaagct taaactgtag aaaaaaattg cttcaaaaga ttgcactatt

6180

actttgggcg acaaatgttt ttaattggtt ttaagtgttt gttagcaaag tgaagttgat

6240

gccaccataa gtctgacagg aggcaagata aacttgtctt catactgctt gtgtataact

6300

tggttttgat gacatttgtg tgtgaacatt atgcacttca gtgtagcgaa gtttaagaaa

6360

ctttgaacag aataacttga aagagtgtgc acatgggtgc agaagtcact ttatttcagt

6420

tgggagactt agcacctaaa tgcactgtta gttcacatac actttgcttg gcctgaaggt

6480

aacattgtga tgtcgctttt tttccctgta ggctaactct ggcagaccaa acagcccatc

6540

cctccgcttc tccagcagac caagcagccc cttgtctgg

6579

<210> 7

<211> 75

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer

<400> 7

cggtgacgtc gaggagaatc ctggacctat ggaggaggat tgggataccg aactcgagca

60

ggaggcggca gcggc

75

<210> 8

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 8

gaaatccagc ttccagttcc cacctggcca gacaaggggc tgcttgg

47

<210> 9

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer

<400> 9

ggtgggctgc tggcattcgc catggtgagc aagggcgagg a

41

<210> 10

<211> 76

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 10

gattctcctc gacgtcaccg catgttagca gacttcctct gccctctccg gatcccttgt

60

acagctcgtc catgcc

76

<210> 11

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer

<400> 11

tctcccatat ggtcgacctg caggcggccg cgaattcact agtgattctt cgtggtt

57

<210> 12

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 12

aggctgaagt tagtagctcc ggatccaaca cttttgagca ctgctctt

48

<210> 13

<211> 107

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer

<400> 13

cagaacatca ccctgaccga ggtgggatcc ggagagggca gaggaagtct gctaacatgc

60

ggtgacgtcg aggagaatcc tggacctatg gtgagcaagg gcgagga

107

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 14

cttgtacagc tcgtccatgc cg

22

<210> 15

<211> 94

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer

<400> 15

tctcggcatg gacgagctgt acaagtgatg aacaaagact ttgaagtaca taaatgtatt

60

actttgatgt taatacagtt cagtttagta agat

94

<210> 16

<211> 55

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 16

ctcttcgaaa tccagcttcc agttcccacc tggcaatact attaaagcaa taggt

55

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> guide sequence

<400> 17

ggtcctattc caggagagga

20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> guide sequence

<400> 18

ggcttactaa actgaactgt

20

<---

Claims (18)

1. A transgenic construct for expression in a germ cell of a host bird, wherein the transgenic construct is configured to selectively kill germ cells of the host bird on demand without killing other cells in the germ cell of the host bird, comprising: (i) a first nucleotide sequence, wherein said first nucleotide sequence encodes an apoptosis-inducing enzyme, wherein said apoptosis-inducing enzyme is a caspase, wherein the activity of the protein encoded by said first nucleotide sequence causes germ cell death in the presence of an exogenous inducing agent; And (ii) a second nucleotide sequence that targets said construct to avian germ cells, wherein said second nucleotide sequence targets said transgene construct to avian germ cells, wherein said second nucleotide sequence targets the DAZL locus. 2. The transgenic construct of claim 1, wherein said first nucleotide sequence comprises an apoptosis-inducing domain, and wherein said exogenous inducing agent is a dimerization agent, wherein the exogenous inducing agent induces the activity of said apoptosis domain, which causes germ cell apoptosis. 3. The transgenic construct according to claim 1, wherein said exogenous inducing agent is selected from the group consisting of AP20187, FK1012 or AP1903 ligand. 4. The transgenic construct according to claim 2, wherein said exogenous inducing agent is a drug for stable dimerization. 5. The transgenic construct of claim 1, wherein said apoptosis-inducing enzyme is a caspase, wherein optionally said caspase is selected from mammalian caspase 9, iCaspase9 or aviCaspase9. 6. Transgenic construct according to any one of paragraphs. 1-5, wherein said second nucleotide sequence targets said transgenic construct to germ cells through homologous recombination at a genetic locus expressed only in avian germ cells. 7. Transgenic construct according to any one of paragraphs. 1-6, wherein said second nucleotide sequence is targeted to germ cells via the CRISPR/Cas system, wherein said transgenic construct comprises a guide RNA targeting a germ cell-specific sequence. 8. A method for obtaining a surrogate host bird by modifying the germplasm of said bird, including the following stages: (i) introducing a transgenic construct into a fertilized egg or cultured avian germ cells and incubating said egg containing said transgenic construct or injected with germ cells containing said transgenic construct, wherein said transgenic construct is a transgenic construct according to any one of claims. 1-7, and wherein said transgenic construct is integrated into the germ cells of said embryo; And (ii) administering said exogenous inducing agent to induce death of said germ cells. 9. The method according to claim 8, additionally including: (iii) transplanting germ cells from the donor bird into said fertilized egg and incubating until hatching to produce offspring birds having the genetic identity of the transplanted germ cells. 10. The method according to claim 9, further including: (iv) mating the male and female offspring of said offspring birds to produce one or more additional generations of offspring birds with germ cells having the genetic identity of the transplanted germ cells. 11. Transgenic bird for use as a surrogate host bird, containing a transgenic construct according to any one of paragraphs. 1-7 and obtained by the method according to any one of paragraphs. 8-10, wherein the transgenic construct is expressed in a host germ cell and is configured to selectively kill host germ cells on demand without killing other cells in the host bird.