KR101918607B1 - Knock-in vector for expression of bovine lactoferrin and knock-in method in the bovine embryo using the same - Google Patents

Abstract

The present invention relates to a knock-in vector for bovine lactoferrin expression and a knock-in method in a bovine embryo using the knock-in vector. More particularly, the present invention provides a bovine beta-casein genomic DNA knock-in vector, comprising: a 5′-terminal fragment comprising a nucleic acid sequence represented by SEQ ID NO: 1 and comprising a promoter of a sub-beta-casein genomic DNA and a part of exon 7, as a 5′-arm; a gene encoding a therapeutic protein; and an intron portion between exon 7 and 8 of the bovine beta-casein genomic DNA, comprising the nucleic acid sequence shown in SEQ ID NO: 4, as a 3′-arm.

Description

Knock-in vector for expression of bovine lactoferrin and knock-in method using knock-in vector for expression of bovine lactoferrin.

The present invention relates to a knock-in vector for bovine lactoferrin expression, and more particularly, to a knock-in vector for bovine lactoferrin expression and a knock-in method in a bovine embryo using the same.

Lactoferrin is also known as lactotransferrin, a type of iron-binding protein known to have strong antibacterial, antiviral, anticancer and anti-inflammatory properties. Lactoferrin in bovine milk is present at a high concentration of 0.8 g / L in colostrum, but it is known to be lowered to 100-400 mg / L in milk. If lactoferrin is maintained at high concentration in milk, Prevention of calf diarrhea caused by infection can improve productivity of animal husbandry. Efforts to develop animal bioreactors that produce such useful proteins from animal milk, etc. have been an important goal in animal biotechnology, and many studies have been conducted. To date, studies on zinc-finger nucleases (ZFNs), TALENs transcription activator-like effector nucleases (CRISPRs) and clasutered regulatory interspaced short palindromic repeats (CRISPRs) / Cas9 have recently been developed and used in the production of various types of genetically modified animals to induce genetic editing in cells or embryos have. When a specific DNA sequence is cleaved by such a gene scissors, several bases are removed or inserted by non-homologous end joining (NHEJ) to induce knock-out of a specific gene. -Inductor vector) with the gene scissors can be introduced into cells or embryos to induce homologous recombination caused by homologous recombination (HR) with the MMEJ. Various donor DNAs for knock-in efficiency enhancement (Knock-in vectors) are used. In this regard, Korean Patent No. 1507600 discloses a knock-in vector produced using sobetalkase for the production of a therapeutic protein.

However, in the case of the above prior art, it is difficult to obtain a transgenic embryo and production efficiency is low because it is a method of introducing a vector into a somatic cell and then producing a cloned animal using somatic cells gene-targeted by homologous gene recombination .

Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above-mentioned problems, and it is an object of the present invention to provide a knockout mouse for the expression of bovine lactoferrin capable of efficiently targeting bovine lactoferrin gene using gene scissors (CRISPR / Cas9) Vector and a knock-in method in a bovine embryo using the same. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided a 5'-arm comprising: a 5'-terminal fragment comprising a nucleic acid sequence represented by SEQ ID NO: 1 and comprising a promoter of a sub-beta-casein genomic DNA; A gene encoding a therapeutic protein; And a 3'-arm, comprising a nucleic acid sequence as set forth in SEQ ID NO: 6 and comprising an intron portion between exons 7 and 8 of the sub-beta-casein genomic DNA, wherein the sub-beta-casein genomic DNA knock- Is provided.

According to another aspect of the present invention, the knock-in vector; 5'-arm sgRNA; 3'-arm sgRNA; And Cas9 or a polynucleotide encoding said Cas9 are provided.

According to another aspect of the present invention, there is provided a microinjection step of microinjecting a composition for cowbeta-casein genomic DNA knockout into a fertilized egg of a cow; Culturing the microinjected embryo to a blastocyst; An amplification step of amplifying the DNA of the blastocyst embryo by PCR; And a gene encoding a protein for treatment with beta-casein genomic DNA in a bovine embryo, wherein the presence or absence of the amplified PCR product and the presence or absence of the amplified PCR product are confirmed and that the vector has been inserted into the place of the sobeta-casein genomic DNA A knock-in method is provided.

As described above, the knock-in vector for the expression of bovine lactoferrin of the present invention and the knock-in method using the bovine embryo using the bovine embryo can be used to precisely target the bovine lactoferrin gene to the exon of the sobeta-casein gene, Using a transgenic cattle, a resistant cow can be developed that has the functions of antibiotics, antivirals, etc. secreted by lactoferrin in a form fused with sobeta-casein. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a schematic diagram showing a process for producing a transgenic cow by microinjecting knock-in vector and gene scissors CRISPR / Cas9 produced in a bovine embryo according to an embodiment of the present invention into bovine embryos.
FIG. 2 is a schematic diagram of a gene structure of sowbeta-casein, three knock-in vectors for bovine lactoferrin expression, and a beta-casein gene into which the knock-in vector is inserted.
Fig. 3 is a gel photograph (b and c) showing the sgRNA target site (a) capable of cleaving the end of Sobeta-casein exon 7 and the in vitro and in vivo activities of the synthesized sgRNA.
Fig. 4 is a gel photograph showing the sgRNA target site (a) capable of cleaving both ends of pBluescript SK (-) inserted with the knock-in vector of the present invention and the in vitro activity of synthesized sgRNA (b and c ).
FIG. 5 is an electrophoresis image showing the result of PCR analysis of embryos implanted with three knock-in vectors for bovine lactoferrin expression of the present invention. FIG.
FIG. 6 is an analysis of the amino acid sequence abnormality in F2A and some bovine lactoferrin DNA sequences and knocked-in base sequences including the sgRNA target site in PCR fragments obtained from knock-in embryos.

Definition of Terms:

As used herein, the term " knock-in vector " refers to a gene targeting gene that knockout a specific gene and express the exogenous gene Lt; / RTI > Since the foreign gene inserted by the knock-in vector can utilize all parts of the gene expression regulatory region located in the genome of the inserted position, it is likely to be expressed by the expression amount of the gene originally present at the position.

As used herein, the term " therapeutic protein " refers to a protein or polypeptide having therapeutic activity.

As used herein, the term "clustered regulatory interspaced short palindromic repeat (CRISPR) / Cas9" is a gene scissor, and the constituent sgRNA has the ability to recognize a specific DNA base sequence of 20 bp. Cas9 protein binds to sgRNA Have been reported to have the ability to cleave specific DNA. However, in the case of the large cattle, the specific part of the cow beta-casein gene is cleaved and homologous gene recombination is used to produce a biotin-producing specific gene (CRISPR / Cas9) The results are not reported.

As used herein, the term " lactoferrin " refers to a protein that has antimicrobial, antiviral, anti-cancer, and anti-inflammatory properties while functioning to regulate immune function.

  As used herein, the term " gene targeting " refers to a technique of introducing a gene mutated at a specific chromosomal location by homologous gene recombination, introducing the gene hit vector into a specific gene locus in a mouse stem cell by homologous gene recombination And then used to produce chimeric mice using the stem cells, which are mainly used for knock-out mouse production, and are distinguished by knock-out and knock-in.

 As used herein, the term " knock-out " refers to introducing a gene mutated by homologous gene recombination at a specific gene position to prevent expression of a specific gene.

 The term " knock-in " as used herein refers to the introduction of a foreign gene to be expressed at the position of a specific gene by homologous gene recombination. The foreign gene inserted includes a promoter and a phosphorus of a specific gene Lt; RTI ID = 0.0 > of the < / RTI > gene expression regulatory sequences.

 As used herein, the term " single guide RNA " is a version of a naturally occurring two-piece guide RNA complex that consists of a single contiguous sequence. A simplified single guide RNA is used to direct the Cas9 protein to bind and cleave specific DNA sequences for genomic editing.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention, there is provided a 5'-arm comprising: a 5'-terminal fragment comprising a nucleic acid sequence represented by SEQ ID NO: 1 and comprising a promoter of a sub-beta-casein genomic DNA; A gene encoding a therapeutic protein; And a 3'-arm, comprising a nucleic acid sequence as set forth in SEQ ID NO: 6 and comprising an intron portion between exons 7 and 8 of the sub-beta-casein genomic DNA, wherein the sub-beta-casein genomic DNA knock- Is provided.

The knock-in vector may be bovine lactoferrin, and the gene coding for bovine lactoferrin may be a polynucleotide consisting of a nucleic acid sequence represented by SEQ ID NO: 7, and the 3 ' 'Terminal can be further connected to the polyA signal.

In the knock-in vector, a reporter gene for confirming the expression of the fusion fluorescent protein may be further connected to the 3 'end of the gene encoding the human lactoferrin, and the fluorescent protein may be a green fluorescent protein (green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP), cyan fluorescent protein Blue fluorescent protein (BFP) or far-red fluorescent protein.

The knock-in vector may comprise a positive selectable marker and a negative selectable marker, respectively, and the positive selectable marker may be a neo gene, a puromycin resistance gene, Gene or a zeocin resistance gene.

According to another aspect of the present invention, the knock-in vector; SUBBETA-casein genome DNA exon 7 TABLE-US-00086 sgRNA; 5'-arm labeled sgRNA of the knock-in vector; 3'-arm labeled sgRNA of the knock-in vector; And Cas9 or a polynucleotide encoding said Cas9 are provided.

In the composition for the sub-beta-casein genomic DNA knock-in, the sgRNA coding for Sobbeta-casein genome DNA exon 7 can target the nucleic acid sequence shown in SEQ ID NO: 35 and the 5'-arm of the knock- The nucleotide sequence of SEQ ID NO: 36 may be targeted and the nucleotide sequence of the knock-in vector described in the 3'-arm sgRNA SEQ ID NO: 37 may be targeted.

According to another aspect of the present invention, there is provided a microinjection step of microinjecting a composition for cowbeta-casein genomic DNA knockout into a fertilized egg of a cow; Culturing the microinjected embryo to a blastocyst; An amplification step of amplifying the DNA of the blastocyst embryo by PCR; And a gene encoding a protein for treatment with beta-casein genomic DNA in a bovine embryo, wherein the presence or absence of the amplified PCR product and the presence or absence of the amplified PCR product are confirmed and that the vector has been inserted into the place of the sobeta-casein genomic DNA A knock-in method is provided.

Currently, knock-in somatic cells are obtained by introducing knock-in vectors and gene scissors into somatic cells, and then a method of developing an animal bioreactor that produces useful protein by producing cloned embryonic somatic cells, And a method of developing an animal bioreactor by directly injecting a vector and gene scissors into an embryo. In recent years, studies have been conducted to produce animals that are gene targeting using the Crispyr gene scissors (CRISPR / Cas9). However, in a large animal cattle, specific regions of the beta-casein gene are cleaved and homologous recombination Have not been reported yet. Also, in the past, in order to produce a therapeutic protein, a knock-in vector was transformed into somatic cells and the transformed somatic cells were injected into the oocyte to induce nuclear replacement. However, the method did not cause knock- Production efficiency of transgenic embryos was very low because of the large number of randomly inserted transformants. Accordingly, the inventors of the present invention have found that knock-in vectors for the expression of bovine lactoferrin and bovine embryos using the knock-in vectors are useful for solving the problems of the conventional method of replacing somatic cell nuclei and the method of using some gene scissors, - method. The present invention provides a method of knocking down a bovine embryo using a knock-in vector and a CRISPR / Cas9 gene scissors capable of enhancing the targeting efficiency of a bovine lactoferrin gene at the exon 7 position of the sobeta-casein gene, - It is possible to insert precisely at the position of casein exon 7. It is ensured that large amount of transgenic embryos are acquired and transplanted to transform the bovine lactoferrin into a form that is fused with sobeta-casein, And the like (Fig. 1).

When knocking in a bovine embryo using a knock-in vector for the expression of bovine lactoferrin of the present invention, the expression of EGFP in the embryo indicates that the chromosome structure, that is, the chromosome at the site where the knocked- (heterochromatin) or euchromatin (euchromatin) structure. However, when the embryo is transplanted into a surrogate mother and the transformed cow is normally grown after birth, the lactoferrin gene is expected to be normally expressed in the mammary gland because it is affected by the beta-casein promoter. Therefore, the knock-in efficiency, which is not the expression of EGFP, is important, and the vector of the present invention has a higher level than the vector using the long homologous recombination region as a result of using gene scissors even though the region for homologous recombination is short Knock - in can be induced.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1 Construction of Knock-in Vectors for Bovine Lactoferrin Expression

1-1: Identification of bovine lactoferrin gene

The present inventors carried out RT-PCR using cDNA secured from bovine mammary gland as a template to clone a lactoferrin gene. Specifically, the RT-PCR was carried out at 94 ° C. for 30 seconds, 68 ° C. for 30 seconds, and 72 ° C. using bLF Kpn IS (SEQ ID NO: 10) and bLF Xba I AS (SEQ ID NO: 11) primer set and Ex Taq 2 min 30 sec 35 cycles. The amplified PCR product was confirmed by electrophoresis on 0.8% agarose gel, purified using QIAgen quick gel extract kit (QIAgen), and ligated to pGEM T-easy vector (Promega Co, USA) The pGEM T-easy_bLF plasmid was obtained and the plasmid thus obtained was confirmed by using Genetyx-win (version 4.0).

In addition, since the Kpn I restriction site is present inside the bovine lactoferrin gene sequence, in order to prevent the cleavage of the bovine lactoferrin gene by the Kpn I restriction enzyme in the production of knock-in vector for bovine lactoferrin expression, Kpn I restriction Point mutation PCR was performed to modify the enzyme site. For this, a plasmid pGEM T-easy_bLF was used as a template and PCR was carried out using a set of bLF Kpn IS (SEQ ID NO: 10) and bLF Kpn I mutation AS primer (SEQ ID NO: 12) and Ex Taq (TAKARA, Shiga, Japan) , 68 ° C for 30 seconds, 72 ° C for 1 minute, 30 seconds and 35 cycles, and the PCR product was detected by electrophoresis on a 1% agarose gel at about 1.5 Kb. In addition, pGEM T-easy_bLF the template plasmid bLF Kpn I mutation S (SEQ ID NO: 13), bLF Xba I mutation AS set (SEQ ID NO: 14) and using Ex Taq (TAKARA, Shiga, Japan ) 30 cho 94 ℃, PCR was carried out at 59 ° C for 30 seconds, 72 ° C for 1 minute and 35 cycles. A PCR product of about 0.7 Kb was detected on 1% agarose gel by electrophoresis.

The two PCR products were purified with QIAgen quick gel extract kit (QIAgen) and diluted to a concentration of 10 ng /.. A total of 1 쨉 g of 0.5 μg of the two diluted PCR products was used as a template and bLF Kpn IS (SEQ ID NO: 10), bLF Xba I mutation AS (SEQ ID NO: 14) primer set and Ex Taq (TAKARA, Shiga, Japan) PCR was performed under conditions of 94 ° C for 30 seconds, 68 ° C for 30 seconds, and 72 ° C for 1 minute and 30 seconds and 35 cycles. A PCR product of about 2.1 Kb was detected in 1% agarose gel through electrophoresis. Then QIAgen quick Gel extract was purified using a Kit (QIAgen) pGEM T-easy vector (Promega Co, USA) ligated to pGEM T-easy_bLF to - has secured the (Kpn I) plasmid Genetyx-win the secure a plasmid ( version 4.0) was used to confirm the nucleotide sequence. The information on the primers used in the present invention including the PCR amplification is summarized in Table 1 below.

Usage primer The nucleic acid sequence (5 '-> 3') SEQ ID NO: Bovine lactoferrin
For cloning bLF Kpn I S GGTACCATGAAGCTCTTCCTCCCCGCCCTGCTGT 10 bLF Xba I AS TCTAGATTACCTCGTCAGGAAGGCGCAGGCTTC 11 bLF Kpn I mutation AS CAAGGTAGCCTTCCGTTGGT 12 bLF Kpn I mutation S ACCAACGGAAGGCTACCTTG 13 bLF Xba I mutation AS GCTCTAGACTACATTCTGTAGTTCTTGTTTCCT 14 Replace bLF
knock-in
vector
For building 100HR Not I S gcgcggccgcAAAGCAGTGCCCTATCC 15 100HR Sal I AS gcgtcgacAGCTATGCTTATTTTGGAAC 16 40HR Not I S gcgcggccgcCCTGTACTAGGTCCTGTCC 17 40HR Sal I AS gcgtcgacGAATATCATACAAACATCAG 18


Single guide
For RNA production b? CE7-2 sgRNA oligo gcctgcagTAATACGACTCACTATAGCAATAATAGGGAAGGGTCCCGTTTTAGAGCTAGAAATAGCAAG 19 pBSK (-) 1 sgRNA oligo gcctgcagTAATACGACTCACTATAggCAAAAGCTGGAGCTCCACCGGTTTTAGAGCTAGAAATAGCAAG 27 pBSK (-) SalI sgRNA oligo gcctgcagTAATACGACTCACTATAGGGTACCGGGCCCCCCCTCGGTTTTAGAGCTAGAAATAGCAAG 28 Constant oligo gcgaattcAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC 20 Oligo S gcctgcagTAATACGACTCACTATAG 21 Oligo AS gcgaattcAAAAGCACCGACTCGGTG 22
b? CE7 indel
For confirmation E7 indel S1 TACCACTCTGCAGGCAACTCAGGAAGA 23 E7 indel AS1 GGTAAGCCTAGACATTGAGATCTGGTG 24 E7 indel S2 GGAGTCTCCAAAGTGAAGGAGGCTATGG 25 E7 indel AS2 CTCAGCTATGCTTATTTTGGAACCATTC 26 knock-in
For confirmation bLF 5 Sc S3 TGCCCAGATGAGAGAAGTGAGGTACAGGAC 33 bLF 5 Sc AS9 CAGGGTCACAGCATCCGCCTTTTTCTCCGC 34
bRAD51
for cloning bRAD51 Not I S gcggccgccaccATGGCTATGCAAATGCAGCT 29 bRAD51 Xba I AS ctagaaatTCAGTCTTTGGCATCTCCCA 30 pRC-CMV T7 pro S TAATACGACTCACTATAGGG 31 pRC-CMV BGH pA AS TCCCCAGCATGCCTGCTATT 32

1-2: Manufacture of bBCE7_bLF_1kbHR_GFP knock-in vector (bLF_1kbHR_GFP KI ⓥ)

We prepared a bBCE7_bLF_1kbHR_GFP knock-in vector containing a 5'-homologous arm length of about 1 kb and a 3'-homologous arm of about 1.8 kb in length pBSK that is secured to an existing (-) m_tEndo_EGFP KI vector ⅱ-1 (Patent No. 10-1628701), the Kpn I and Xba I restriction enzyme which cut to prepare a vector, and then, pGEM Teasy_bLF (- Kpn I) the plasmid Kpn I and Xba I restriction enzymes to obtain a bacterium bacterium bBCE7_bLF_1kbHR_GFP knock-in vector. After sequencing, the nucleotide sequence was confirmed using Genetyx-win (version 4.0) (Fig. 2).

1-3: Manufacturing of bBCE7_bLF_100HR_GFP knock-in vector (bLF_100HR_GFP KI ⓥ)

BBCE7 5'_F2A_bLF_BGHpA_CMV-EGFP_BGHpA_E8-9 3 '(bBCE7_bLF_1kbHR_GFP) to produce a bBCE7_bLF_100HR_GFP knock-in vector comprising a 5'-homologous arm and a 3'- homologous arm of about 100 bp in length, KI vector) plasmid as a template at 94 ° C for 30 seconds, 54 ° C to 62 ° C using 100HR Not I S (SEQ ID NO: 15), 100HR Sal I AS (SEQ ID NO: 16) primer set and KOD Fx neo (Toyobo, Osaka, Japan) PCR was carried out under the conditions of temperature gradient of 30 sec., 72 ℃ for 4 min. And 30 cycles. From the electrophoresis, PCR product of about 4.1 Kb was detected in 0.8% agarose gel. Then, the PCR product was purified with QIAgen quick gel extract kit (QIAgen), digested with Not I and Sal I restriction enzymes, ligated to pBSK (-) / NotI, SalI vector to obtain bBCE7_bLF_100HR_GFP or neo knock-in vector And the nucleotide sequence was analyzed using Genetyx-win (version 4.0) after the sequencing (FIG. 2).

1-4: Manufacturing of bBCE7_bLF_40HR_GFP knock-in vector (bLF_40HR_GFP KI ⓥ)

BBCE7 5'_F2A_bLF_BGHpA_CMV-EGFP_BGHpA_E8-9 3 '(SEQ ID NO: 2) to produce a bBCE7_bLF_40HR_GFP knock-in vector comprising a 5'-homologous arm and a 3'- homologous arm of about 40 bp in length bBCE7_bLF_1kbHR_GFP KI vector) was amplified by PCR using primers of 40HR Not I S (SEQ ID NO: 17), 40HR Sal I AS (SEQ ID NO: 18) and KOD Fx neo (Toyobo, Osaka, Japan) PCR was carried out at a temperature gradient of 62 ° C for 30 seconds, 72 ° C for 4 minutes and 30 cycles, and about 4 Kb of PCR product was detected in 0.8% agarose gel through electrophoresis. They were purified PCR products as QIAgen quick Gel extract Kit (QIAgen) was cut with Not I and Sal I restriction enzymes, pBSK (-) / Not I , and ligated to Sal I vector was secured bBCE7_bLF_40HR_GFP or neo Knock-in vector After the base sequence analysis, the nucleotide sequence was confirmed using Genetyx-win (version 4.0) (Fig. 3).

Example 2: Securing CRISPR / Cas9 for cleaving sobeta-casein exon 7

2-1: Production of Sobeta-casein exon 7 base sequence-specific sgRNA

The present inventors designed an sgRNA that recognizes and operates the nucleic acid sequence (AATAATAGGGAAGGGTCCCCGG, bβCE7-2, SEQ ID NO: 35) at the exo 7 position of the small β-casein gene. The bβCE7-2 sgRNA oligo (SEQ ID NO: 19), which is composed of the Pst I restriction site, the T7 promoter, the sgRNA target site and a portion of the Cas9 handle, a portion of the Cas9 handle, a terminator sequence and an Eco RI restriction enzyme site (SEQ ID NO: 20) was synthesized. To anneal the two oligos, 100 μM bβCE7-2 sgRNA oligos were mixed with 100 μM of the constant oligonucleotide. Using a PCR machine, the mixture was treated at 95 ° C for 5 minutes and then heated to 85 ° C at intervals of -2 ° C And treated at -0.1 ℃ intervals per second to 25 ℃. Then, 2.5 μg of 10 mM dNTP mix, 2 μl of 10 × NEB buffer, 0.2 μg of 100 × NEB BSA and 1.5 U of T4 NEB DNA polymerase (New England Biolabs, Beverly, MA, USA) were added and reacted at 12 ° C. for 20 minutes, . (SEQ ID NO: 21), AS (SEQ ID NO: 22) set and KOD Fx neo (Toyobo, Osaka, Japan) were used to amplify the prepared template. PCR was carried out for 30 seconds and 35 cycles. A PCR product of about 135 bp was detected on 1.5% agarose gel by electrophoresis. Subsequently, sgRNA was synthesized using MEGAshortscript T7 Transcription Kit (Ambion, Huntingdon, UK) to in vitro transcription of the DNA into RNA. The in vitro transcription was performed using 2 μg T7 10X reaction buffer, 2 μg each of 75 mM ATP, CTP, GTP, UTP solution and 2 μg of each of the 135 bp PCR products purified with QIAgen quick Gel extract kit (QIAgen) T7 enzyme mix was added and the volume was adjusted to 20 ㎍ total with Nuclease-free water and reacted at 37 ℃ for 4 hours. Then, 1 μg of TURBO DNase was added to the DNA and the reaction was carried out at 37 ° C for 15 minutes. The synthesized sgRNA was purified using a MEGAclear kit (Ambion, Huntingdon, UK) and bβCE7-2 sgRNA targeting the position of the sub-beta-casein gene exon 7 was synthesized (FIG.

2-2: In vitro Activation of bβCE7 sgRNA

The present inventors have verified in vitro the above synthesized b? CE7-2 sgRNA activity. First, a substrate containing a target site of b? CE7 sgRNA was prepared. (SEQ ID NO: 23), E7 indel AS1 (SEQ ID NO: 24) primer and KOD Fx neo (Toyobo, Osaka, Japan) as primers for MAC-T genomic DNA at 94 ° C for 30 seconds, 56 ° C 30 sec, 72 ° C for 1 min and 32 cycles, and the PCR product was detected by electrophoresis on a 1.5% agarose gel at about 997 bp. Then, it was purified with QIAgen quickGel extract Kit (QIAgen) and used as a substrate.

Subsequently, 150 ng of substrate containing 350 ng of the synthesized b? CE7-2 sgRNA and 500 ng of Cas9 protein (Toolgen, Seoge, Korea) and bβCE7 target site, 10 × Buffer H, 10 × BSA (TAKARA, Shiga, Japan) The volume was adjusted to a total of 10 μg and reacted at 37 ° C for 1 hour. Then, RNase A was added for the degradation of RNA, and the reaction was carried out at 37 ° C for 15 minutes. The fragment cleaved by electrophoresis on 1.5% agarose gel was confirmed, so that bβCE7-2 sgRNA was activated and the sub- (Fig. 3B).

2-3: In vivo  Activation of bβCE7 sgRNA

The present inventors have verified the activity of bβCE7 sgRNA in MAC-T cells, a mammary alveolar cell. The MAC-T cells were cultured in DMEM (Hyclone, Logan, USA), 5% FBS (Hyclone) and 1% penicillin / streptomycin (Hyclone) conditions. Transfection was performed by adding MAC- X10 ⁵ cells were seeded. One day later, 500 ng of Cas9 protein and 120 ng of bβCE7-2 sgRNA were used as a Lipofectamin RNAiMAX reagent (Invitrogen, Waltham, USA). After 72 hours of the transfection, the cells were harvested and genomic DNA was isolated using G-DEX ™ IIc For Cell / tissue Genomic DNA Extraction Kit (Intron, Seongnam-si, Korea). E7 indel S2 (SEQ ID NO: 25), E7 indel AS2 (SEQ ID NO: 26), and KOD Fx neo (Toyobo, Osaka, Japan) were used to determine the activity of bβCE7 sgRNA PCR was carried out using 94 ° C for 10 seconds, 60 ° C for 30 seconds, 68 ° C for 30 seconds and 35 cycles. Then, the activity of T7 endonuclease I was first measured by using 1 μg of DNA after purifying the PCR product with QIAgen quick gel extract kit (QIAgen). First, the DNA fragment was treated at 95 ° C for 10 minutes using a PCR machine, then treated at 85 ° C for 2 ° C per second, and then treated at 25 ° C for -0.1 ° C per second. To the treated DNA, 10 U T7 endonuclease I (NEB, Ipswich, USA) was added and treated at 37 ° C for 30 minutes. After electrophoresis on 2% agarose gel, the cleaved fragments were confirmed and bβCE7-2 sgRNA And cleaved at position 7 of Sobeta-casein exon (FIG. 3C).

Example 3: Securing CRISPR / Cas9

3-1: Preparation of pBluescriptSK (-) vector specific base sequence specific sg RNA

The present inventors have succeeded in isolating pBSK (-) 1 sgRNA (CAAAAGCTGGAGCTCCACCGCGG, SEQ ID NO: 36) capable of cutting in front of the 5 'arm of the bLF replacement knock-in vector and pBSK (- ) Sal I sgRNA (GGGTACCGGGCCCCCCCTCGAGG, SEQ ID NO: 37) was designed. (-) 1 sgRNA oligo (SEQ ID NO: 27) or Sal I oligos (SEQ ID NO: 28) and Cas9 handle (SEQ ID NO: 28) consisting of the Pst I restriction site, the T7 promoter, the pBluescriptSK A partial constant oligo (SEQ ID NO: 20) containing the terminator sequence and the Eco R I restriction site was synthesized.

To anneal the two oligos, 100 μM pBSK (-) 1 or SalI oligo and 100 μM constant oligo were mixed and treated at 95 ° C for 5 minutes and then at 85 ° C for 2 ° C And treated at -0.1 ° C per second to 25 ° C. After addition of 2.5 μg of 10 mM dNTP mix, 2 μl of 10 × NEB buffer, 0.2 μg of 100 × NEB BSA and 1.5 U of T4 NEB DNA polymerase (New England Biolabs, Beverly, MA, USA) . 30 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds using Oligo S (SEQ ID NO: 21), AS (SEQ ID NO: 22) primer set, KOD Fx neo (Toyobo, Osaka, Japan) PCR was performed under the condition of 35 cycles. A PCR product of about 135 bp was detected on 1.5% agarose gel by electrophoresis. Then, sgRNA was synthesized using MEGAshortscript T7 Transcription Kit (Ambion, Huntingdon, UK) for in vitro transcription of the DNA with RNA. The in vitro transcription was performed using 1 μg of the 135 bp PCR product purified with QIAgen quick gel extract kit (QIAgen), 2 μg T7 10X reaction buffer, 2 μg each 75 mM ATP, CTP, GTP, UTP solution and 2 μg T7 enzyme mix, and the volume was adjusted to 20 μg total with Nuclease-free water, followed by reaction at 37 ° C for 4 hours. The resulting sgRNA was purified using a MEGAclear kit (Ambion, Huntingdon, UK), and the bLF replacement knock-in vector was digested with 1 μg of TURBO DNase and reacted at 37 ° C. for 15 minutes. pBSK (-) 1 and Sal I sgRNA were synthesized (Fig. 4A).

3-2: In vitro  Activation of pBSK (-) sgRNA in rat

To examine the activity of pBSK (-) sgRNA, the present inventors used 350 ng of the synthesized pBSK (-) 1 or Sal I sgRNA and 500 ng of Cas9 protein (Toolgen, Seogye, Korea), 300 ng of the pBluscriptSK (- 10X Buffer H, and 10XBSA (TAKARA, Shiga, Japan) were added to a total volume of 10 μg and reacted at 37 ° C for 1 hour. After that, RNase A was added to decompose RNA, and the reaction was carried out at 37 ° C for 15 minutes. The fragments were confirmed by electrophoresis on 0.8% agarose gel to confirm the activity of pBSK (-) 1 and Sal I sgRNA (Figs. 4B and 4C).

Example 4: Preparation of Cas9 mRNA

For the production of Cas9 mRNA, the present inventors straightened Cas9 expression vector (pRGEN-Cas9-CMV plasmid, Tulgen) with Spe I restriction enzyme. RNA synthesis was carried out using mMESSAGEmMACHINE T7 ugtra kit (Ambion, Waltham, USA) as follows. First, prepare a mixture containing 0.5 μg of the linearized plasmid, 5 μl of T7 2X NTP / ARCA, 1 μl of 10 × T7 Reaction buffer, and 1 μl of T7 enzyme mix, incubate at 37 ° C for 2 hours, add 1 μl of TURBO DNase Lt; 0 > C for 15 minutes. The poly (A) tailing kit (Ambion) was used to bind poly (RNA) to the prepared RNA as follows. 10 μl of the prepared RNA solution, 10 μl of 5 × E-PAP buffer, 5 μl of 25 mM ATP, 5 μl of 25 mM MnCl ₂ , 20 μl of Nuclease free water and 2 μl of E-PAP were added and reacted at 37 ° C for 1 hour. For RNA recovery, 50 μl of elution solution was added to the tube with poly (A) -tailed RNA using MEGA clear kit (Ambion) to make a final volume of 100 μl and 350 μl of binding solution was added , Followed by the addition of 250 [mu] l of 100% EtOH. The mixed aqueous solution was transferred to a filter, centrifuged at 10,000 rpm for 1 minute, added with 500 μl of washing solution, centrifuged at 10,000 rpm for 1 minute, and then repeated one more time. After transferring the filter to a new 1.5 ml tube, 50 μl of the eluate at 95 ° C was added, centrifuged at 10,000 rpm for 1 minute, and 100 μl of mRNA was finally recovered by repeating the above procedure one more time. The obtained mRNA was concentrated by 5 M Ammonium acetate and finally dissolved in 20 μl of Nuclease-free water and stored at -80 ° C. until use.

Example 5: Preparation of bRAD51 mRNA

The present inventors carried out RT-PCR using MAC-T cell cDNA as a bovine mammary cell to identify the bovine RAD51 gene. First, bRAD51 Not IS (SEQ ID NO: 29), bRAD51 XbaI AS (SEQ ID NO: 30) primer set and KOD Fx neo (Toyobo, Osaka, Japan) capable of specifically binding to the bRAD51 gene (NCBI accession number NM_001046179) PCR was performed at 94 ° C for 30 seconds, 56 ° C to 64 ° C for 30 seconds, and 72 ° C for 2 minutes and 32 cycles. A PCR product of about 1 kb was detected on 0.8% agarose gel by electrophoresis. Then, 5 U Go taq DNA polymerase (Promega, Madison, Wis., USA) was added and reacted at 72 ° C for 15 minutes. A tailings were then purified using a QIAgen quick gel extract kit (QIAgen, Hilden, Germany) One product was sub-cloned into the pGEM-T.easy vector (Promega, Madison, Wis., USA) to obtain pGEM-T.easy_bRAD51 plasmid DNA, and then using Genetyx-win (version 4.0) The nucleotide sequence was confirmed. Subsequently, pGEM-T.easy_bRAD51 plasmid and pRC-CMV plasmid were digested with Not I and Xba I restriction enzyme, and then sub-cloned to prepare pRC-CMV_bRAD51 plasmid DNA capable of expressing bRAD51 gene. Then, in order to synthesize bRAD51 mRNA from the DNA sequence from the T7 promoter of the pRC-CMV_bRAD51 plasmid vector to the bRAD51 cDNA and the BGHpA signal, the pRC-CMV_bRAD51 plasmid vector was used to express the T7 promoter and pRC-CMV 30 sec at 94 [deg.] C for 30 sec and 54 [deg.] C to 60 [deg.] C using T7 proS (SEQ ID NO: 31), pRC-CMV BGH pA AS (SEQ ID NO: 32) and KOD Fx neo (Toyobo, Osaka, Japan) , 72 ° C for 2 minutes and 30 seconds and 30 cycles. PCR products were detected in 0.8% agarose gel by electrophoresis and purified with QIAgen quick gel extract kit (QIAgen) for in vitro transcription As a template. MRNA was synthesized using mMESSAGE mMACHINE T7 ULTRA Transcription Kit (Ambion, Huntingdon, UK) in order to in vitro transcription of DNA into RNA. In vitro transcription was performed in 500 μg of PCR product of approximately 1.4 kb, 2 μg of 10X T7 Reaction Buffer, 10 μg T7 2X NTP / ARCA and 2 μg T7 enzyme mix were added, and the total amount of 20 ㎍ was mixed with nuclease-free water and reacted at 37 ° C for 1 hour. Then, 1 μg of TURBO DNase was added to the DNA to dissolve the DNA, and the reaction was carried out at 37 ° C. for 15 minutes to synthesize 5'-cap modified RNA. To add Poly A to the 3 'end of the synthesized RNA, 20 μg of 5 × E-PAP buffer, 10 μg of 25 mM MnCl ₂ , and 10 μM of the poly (A) tailing kit (Applied Biosystems, Foster City, CA, USA) 10 μg of 10 mM ATP, and 4 μg of E-PAP enzyme were added, and the volume was adjusted to 100 μg total with Nuclease-free water and reacted at 37 ° C for 1 hour. The mRNA was purified using a MEGAclear kit (Ambion, Huntingdon, UK) and used for the experiment.

Example 6: Securing knock-in fertilized eggs by microinjection of whole nucleus embryos

6-1: Preparation of pre-nucleation embryos

To prepare the whole nucleus embryos, the present inventors transferred the small ovaries recovered from the slaughterhouse to physiological saline containing 75 μg / ml potassium penicillin G and transferred them to the laboratory at 25-30 ° C. The ovaries were washed three times or more with sterilized physiological saline at 37 ° C. Follicular growths of 3-6 mm in diameter were inhaled in a syringe equipped with an 18 gauge needle, and the ovaries were recovered under a stereomicroscope. The recovered ovarian follicles were washed three times with Tyrode's lactate (TL) -Hepes solution, and then washed three times or more with in vitro maturation medium. Ten ovum follicles were placed in 50 μl of in vitro maturation culture medium (TCM-199) And 5% CO ₂ for 24 hours. After the in vitro maturation of the oocytes was completed, the cells were washed three times in Fert-TALP and transferred to 10 fertilizers (44 μl). The frozen spermatozoa were adjusted to a final concentration of 2 × 10 ⁶ cells / ml ㎍ / ml heparin and PHE were added together and the modification was induced at 38.5 ℃ and 5% CO ² for 18 hours. The fertilized eggs with the second polar body were selected 16-18 hours after induction of in vitro fertilization and used for microinjection.

6-2: Microinjection of CRISPR / Cas9 and knock-in vector into pre-nucleation embryos

In order to microinject CRISPR / Cas9 and knock-in vector to the nucleus of embryos confirmed to have a second polar body 16-18 hours after in vitro fertilization, the embryos were first centrifuged at 12,000 rpm for 5 minutes, To make it easier to observe the nucleus. The knock-in vector of the present invention and CRISPR / Cas9 were then microinjected into the cytoplasm of bovine embryos using a micro manipulator mounted on an inverted microscope. The microinjected embryos were washed in CR1-aa medium supplemented with 3 mg / ml BSA, and then transferred to 50 ㎕ colony by 10-15 cells for 7 days at 38.5 ° C and 5% CO ₂ . Details of the sample for microinjection are summarized in Table 2 below.

Details of sample for microinjection number Sample name Volume L Final concentration One Knock-in vector 1.2 [mu] g / [mu] g One 200 ng / [mu] g 4 Bovine-CNS-EX7_sgRNA_2 0.6 / / ㎍ One 100 ng / [mu] g 5 pBSK (-) sgRNA # 1 + pBSK (-) SalIsgRNA 1.2 [mu] g / [mu] g One 100 ng / [mu] g 6 Cas9 mRNA 2.4 / / ㎍ One 400 ng / [mu] g 7 bRAD51 mRNA 0.6 / / ㎍ One 100 ng / [mu] g 8 Nuclease free water with Scr7 6 mM Scr7 One 1 mM Sum 6 [mu] g

Example 7: Knock-in Validation from Microinjected Embryos

7-1: PCR analysis of embryos with knock-in vector

The present inventors performed knock-in assays using embryos implanted with knock-in vectors. After the microinjection, the same amount of 2X Lysis buffer [200 mM Tris-HCl (pH 8.3), 200 mM KCl, 0.04% Gelatin, 0.9% Tween 20 and 250 μg / ml Proteinase K , 120 ㎍ / ml yeast tRNA], and then treated at 56 ° C for 10 minutes and treated at 95 ° C for 10 minutes to prepare crude DNA. Using the crude DNA prepared above as a template, the primers set at bLF 5 Sc S3 (SEQ ID NO: 33), bLF Sc AS9 (SEQ ID NO: 34) and KOD Fx neo (Toyobo, Osaka, Japan) PCR was carried out at 68 ° C for 30 seconds, 72 ° C for 2 minutes and 38 cycles, and about 1.7 kb of PCR product was detected on 0.8% agarose gel by electrophoresis.

Three bLF_1kbHR_GFP KI ⓥ, bLF_100HR_GFP KI ⓥ, or bLF_40HR_GFP KI ⓥ knock-in vector and CRISPR / Cas9 with different lengths of homologous region were injected microinjected into the cytoplasm of prepubertal embryos and knocked out by homologous recombination As a result of culturing to produce embryos, bbLF_1kbHR_GFP KI ⓥ and CRISPR / Cas9 were microinjected into 53 bovine embryos, and 9 of them were developed into blastocysts. The PCR was carried out using the blastocyst embryos, And a knock-in occurred in both of the two blastocysts, and a band of 1.7 kb was confirmed. However, bLF_100HR_GFP KI ⓥ and CRISPR / Cas9, which were 100 bp in length, were microinjected into 62 embryos, and 9 of them were developed into blastocysts. EGFP expression was observed in 6 embryos, - The band could not be confirmed because no phosphorus occurred. In addition, bLF_40HR_GFP KI ⓥ and CRISPR / Cas9 were microinjected into 77 bovine embryos, 14 of them developed into blastocysts and 2 of them developed into blastocysts. EGFP expression was observed in 9 out of 14 blastocysts, , The expression of EGFP was confirmed. The results of analysis of 13 blastocysts and 2 blastocysts showed that knock-in occurred in 4 blastocyst embryos and 1.7 kb of bands were detected. Among the 4 knock-in embryos, (Fig. 5). Therefore, knock-in of homologous recombination was observed in 22.9% and 26.7% efficiency, respectively, using a CRISPR / Cas9 knock-in vector. The results of the knock-in test by microinjection of the knock-in vector and gene scissors of the present invention are summarized in Table 3 below.

Knock-in efficiency of embryos injected with knock-in vector for bovine lactoferrin expression Knock-in vector Number of microinjected embryos Number of blastocysts (%) EGFP expression (%) PCR analysis Number of embryos (%) Knuckle - number of embryos
(% Efficiency,%) bLF_1kbHR_GFP Kl 53 9 (17.0) 2 (3.7) 9 (17.0) 2 (22.2) bLF_100HR_GFP Kl 62 9 (14.5) 6 (9.7) 9 (14.5) 0 bLF_40HR_GFP Kl 77 14 (18.2) 9 (11.7) 15 (19.5) 4 (26.7)

7-2: Nucleotide Sequence Analysis of Embryos Inserted with Knock-in Vectors

The present inventors used bLF 5 Sc S3 (SEQ ID NO: 33) and bLF ScAS9 (SEQ ID NO: 34) using 1 ㎍ of the PCR product of Example 7-1 as a template to analyze the nucleotide sequence of knock- Second PCR was carried out using primer sets and KOD Fx neo (Toyobo, Osaka, Japan) at 98 ° C for 20 seconds, 68 ° C for 30 seconds, and 72 ° C for 2 minutes and 27 cycles, and electrophoresis was performed in 0.8% agarose gel A 1.7 kb PCR product was identified. Then, 5 U of goat DNA polymerase (Promega, Madison, Wis., USA) was added and reacted for 15 min at 72 ° C for A tailing. The product purified using QIAgen quick gel extract kit (QIAgen, Hilden, Germany) Were subcloned into pGEM-T.easy vector (Promega, Madison, Wis., USA) to obtain plasmid DNA. The obtained plasmid DNA was sequenced using Genetyx-win (version 4.0). Therefore, the nucleotide sequences of knock-in embryos were analyzed by homologous recombination by microinjection into bovine embryos with CRISPR / Cas9.

As a result, homologous recombination occurred when two vectors (bLF_1kbHR_GFP KI ⓥ and bLF_40HR_GFP KI ⓥ) were used, and the nucleotide sequences of the 5'-arm, F2A base and bovine lactoferrin gene of the knock-in vector were inserted And the ctc of the restriction enzyme Xho I site (ctcgag) used in vector construction was removed. However, when the knocked-in sequence was changed to an amino acid, the elimination of ctc did not synthesize the amino acid L, but the amino acid sequence was not found to be abnormal (FIG. 6).

In conclusion, the knock-in vector for the expression of bovine lactoferrin and the knock-in method using the bovine lactoferrin expression vector of the present invention can be used as a knock-in vector capable of targeting the bovine lactoferrin gene to the exon 7 position of the sub- (CRISPR / Cas9) to obtain a high transgenic embryo compared to conventional somatic cell nuclear transfer through homologous gene recombination in fertilized embryos and transplanting it into a sub-beta- It is possible to mass-produce dairy cows that are highly resistant to mastitis that has antibacterial and antiviral functions that are secreted in milk in a form fused with casein.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Knock-in vector for expression of bovine lactoferrin and knock-in          method in the bovine embryo using the same <130> PD18-5665 <160> 37 <170> KoPatentin 3.0 <210> 1 <211> 1056 <212> DNA <213> Artificial Sequence <220> <223> bLF_1kbHR_GFP KI vector 5'arm <400> 1 ggcacttagg ccaaattcta aatcaaaatg aatttacaac ttgatgcctt tgaagactca 60 agattaccac cttctaccaa gagaagtagt gctagaagtt ggccattgtt aaggaactcc 120 ttgaattaaa aaaacacata ttaagactta gttttcatta aaacaaacaa aaataaacct 180 cagagtaact tttaaagtct ttttaaaatg gatctttctt tgttatatga aaccagtttg 240 gactattatc caaagtatgt agccaccact ctgcaggcaa ctcaggaaga ggtggaataa 300 gtgttgaaat ctccaaaccc tgatttcact tgactctctg atttcacctg tgaagaaagt 360 gt; tcttaaccaa accaaatgga agattttctt tctctctctt cactgaatta tgttttaaaa 480 agaggaggat aattcatcat gaataacaat tataactgga ttatggactc aaagatttgt 540 tttccttctt tccaggatga actccaggat aaaatccacc cctttgccca gacacagtct 600 ctagtctatc ccttccctgg gcccatccct aacagcctcc cacaaaacat ccctcctctt 660 actcaaaccc ctgtggtggt gccgcctttc cttcagcctg aagtaatggg agtctccaaa 720 gtgaaggagg ctatggctcc taagcacaaa gaaatgccct tccctaaata tccagttgag 780 ccctttactg aaagccagag cctgactctc actgatgttg aaaatctgca ccttcctctg 840 cctctgctcc agtcttggat gcaccagcct caccagcctc ttcctccaac tgtcatgttt 900 cctcctcagt ccgtgctgtc cctttctcag tccaaagtcc tgcctgttcc ccagaaagca 960 gtgccctatc cccagagaga tatgcccatt caggcctttc tgctctacca agagcctgta 1020 ctaggtcctg tccggggacc ctttcctatc attgtc 1056 <210> 2 <211> 116 <212> DNA <213> Artificial Sequence <220> <223> bLF_100HR_GFP KI vector 5'arm <400> 2 gcggccgcaa agcagtgccc tatccccaga gagatatgcc cattcaggcc tttctgctct 60 accaagagcc tgtactaggt cctgtccggg gaccctttcc tatcattgtc ctcgag 116 <210> 3 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> bLF_40HR_GFP KI vector 5'arm <400> 3 gcggccgccc tgtactaggt cctgtccggg gaccctttcc tatcattgtc ctcgag 56 <210> 4 <211> 1792 <212> DNA <213> Artificial Sequence <220> <223> bLF_1kbHR_GFP KI vector 3'arm <400> 4 ctaactgtgc tgtttaactt ctgatgtttg tatgatattc gagtaattaa gagtcctata 60 aaaaaatgaa taatgaatgg ttccaaaata agcatagctg agattaatga ttgtcagcat 120 tagttataaa tagaataagc tggagaactt tcacctcccc tccaccacca gatctcaatg 180 tctaggctta cccgtggaga ttctgatgta attgttcttt ctatgtagaa gaaacttatt 240 gggaagaaat aatataatgg actatgattt aattggtctg ttgagaccaa ttaaattaga 300 tgaaggcgat taaggtacaa taaagccaga attgaatttg ataatctcat ttggctaaga 360 ataacaaacc taagaaggtt tgctattttc tacaattttg aagttctcct tatgcacaat 420 tatttcacca catgactcat ttcacatctt gtttttgata tatgagcata tgagggaaaa 480 atactgagat gcttatttca atactcaggg aaaattttct tgccaaaagg caagaattgt 540 ataaatcatt cacttatttt attttattat tttttttatt tttaaggtct aagaggattt 600 caaagtgaat gccccctcct cacttttggt aggctttagg atattggagg cagactgatc 660 atttttatag ttaatatctt ttacatttca ttttcctgga taagctccaa tagtagcaat 720 ttccatcagt gtaccagctt aaagattaat tataaattta ttttcaatga ttgactgtta 780 tttactggcc tgaaattatg tatctgttat atttcaaata atgcaaaact gtatatatat 840 ggtgtttaca gatttgattg gttttctttc aatagcctat atccttatta ttgattgtca 900 tcatttatag aaaaaactga aaataatttc ttatactttt atgtaaacct gttagagctt 960 attttaaaga tcaactgcat tcacatttct aatctagtca ttatgagctt caatagtttt 1020 atctcactta aaatatatat attgtctttt aattcatgag tcaaaataca atctcacagt 1080 ccagatatgg gacttaaaag ggggatagaa tatagttttg atattcttaa caatacacat 1140 ccttttgtga tcatgattca gcagacattt taataaaatg attccaagta agccgatgtt 1200 tggtcctaga ggaattttta taacctttaa gagaaggcat agcatggtgt ttttgtaata 1260 agatttcttt tatgaaaaag tcacaccaaa attgcaaatg gggtgagatg aagagttata 1320 acatataact aaatctatgt ttgttctcta ttccacagaa ttgactgcga ctggaaatat 1380 ggcaactttt caatccttgc atcatgttac taagataatt tttaaatgag tatacatgga 1440 acaaaaaatg aaactttatt cctttattta ttttatgctt tttcatctta atttgaattt 1500 gagtcataaa ctatatattt caaaatttta attcaacatt agcataaaag ttcaatttta 1560 acttggaaat atcatgaaca tatcaaaata tgtataaaaa taatttctgg aattgtgatt 1620 attatttctt taagaatcta tttcctaacc agtcatttca ataaattaat ccttaggcat 1680 atttaagttt tcttgtcttt attatatttt ttttaatgaa attggtctct ttattgttaa 1740 cttaaattta tctttgatgt taaaaagagc tgtggaaaat taaaattgaa ta 1792 <210> 5 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> bLF_100HR_GFP KI vector 3'arm <400> 5 aagcttctaa ctgtgctgtt taacttctga tgtttgtatg atattcgagt aattaagagt 60 cctataaaaa aatgaataat gaatggttcc aaaataagca tagctggtcg ac 112 <210> 6 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> bLF_40HR_GFP KI vector 3'arm <400> 6 aagcttctaa ctgtgctgtt taacttctga tgtttgtatg atattcgtcg ac 52 <210> 7 <211> 2127 <212> DNA <213> Artificial Sequence <220> <223> bovine lactoferrin gene <400> 7 atgaagctct tcgtccccgc cctgctgtcc cttggagccc ttggactgtg tctggctgcc 60 ccgaggaaaa acgttcgatg gtgtaccatc tcccaacctg agtggttcaa atgccgccga 120 tggcagtgga ggatgaagaa gctgggtgct ccctctatca cctgtgtgag gagggccttt 180 gccttggaat gtatccgggc catcgcggag aaaaaggcgg atgctgtgac cctggatggt 240 ggcatggtgt ttgaggcggg ccgggacccc tacaaactgc ggccagtagc agcagagatc 300 tatgggacga aagagtctcc ccaaacccac tattatgctg tggccgtcgt gaagaagggc 360 agcaactttc agctggacca gctgcaaggc cggaagtcct gccatacggg ccttggcagg 420 tccgctgggt ggatcatccc tatgggaatc cttcgcccgt acttgagctg gacagagtca 480 ctcgagcccc tccagggagc tgtggctaaa ttcttctctg ccagctgtgt tccctgcatt 540 gatagacaag cataccccaa cctgtgtcaa ctgtgcaagg gggaggggga gaaccagtgt 600 gcctgctcct cccgggaacc atacttcggt tattctggtg ccttcaagtg tctgcaggac 660 ggggctggag acgtggcttt tgttaaagag acgacagtgt ttgagaactt gccagagaag 720 gctgacaggg accagtatga gcttctctgc ctgaacaaca gtcgggcgcc agtggatgcg 780 ttcaaggagt gccacctggc ccaggtccct tctcatgctg tcgtggcccg aagtgtggat 840 ggcaaggaag acttgatctg gaagcttctc agcaaggcgc aggagaaatt tggaaaaaac 900 aagtctcgga gcttccagct ctttggctct ccacccggcc agagggacct gctgttcaaa 960 gactctgctc ttgggttttt gaggatcccc tcgaaggtag attcggcgct gtacctgggc 1020 tcccgctact tgaccacctt gaagaacctc agggaaactg cggaggaggt gaaggcgcgg 1080 tacaccaggg tcgtgtggtg tgccgtggga cctgaggagc agaagaagtg ccagcagtgg 1140 agccagcaga gcggccagaa cgtgacctgt gccacggcgt ccaccactga cgactgcatc 1200 gtcctggtgc tgaaagggga agcagatgcc ctgaacttgg atggaggata tatctacact 1260 gcgggcaagt gtggcctggt gcctgtcctg gcagagaacc ggaaatcctc caaacacagt 1320 agcctagatt gtgtgctgag accaacggaa ggctaccttg ccgtggcagt tgtcaagaaa 1380 gcaaatgagg ggctcacatg gaattctctg aaagacaaga agtcgtgcca caccgccgtg 1440 gacaggactg caggctggaa catccccatg ggcctgatcg tcaaccagac aggctcctgc 1500 gcatttgatg aattctttag tcagagctgt gcccctgggg ctgacccgaa atccagactc 1560 tgtgccttgt gtgctggcga tgaccagggc ctggacaagt gtgtgcccaa ctctaaggag 1620 aagtactatg gctataccgg ggctttcagg tgcctggctg aggacgttgg ggacgttgcc 1680 tttgtgaaaa acgacacagt ctgggagaac acgaatggag agagcactgc agactgggct 1740 aagaacttga atcgtgagga cttcaggttg ctctgcctcg atggcaccag gaagcctgtg 1800 acggaggctc agagctgcca cctggcggtg gccccgaatc acgctgtggt gtctcggagc 1860 gatagggcag cacacgtgaa acaggtgctg ctccaccagc aggctctgtt tgggaaaaat 1920 ggaaaaaact gcccggacaa gttttgtttg ttcaaatctg aaaccaaaaa ccttctgttc 1980 aatgacaaca ctgagtgtct ggccaaactt ggaggcagac caacgtatga agaatatttg 2040 gggacagagt atgtcacggc cattgccaac ctgaaaaaat gctcaacctc cccgcttctg 2100 gaagcctgcg ccttcctgac gaggtaa 2127 <210> 8 <211> 227 <212> DNA <213> Artificial Sequence <220> <223> bovine growth hormone poly <400> 8 cgactgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg ccttccttga 60 ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt gcatcgcatt 120 gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc aagggggagg 180 attgggaaga caatagcagg catgctgggg atgcggtggg ctctatg 227 <210> 9 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> Purin-F2A <400> 9 agaaaaagaa gggctcctgt caaacaaact cttaactttg atttactcaa actggctggg 60 gatgtagaaa gcaatccagg tcca 84 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> bLF KpnI S <400> 10 ggtaccatga agctcttcct ccccgccctg ctgt 34 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> bLF XbaI AS <400> 11 tctagattac ctcgtcagga aggcgcaggc ttc 33 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> bLF KpnI mutation AS <400> 12 caaggtagcc ttccgttggt 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> bLF KpnI mutation S <400> 13 accaacggaa ggctaccttg 20 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> bLF XbaI mutation AS <400> 14 gctctagact acattctgta gttcttgttt cct 33 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 100HR NotI S <400> 15 gcgcggccgc aaagcagtgc cctatcc 27 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 100HR SalI AS <400> 16 gcgtcgacag ctatgcttat tttggaac 28 <210> 17 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> 40HR NotI S <400> 17 gcgcggccgc cctgtactag gtcctgtcc 29 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 40HR SalI AS <400> 18 gcgtcgacga atatcataca aacatcag 28 <210> 19 <211> 69 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > b beta CE7-2 sgRNA oligo <400> 19 gcctgcagta atacgactca ctatagcaat aatagggaag ggtcccgttt tagagctaga 60 aatagcaag 69 <210> 20 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> Constant oligo <400> 20 gcgaattcaa aagcaccgac tcggtgccac tttttcaagt tgataacgga ctagccttat 60 tttaacttgc tatttctagc tctaaaac 88 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Oligo S <400> 21 gcctgcagta atacgactca ctatag 26 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Oligo AS <400> 22 gcgaattcaa aagcaccgac tcggtg 26 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> E7 indel S1 <400> 23 taccactctg caggcaactc aggaaga 27 <210> 24 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> E7 indel AS1 <400> 24 ggtaagccta gacattgaga tctggtg 27 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> E7 indel S2 <400> 25 ggagtctcca aagtgaagga ggctatgg 28 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> E7 indel AS2 <400> 26 ctcagctatg cttattttgg aaccattc 28 <210> 27 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> pBSK (-) 1 sgRNA oligo <400> 27 gcctgcagta atacgactca ctataggcaa aagctggagc tccaccggtt ttagagctag 60 aaatagcaag 70 <210> 28 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> pBSK (-) SalI sgRNA oligo <400> 28 gcctgcagta atacgactca ctatagggta ccgggccccc cctcggtttt agagctagaa 60 atagcaag 68 <210> 29 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> bRAD51 NotI S <400> 29 gcggccgcca ccatggctat gcaaatgcag ct 32 <210> 30 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> bRAD51 XbaI AS <400> 30 ctagaaattc agtctttggc atctccca 28 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pRC-CMV T7 pro S <400> 31 taatacgact cactataggg 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> pRC-CMV BGH pA AS <400> 32 tccccagcat gcctgctatt 20 <210> 33 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> bLF 5 Sc S3 <400> 33 tgcccagatg agagaagtga ggtacaggac 30 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> bLF 5 Sc AS9 <400> 34 cagggtcaca gcatccgcct ttttctccgc 30 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> exon 7 target sgRNA <400> 35 aataataggg aagggtcccc gg 22 <210> 36 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pBSK (-) 1 sgRNA <400> 36 caaaagctgg agctccaccg cgg 23 <210> 37 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> pBSK (-) SalI sgRNA <400> 37 gggtaccggg ccccccctcg agg 23

Claims (15)

A 5'-arm fragment comprising a nucleic acid sequence as set forth in SEQ ID NO: 3 and comprising a promoter of a sub-beta-casein genomic DNA, a portion of exon 7;
A gene encoding a therapeutic protein; And
A 3'-arm, comprising a nucleic acid sequence as set forth in SEQ ID NO: 6 and comprising an intron portion between exons 7 and 8 of a sub-beta-casein genomic DNA. The method according to claim 1,
The therapeutic protein is bovine lactoferrin, a knock-in vector. 3. The method of claim 2,
Wherein the gene encoding the bovine lactoferrin is a polynucleotide consisting of a nucleic acid sequence represented by SEQ ID NO: 7. 3. The method of claim 2,
A knock-in vector to which a polyA signal is additionally attached to the 3 'end of the gene encoding the bovine lactoferrin. 3. The method of claim 2,
A knock-in vector further comprising a reporter gene for confirming the expression of the fusion fluorescent protein at the 3 'end of the gene encoding the bovine lactoferrin. 6. The method of claim 5,
The fluorescent protein may be selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP) Knock-in vector, which is a cyan fluorescent protein (CFP), a blue fluorescent protein (BFP), or a far-red fluorescent protein. The method according to claim 1,
A knock-in vector comprising a positive selectable marker or a negative selectable marker. 8. The method of claim 7,
Wherein the positive selection marker is a neo gene, a puromycin resistance gene, or a zeocin resistance gene. A knock-in vector as claimed in any one of claims 1 to 7;
SUBBETA-casein genome DNA exon 7 TABLE-US-00086 sgRNA;
5'-arm labeled sgRNA of the knock-in vector;
3'-arm labeled sgRNA of the knock-in vector; And
Cas9 or a polynucleotide encoding said Cas9. 10. The method of claim 9,
35. The composition of claim 21, wherein the sβRNA is a nucleic acid sequence as set forth in SEQ ID NO: 35. 10. The method of claim 9,
36. A composition for targeting a nucleic acid sequence as set forth in SEQ ID NO: 36 of a 5'-arm sgRNA of the knock-in vector. 10. The method of claim 9,
37. The composition of claim 37, wherein the target is a nucleic acid sequence as set forth in SEQ ID NO: 37 of the 3'-arm of the knockin vector. 10. The method of claim 9,
wherein the composition further comprises a bRAD51 protein or a polynucleotide encoding the bRAD51 protein. A microinjection step of microinjecting the composition of sub-beta-casein genomic DNA knock-in of claim 9 into a fertilized egg of a cow;
Culturing the microinjected embryo to a blastocyst;
An amplification step of amplifying the DNA of the blastocyst embryo by PCR; And
The presence or absence and size of the amplified PCR product are determined and it is confirmed that the vector has been inserted into the place of the sub-beta-casein genomic DNA. The gene encoding the protein for treating beta-casein genomic DNA in bovine embryo -In method. A transformant for the mass production of a therapeutic protein, which is generated from a recombinant bovine embryo knocked out with a beta-casein genomic DNA in the nucleus of a bovine embryo with the composition of the sub-beta-casein genomic DNA knockout of claim 9.

Images