CN111073963B - Method for identifying gender of fertilized eggs of chickens in one day - Google Patents
Method for identifying gender of fertilized eggs of chickens in one day Download PDFInfo
- Publication number
- CN111073963B CN111073963B CN201911260564.8A CN201911260564A CN111073963B CN 111073963 B CN111073963 B CN 111073963B CN 201911260564 A CN201911260564 A CN 201911260564A CN 111073963 B CN111073963 B CN 111073963B
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- chicken
- hatching
- egg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses a method for identifying the sex of a fertilized egg of a chicken in one day, which comprises the following steps: inserting a tag protein gene at a fixed point on a Z chromosome of a chicken, constructing a pure line carrying a homozygote of an inserted fragment of the tag protein gene, and matching and combining the pure line and a wild individual, wherein the sex of a hatching egg can be judged by irradiating the hatching egg by optical equipment on the first day of hatching. The identification method can accurately judge the sex of the fertilized eggs within one day after the fertilized eggs are hatched, can ensure the normal production of the female and the young eggs, does not waste male hatching eggs, is convenient and quick, has low cost, and is suitable for popularization and application.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a method for identifying the sex of a fertilized egg of a chicken in one day.
Background
Sex determination of early embryo of fertilized egg of chicken is always an industry difficulty. The main reason is that avian embryo development has characteristics different from mammals: the development of the poultry embryo is divided into an in-vivo stage and an in-vitro stage, after the sperms and the eggs are combined and only stay in the body for about 20 to 26 hours, the poultry embryo is delivered in the form of an egg, and the development is suspended, the embryo is in a blastocyst stage, and the gender of the embryo in the body of a hen can not be detected by the prior art; after the fertilized egg is delivered, the fertilized egg begins to continue to develop at a proper temperature, thick albumen exists outside the fertilized egg, the albumen outside is a firm eggshell, and the traditional hatching technology can only distinguish whether the fertilized egg is, whether the embryo dies and cannot distinguish the sex by 'photographing the egg'.
Currently, the common male and female identification technologies are mainly divided into two types: one is that after hatching, through some accompanying characters such as 'gold and silver feather', 'fast and slow feather' and 'transverse spot', etc., the male and female can be quickly identified within 24 hours after the chicks are hatched, and the accuracy rate is over 95 percent. Although the technology meets the requirement of commercial generation breeding of laying hens to a certain extent, cocks equal to hens are immediately slaughtered, and waste and humanitarian trouble are caused. The implementation of the technology needs to cultivate specialized strains (such as slow feather strains and the like), can be realized only by special hybridization matching combination, and can not realize self-discrimination of male and female through the seed selection of the strain. Another technique is to directly manipulate the fertilized egg at the hatching stage to determine gender. Typical methods such as spectral scanning utilize physiological and biochemical indicators of embryos of different sexes such as: the early sex determination of the embryo can be realized by different concentrations of components such as hemoglobin, and the like, and the method can be realized only after the embryo develops for at least 7 days (namely, the sex differentiation of the embryo is enough). By utilizing the puncture technology, part of tissue fluid in the embryo is extracted, and the chromosome composition of the embryo can be identified through PCR (polymerase chain reaction), so that the sex is judged. Even if the sex of the fertilized eggs is judged 7 days after the embryos are incubated, the eggs which are incubated for more than one week cannot be used for other purposes, and the resource waste is caused. Meanwhile, the eggshells are required to be damaged by the technology, and industrial production cannot be realized.
Therefore, a technology capable of accurately judging the sex of the fertilized eggs in the early embryonic development stage (such as within one day after hatching) is needed, the normal production of the female and the female young eggs can be ensured, and the male hatching eggs cannot be wasted, so that the defects in the prior art are overcome.
Disclosure of Invention
It is an object of the present invention to address at least the above problems and to provide at least the advantages described hereinafter.
The invention also aims to provide a method for identifying the gender of the fertilized eggs of the chickens in one day, which can accurately judge the gender of the fertilized eggs within one day after the fertilized eggs are hatched, can ensure the normal production of the female and the young chickens, does not waste male eggs, is convenient and quick, has low cost and is suitable for popularization and application.
To achieve these objects and other advantages in accordance with the purpose of the invention, there is provided a method for sexing a fertilized egg of a chicken at one day age, comprising the steps of:
inserting a tag protein gene at a fixed point on a Z chromosome of a chicken, constructing a pure line of which the genotype is a homozygote carrying an inserted fragment of the tag protein gene, and matching and combining the pure line and a wild individual, wherein the sex of a hatching egg can be judged by irradiating the grown hatching egg by optical equipment on the first day of hatching.
Preferably, the tag protein gene is a marker gene inserted at a site-specific position on the Z chromosome, which can be used for early identification and can be detected.
Preferably, the tag protein gene is a green fluorescent protein gene.
Preferably, the method for constructing the pure line of which the genotype is homozygote of the gene insert carrying the green fluorescent protein specifically comprises the following steps:
step 1: designing a guide RNA sequence according to the Z chromosome genome sequence of the poultry;
and 2, step: through molecular cloning, a guide RNA sequence is inserted into a multiple cloning site of AAV-CRISPR plasmid containing xCAS9 protein to construct CRISPR/CAS gene cutting plasmid;
and step 3: obtaining a target sequence according to an insertion site on a Z chromosome, respectively amplifying an upstream homologous arm sequence shown as SEQ ID NO. 1 and a downstream homologous arm sequence shown as SEQ ID NO. 2 according to a gene sequence of 1kb at the upstream and downstream of the target sequence, connecting the upstream homologous arm sequence and the downstream homologous arm sequence with a green fluorescent protein gene through molecular cloning to form a donor gene sequence, cloning the donor gene sequence into an AAV plasmid, and constructing a CRISPR/CAS gene donor plasmid;
and 4, step 4: respectively carrying out AVV virus packaging on the constructed CRISPR/CAS gene cutting plasmid and CRISPR/CAS gene donor plasmid to obtain two virus stock solutions, and respectively carrying out purification and concentration to obtain two working solution viruses;
and 5: injecting the two obtained working solution viruses into the blastoderm of the early chicken fertilized egg together, and hatching; a (c)
Step 6: performing positive identification on the hatched chick F0 generation through phenotype and PCR amplification detection; breeding positive F0 generation chickens and wild type chickens, and obtaining heterozygote F1 generation chickens with exogenous gene genetic ability by a positive identification method; (ii) a
And 7: and (4) breeding the F1 generation positive heterozygote cock and the positive hen in the step (6) to produce chicks, and obtaining homozygous individuals of which the cock and the hen are both subjected to gene modification by a positive identification method.
Preferably, the guide RNA sequence in step 1 is specifically designed in the following manner: the method is characterized in that a proper PAM locus is found on 75842691-75842693bp positioned on a Z chromosome, a target sequence of 20-24bp near the locus is obtained, and then the target sequence and the tracerRNA sequence are fused.
Preferably, the titer of the virus of the working solution in the step 4 is not less than 10 12 vg/mL。
Preferably, the injection positions in step 5 are: and horizontally placing the egg to be injected and marking the intersection point of the long shaft and the short shaft, windowing at the intersection point after alcohol disinfection, and finding a bright area above the blastoderm.
Preferably, the injection volume of the working fluid virus in step 5 is 0.5-2 μ L.
Preferably, in the positive identification in step 6 and step 7, the conditions for PCR amplification detection are as follows: pre-denaturation at 95 ℃ for 5min; performing denaturation at 94 ℃ for 30s-60 ℃, annealing at 30s-72 ℃ for 30s, and extending for 25 times; extending for 5min at 72 ℃; storing at 4 ℃.
Preferably, the pure line and the wild type individual are combined in a matched way, and the specific matched combination form is as follows: and (4) mating the wild cock not carrying the green fluorescent protein with the hen carrying the green fluorescent protein screened in the step (7), judging whether the generated hatching eggs are male or female according to the existence of green fluorescence, wherein male hatching eggs capable of detecting green fluorescence reaction and female hatching eggs capable of detecting green fluorescence reaction can not be detected.
Preferably, the optical device is a device capable of irradiating the hatching egg with ultraviolet light having a wavelength of 395nm or blue light having a wavelength of 450 to 490nm as the excitation light.
The invention at least comprises the following beneficial effects:
the invention utilizes gene editing technology to insert the green fluorescent protein gene into the sex chromosome Z of chicken, and constructs pure lines of which the genotypes are homozygotes carrying green fluorescent protein insert segments. By matching and combining the pure line and a wild individual, the sex of the hatching egg can be accurately judged in the first day of hatching: female hatching eggs which do not carry green fluorescent protein genes can be used for large-scale laying hen production, and male hatching eggs which carry inserted genes can be used for a bioreactor and the like. Compared with other embryo sex identification methods, the embryo female identification is completed in the first day of hatching egg hatching, the accuracy is high, eggshells are not damaged by the method, the stress on the hatching eggs is small, the embryo after early sex identification can be timely processed, and the waste of hatching resources is avoided.
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.
Drawings
FIG. 1 shows the genotype identification results of F0-generation genetically modified animals, wherein lanes from left to right are WT (unmodified wild-type gene), male heterozygous, male homozygous, female positive, marker minimum 200bp, and Marker brightest band 1000bp, respectively;
FIG. 2 shows the construction of pure line and wild type individual combination form.
Detailed Description
The present invention is described in further detail below to enable those skilled in the art to practice the invention with reference to the description.
It will be understood that terms such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or combinations thereof.
The invention provides a method for identifying the sex of a fertilized egg of a chicken in one day, which comprises the following steps:
inserting a tag protein gene at a fixed point on a Z chromosome of a chicken, constructing a pure line of which the genotype is a homozygote carrying an inserted fragment of the tag protein gene, and matching and combining the pure line and a wild individual, wherein the sex of a hatching egg can be judged by irradiating the grown hatching egg by optical equipment on the first day of hatching.
In the scheme, a proper PAM site is found between two genes on a Z chromosome of the chicken, the exogenous reporter gene is inserted in a cloning mode, the application screens out a pure line carrying a homozygote of a tag protein insert in offspring through the insertion of the tag protein gene and the expression of the inserted tag protein and the joint identification of phenotype and genotype, and the generated egg carrying a tag protein allele is a male egg and does not carry the gene of the tag protein insert and is expressed as a wild type egg, namely a female egg, through the matched combination of the pure line and a wild type individual.
In a preferred embodiment, the tag protein gene is a marker gene inserted at a site-specific position on the Z chromosome, which can be used for early identification and can be detected.
In a preferred embodiment, the tag protein gene is a green fluorescent protein gene.
In the scheme, the green fluorescent protein gene is adopted to facilitate early identification, and the sex of the hatching egg can be conveniently detected according to whether green or blue fluorescence exists or not through irradiation of optical equipment.
In a preferred embodiment, the method for constructing a pure line with the genotype of the homozygote carrying the green fluorescent protein gene insert specifically comprises the following steps:
step 1: designing a guide RNA sequence according to the Z chromosome genome sequence of the poultry;
step 2: through molecular cloning, a guide RNA sequence is inserted into a multiple cloning site of AAV-CRISPR plasmid containing xCAS9 protein to construct CRISPR/CAS gene cutting plasmid;
and 3, step 3: obtaining a target sequence according to an insertion site on a Z chromosome, respectively amplifying an upstream homologous arm sequence shown as SEQ ID NO. 1 and a downstream homologous arm sequence shown as SEQ ID NO. 2 according to a gene sequence of 1kb of upstream and downstream of the target sequence, connecting the upstream homologous arm sequence and the downstream homologous arm sequence with a green fluorescent protein gene through molecular cloning to form a donor gene sequence, cloning the donor gene sequence into an AAV plasmid, and constructing a CRISPR/CAS gene donor plasmid;
and 4, step 4: respectively carrying out AVV virus packaging on the constructed CRISPR/CAS gene cutting plasmid and CRISPR/CAS gene donor plasmid to obtain two virus stock solutions, and respectively purifying and concentrating to obtain two working solution viruses;
and 5: injecting the two obtained working solution viruses into the blastoderm of the early chicken fertilized eggs together, and hatching; a
Step 6: performing positive identification on the hatched chick F0 generation through phenotype and PCR amplification detection; breeding positive F0 generation chickens and wild chickens, and obtaining heterozygote F1 generation chickens with exogenous gene genetic capacity by a positive identification method; (ii) a
And 7: and (4) breeding the chicks of the positive heterozygote cock and the positive hen in the F1 generation in the step 6 by a positive identification method to obtain homozygous individuals of which both the cock and the hen are genetically modified.
In a preferred embodiment, the guide RNA sequence in step 1 is specifically designed in the following manner: a suitable PAM site is found on 75842691-75842693bp on a Z chromosome, a target sequence of 20-24bp near the site is obtained, and then the target sequence and the tracerRNA sequence are fused.
In a preferred embodiment, the titer of the working virus in step 4 is not less than 10 12 vg/mL。
In a preferred embodiment, the injection positions in step 5 are: horizontally placing the egg to be injected and marking the intersection point of the long shaft and the short shaft, windowing at the intersection point after alcohol disinfection, and finding a bright area above the blastoderm;
the injection volume of the working solution virus is 0.5-2 mu L.
In a preferred embodiment, when positive identification is performed in step 6 and step 7, the conditions for PCR amplification detection are as follows: pre-denaturation at 95 ℃ for 5min; performing denaturation at 94 ℃ for 30s-60 ℃, annealing at 30s-72 ℃ for 30s, and performing extension for 25 times; extending for 5min at 72 ℃; storing at 4 ℃.
In a preferred embodiment, the pure line and the wild type individual are combined in a matched manner, and the specific matched combination form is as follows: and (4) mating the wild cock not carrying the green fluorescent protein with the hen carrying the green fluorescent protein screened in the step (7), judging whether the generated hatching eggs are male or female according to the existence of green fluorescence, wherein male hatching eggs capable of detecting green fluorescence reaction and female hatching eggs capable of detecting green fluorescence reaction can not be detected.
In a preferred embodiment, the optical device is a device capable of irradiating the hatching egg with ultraviolet light having a wavelength of 395nm or blue light having a wavelength of 450 to 490nm as the excitation light.
In addition, the technical means mainly adopted by the application is to insert the detectable tag protein gene which can be used for early identification at a fixed point on the Z chromosome of the chicken, so the method is not limited to the specific gene editing method, the plasmid and the tag protein gene used in the following specific methods.
To achieve specific gene editing on sex chromosomes, the inventors used the currently most advanced third generation genome site-directed editing techniques: CRISPR/CAS (clustered regularly interspaced short palindromic repeats) techniques. The basic principle of the technology is that a guide RNA (gRNA) formed by fusing tracerRNA and a target sequence and a CAS protein form a cutting complex; the complex specifically recognizes a target sequence near a Preseparation Adjacent Motif (PAM) on the genome, and cleaves the target sequence to form a double-stranded break (DSB). The presence of native DNA break repair mechanisms non-homologous end-linking (NHEI) and Homologous Recombination (HR) in the body; when donor DNA exists, homologous recombination can occur, and then the donor DNA can be inserted into a DNA breaking position, so that the aim of inserting an exogenous reporter gene is finally achieved. According to the method, a site-specific insertion method for the chicken Z chromosome non-coding region green fluorescent protein gene is designed.
Example 1
A method for identifying the sex of fertilized eggs of a chicken in one day age selects a certain white-shell layer chicken strain.
1. Construction of Gene-modified Chicken pure line
(1) Guide RNA sequence design
According to the Z chromosome genome sequence of the poultry, a PAM locus is searched in a spacer sequence of two genes positioned on the Z chromosome, a target sequence of 20-24 bases nearby the PAM locus is obtained, the PAM locus is fused with a known tracerRNA sequence, and a guide RNA sequence is designed, wherein the forward gRNA sequence is shown as SEQ ID NO. 3; the reverse gRNA sequence is shown in SEQ ID NO. 4, and after the whole reverse sequences are respectively synthesized, double-stranded DNA is synthesized by annealing at 95 ℃.
(2) Construction of Gene cleavage plasmids
The plasmid is directly connected to the polyclonal site of AAV-CRISPR plasmid (the plasmid contains xCS 9 protein) containing BsmB1 enzyme cutting site through enzyme cutting site sequences added on both sides of the positive direction of the gRNA sequence, and the site is positioned at the downstream of a eukaryotic promoter, so that CRISPR/CAS gene cutting plasmid is constructed.
(3) Donor plasmid construction
A necessary prerequisite for homologous recombination to occur is that the donor gene sequence requires upstream and downstream homology sequences that match the DNA break site. Designing PCR amplification primers according to genome sequences of 1kb of each upstream and downstream of a target sequence, respectively amplifying homologous arms of about 1kb of the upstream and downstream of the target sequence, and connecting the homologous arms as shown in SEQ ID NO. 1 and the homologous arms as shown in SEQ ID NO. 2 to the 5 'end and the 3' end of a green fluorescent protein gene (EGFP as shown in SEQ ID NO. 5) by a molecular cloning means to form a complete donor gene sequence; finally, the donor gene sequence is cloned into AAV plasmid to construct CRISPR/CAS donor plasmid.
(4) AAV virus packaging
The constructed CRISPR/CAS gene excision plasmid and donor plasmid, together with helper plasmid, packaging plasmid, were transfected into HEK293T cells, respectively, according to the ratio of 25. Shaking gently and mixing, placing the cells at 37 deg.C, 5% 2 Culturing in an incubator, observing the transfection efficiency 24h after transfection, and collecting cell culture supernatant for virus purification after culturing for 3 days. And purifying and concentrating the obtained virus stock solution to obtain the working solution virus for transgenic operation. To ensure sufficient virus infection efficiency, the titer of the virus in the working solution is not less than 10 12 vg/mL。
(5) Genetic modification of chick embryos
The two resulting working solution viruses were co-injected into blastoderms of early chicken zygotes (1 d-5 d) as follows: the hatching egg to be injected is horizontally placed and marked with the intersection point of the long axis and the short axis, and after the disinfection by alcohol, a window is opened at the intersection point, and the size is suitable for seeing the blastoderm. Finding out the clear vitelline surface (bright area) above blastoderm under stereomicroscope, sucking 0.5-2ul virus with microscope needle, injecting to the bright area, sealing the hatching egg with parafilm after injection, and incubating.
(6) F0 generation gene modified animal identification and passage
The hatched chick is the F0 generation, and the positive identification is carried out on the F0 animal.
Positive animal standard: 1. phenotype, namely animal skin tissue shows green under the blue laser luminescence of about 488 nm; 2. the EGFP gene can be detected by PCR amplification with chicken tissue DNA as a template; and (3) breeding the positive F0 generation animal with a wild animal to obtain a positive F1 generation animal (the identification method is the same as that of the F0 animal), wherein the F1 generation animal is a heterozygote animal with the genetic ability of the exogenous gene (green fluorescent protein).
PCR identification primer: f, cactacaccccttatgcctg
R:ttccctcccctctagggag
Amplification conditions: pre-denaturation at 95 ℃ for 5min; performing denaturation at 94 ℃ for 30s-60 ℃, annealing at 30s-72 ℃ for 30s, and performing extension for 25 times; extending for 5min at 72 ℃; storing at 4 deg.C.
When designing the PCR identifying primer of the genetically modified animal, the upstream primer and the downstream primer are respectively positioned at two sides of the Z chromosome genome target sequence. As the exogenous fluorescent marker gene is inserted into the position of the target sequence of the positive animal, a 1028bp product containing the EGFP gene can be obtained after amplification; and the non-gene modified animal has only 230bp product, and two different products can be separated and distinguished by agarose gel electrophoresis, and the method can also distinguish heterozygote and homozygote male individuals. Because heterozygote individuals have a genetically modified Z chromosome and an unmodified Z chromosome, the electrophoresis band of the PCR product has two bands (a positive large band and a negative short band); the Z chromosomes of homozygous individuals are genetically modified, so that the product has only one large band, as shown in FIG. 1.
(7) Obtaining a genetically modified homozygous animal:
the hen obtained in the step (6) only carries one Z chromosome, and the positive hen is a gene modification homozygous individual. And (4) repeating the PCR detection method in the step (6) for the chicks produced by the pure breeding of the positive heterozygote cock and the positive hen, eliminating individuals with two bands shown by the PCR amplification result, wherein the remaining cocks and hens are all gene modification homozygous individuals, and the cocks and the hens can be subjected to locked successive breeding to keep the gene modification homozygous characteristic.
2. Construction of hybrid combinations
(1) Collecting semen of a wild cock, diluting the semen by 5 times with semen diluent, and carrying out artificial insemination on a hen according to a cock-to-hen ratio of 1.
(2) Collecting qualified hatching eggs and sending the hatching eggs into an egg storage.
The construction principle is as follows: the pure line and wild type individuals obtained by the construction of 1 can produce hatching eggs in a matched combination mode as shown in figure 2.
3. Hatching egg identification
(1) Ultraviolet light with the wavelength of 395nm or blue light with the wavelength of 450-490nm is used as exciting light to irradiate hatching eggs;
(2) The male hatching eggs can be detected through the optical equipment when the green fluorescence reaction is detected, and the female hatching eggs are detected when the green fluorescence reaction is not detected.
The present application also compares the effect with other methods of gender identification in the prior art, as shown in Table 1
TABLE 1 comparison of the Effect of different methods for identifying the sex of chickens
As can be seen from Table 1, the labor intensity of the anus overturning workers is high, and the identification accuracy is low; according to the accompanying genetic traits such as golden and silver feathers, fast and slow feathers and the like, the processing is finished within 24 hours after hatching, although the labor intensity can be reduced and the identification accuracy is increased, a large number of male hatchlings are killed, so that humanistic troubles are caused, and meanwhile, production resources are wasted; the far infrared scanning and the puncture detection are carried out after the hatching eggs are hatched for 7 days, the identification accuracy of the far infrared scanning and the puncture detection is low, the eggshells of the hatching eggs need to be damaged, the industrial application cannot be realized, the hatching eggs which are hatched for more than 7 days cannot be used for other purposes, and the waste of resources is also caused. The invention can complete male and female identification within 1 day after hatching eggs, female hatching eggs are completely wild type and have no influence on normal production, and male hatching eggs are just hatched for 1 day and have no influence on other purposes.
While the embodiments of the invention have been disclosed above, it is not intended to be limited to the details shown in the description and the examples, which are set forth in the following description and drawings, but is fully applicable to various fields of endeavor for which the invention is entitled, and it will be readily apparent to those skilled in the art that additional modifications thereof can be made, and thus the invention is not limited to the details and instrumentalities shown herein without departing from the general concept defined by the appended claims and their equivalents.
Sequence listing
<110> Beijing Hospital affiliated to first university of medical science of Nanjing university of agriculture
<120> method for identifying gender of fertilized eggs of chickens in one day age
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1047
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctgctagatc attttgattc tgttctacgt gtcccaaaat aggcccgact tcccaccttt 60
ggcctcaact catgtctctt tcatatctcc tttttctttc tagtactccg gcacaggcag 120
gcagagcatc tcatcatgac acaggtaaaa cctcccaaca gcaccaagag gatgcaaact 180
aggaagagct gctttaacca tcctagattc agtagccagc tagtaagcaa gttccctaaa 240
tctccttccc agctggtgtc atcctgactt gtcctaggca ggactttcat ctgttcccaa 300
actttccatc aatctctccc gattcttaaa tccttcttgc tgtaagcaca gcgactctga 360
tttattcttg tgcaaacccc tccttccttg gctgttaatc ggtctagtgc catcctattc 420
tggagcactg ctttggataa aggggacact tcttcttgga ttgctcgtaa tgcatccgtt 480
gtgccattct ctatgatttc cagagttgca gagatattga ctctagcttt ttctagctgg 540
gcaactccta gagccgggat aagggctctc ggaaagcagt ggtatccctt gttctatata 600
gctaggggtt tgtatgtacg cttcgtttga atcccaaggg tcctcaggag tccccgaggg 660
atctcctcat gcaccatggt ctgggctatt aagtatcctg tagtgcaagt ccctgtccaa 720
tgtaaaggta ctgctttccg tgcctgagcg tccccacata accaccatgt ggtatccatg 780
aggtatctga catggcctgg ccatcttttc ctgaagagtg aacgatgctc ccatccctac 840
aattccgagt atgttcttct ctgagagcca gtgtgactcg ttatcgattc taggatcaca 900
ccccacactt tggttccacc cccaactaca ccctatgcct gtcaagttct gtcagccaac 960
ccccacccca cctttaccgt cagtttttct gtctacagag atagacctag tagagttagt 1020
aactagtcaa tgcaatgtag gtccctt 1047
<210> 2
<211> 1053
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttgtggcttg tcttctatcc caaacttaca ctttccgtgc tctagccaac ctggaagggt 60
ccaatgtagt gccaaaatcc cataaacggg cacctttccc tcccctctag ggagggcatt 120
gcatatccaa caagatttgt tgagagcctg gcccattttc tcagttcttc ggaagtagct 180
cttctcttgc caagctgtga ctactacccc cctcatactg accattctga aactcttatc 240
cgtgctttcg gatcctgatt ttcagcggtc ctctctcttg tgctgtccac tgtggtcctg 300
gtgctttctt caggcaggta tgatgtatcc acggtgtaag cccctctacc ttggccgtgg 360
tgtgggtggt caggagaagt tggtagggtc cttcccactt tggttccaga ggtacatctg 420
agggagattg tacgtaaaca cggtcgcctg gcaatacatg gtgcactgga gcgtcagtgc 480
tccagtcaat cagttcccag tcatgtgctt ctttgttgga ccacctttgc aaaaatgtgg 540
gcctcgatct gctgagattg ctccaggagc cctgaacctt ggaataaaca tcatgtaaca 600
gcatttttgt tgcttcccga accttaggag tcctccaggg aaatacctct ggccatcccc 660
aaaaggtatc agttagtgcc aacacccagc gatccccccc ttttcttggg ggtttcagga 720
agtcactttg tcagtgttgc cctggaaggt tccctttccc aataggccca cttgtagccc 780
tttgctggta ctaggatcgt gctttgtaac ctctgtttac ggtctggaat taaagccctc 840
ttcaacgacc tgctctaccc cctgatccac catcttctct ccagtttccg gtacagtgtt 900
ctctttctga tgtccttgac aatggatggt acccacgctt accttagtga agatttctgt 960
aacttctggg ggtacaccac tgtttgtccc agtttgtatg taagccagac ttaccatttt 1020
cagtcagttc atcttgtttg acccttagct cca 1053
<210> 3
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
caccgtgcaa tgtaggtccc ttttgtgg 28
<210> 4
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cacgttacat ccagggaaac acccaaa 27
<210> 5
<211> 798
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtcc 720
ggagctgcgg ccgctgccgc tgcggcagcg gccgaattcc ccgggctcga gaagcttgga 780
tccaccggat ctagataa 798
Claims (6)
1. A method for identifying the sex of a fertilized egg of a chicken in one day is characterized by comprising the following steps:
inserting a tag protein gene at a fixed point on a Z chromosome of a chicken, constructing a pure line of which the genotype is a homozygote carrying an inserted fragment of the tag protein gene, and matching and combining the pure line and a wild individual, wherein the sex of a hatching egg can be judged by irradiating the grown hatching egg by optical equipment on the first day of hatching;
the tag protein gene is a marker gene which can be used for early identification and can be detected and is inserted into a site-specific position on the Z chromosome;
the label protein gene is a green fluorescent protein gene;
the method for constructing the clone of the homozygote of the gene insert carrying the tag protein specifically comprises the following steps:
step 1: designing a guide RNA sequence according to the Z chromosome genome sequence of the poultry; the guide RNA sequence is specifically designed in the following mode: finding a proper PAM locus on 75842691-75842693bp positioned on a Z chromosome, obtaining a target sequence of 20-24bp near the locus, and fusing the target sequence and a tracerRNA sequence to obtain the protein; the guide RNA comprises a forward gRNA sequence shown as SEQ ID NO. 3 and a reverse gRNA sequence shown as SEQ ID NO. 4;
step 2: through molecular cloning, a guide RNA sequence is inserted into a multiple cloning site of AAV-CRISPR plasmid containing xCAS9 protein to construct CRISPR/CAS gene cutting plasmid;
and 3, step 3: obtaining a target sequence according to an insertion site on a Z chromosome, respectively amplifying an upstream homologous arm sequence shown as SEQ ID NO. 1 and a downstream homologous arm sequence shown as SEQ ID NO. 2 according to a gene sequence of 1kb of upstream and downstream of the target sequence, connecting the upstream homologous arm sequence and the downstream homologous arm sequence with a green fluorescent protein gene through molecular cloning to form a donor gene sequence, cloning the donor gene sequence into an AAV plasmid, and constructing a CRISPR/CAS gene donor plasmid;
and 4, step 4: respectively carrying out AVV virus packaging on the constructed CRISPR/CAS gene cutting plasmid and CRISPR/CAS gene donor plasmid to obtain two virus stock solutions, and respectively purifying and concentrating to obtain two working solution viruses;
and 5: injecting the two obtained working solution viruses into the blastoderm of the early chicken fertilized eggs together, and hatching;
step 6: carrying out positive identification on the hatched chick F0 generation through phenotype and PCR amplification detection; the positive F0 generation chicken and the wild chicken are bred, and heterozygote F1 generation chicken with exogenous gene genetic ability is obtained by a positive identification method;
and 7: and (4) obtaining homozygous individuals of the cock and the hen which are both genetically modified by a positive identification method from the chicks produced by pure breeding of the F1 generation positive heterozygote cock and the positive hen in the step 6.
2. The method for sex determination of a fertilized egg of a chicken of one day old according to claim 1, wherein the titer of the virus of the working fluid in step 4 is not less than 10 12 vg/mL。
3. The method for sexing a fertilized egg of a chicken of one day old according to claim 1, wherein the injection site in step 5 is: horizontally placing the egg to be injected and marking the intersection point of the long shaft and the short shaft, windowing at the intersection point after alcohol disinfection, and finding a bright area above the blastoderm;
the injection volume of the working solution virus is 0.5-2 mu L.
4. The method for sex discrimination of a fertilized egg of a chicken of one day old according to claim 1, wherein the PCR amplification primers for positive sex discrimination in steps 6 and 7 are: f, cactacaccctgcctg and R, ttcccctccctctaggggag, wherein the conditions for PCR amplification detection are as follows: pre-denaturation at 95 ℃ for 5min; performing denaturation at 94 ℃ for 30s-60 ℃, annealing at 30s-72 ℃ for 30s, and extending for 25 times; extending for 5min at 72 ℃; storing at 4 ℃.
5. The method for sex discrimination of a fertilized egg of a chicken of one day old according to claim 1, wherein the pure line is combined with a wild-type individual in a matched combination of: and (4) mating the wild cock not carrying the green fluorescent protein with the hen carrying the green fluorescent protein screened in the step (7), judging whether the generated hatching eggs are male or female according to the existence of green fluorescence, wherein the male hatching eggs capable of detecting the green fluorescent reaction are male hatching eggs, and the female hatching eggs capable of detecting the green fluorescent reaction are female hatching eggs.
6. The method for sex determination of a fertilized egg of a chicken of one day old according to claim 1, wherein the optical apparatus is an apparatus capable of irradiating the hatching egg with ultraviolet light having a wavelength of 395nm or blue light having a wavelength of 450 to 490nm as excitation light.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911260564.8A CN111073963B (en) | 2019-12-10 | 2019-12-10 | Method for identifying gender of fertilized eggs of chickens in one day |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911260564.8A CN111073963B (en) | 2019-12-10 | 2019-12-10 | Method for identifying gender of fertilized eggs of chickens in one day |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111073963A CN111073963A (en) | 2020-04-28 |
| CN111073963B true CN111073963B (en) | 2023-04-14 |
Family
ID=70313632
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911260564.8A Active CN111073963B (en) | 2019-12-10 | 2019-12-10 | Method for identifying gender of fertilized eggs of chickens in one day |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111073963B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018013759A1 (en) * | 2016-07-13 | 2018-01-18 | Yorktown Technologies, L.P. | Poultry and offspring sex selection |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2019505175A (en) * | 2015-12-03 | 2019-02-28 | エッグクシト，リミテッド | Method and means for determining the sex of an embryo in an unhatched egg of a bird |
| CN107384967B (en) * | 2017-03-30 | 2020-10-13 | 浙江省农业科学院 | Method for inserting exogenous gene into silkworm W chromosome at fixed point |
| CN109402244B (en) * | 2018-12-20 | 2022-05-03 | 广西大学 | Sex identification method for mammalian embryo |
-
2019
- 2019-12-10 CN CN201911260564.8A patent/CN111073963B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018013759A1 (en) * | 2016-07-13 | 2018-01-18 | Yorktown Technologies, L.P. | Poultry and offspring sex selection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111073963A (en) | 2020-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106535630B (en) | Multiple gene editing | |
| Yang et al. | Genome editing and its applications in genetic improvement in aquaculture | |
| CN105073981A (en) | Control of sexual maturation in animals | |
| WO2015068785A1 (en) | Vector for nucleic acid insertion | |
| CN105101787A (en) | Genetically modified animals and methods for making the same | |
| CN105473714A (en) | Genetically sterile animals | |
| WO2017094015A1 (en) | Methods for gender determination of avian embryos in unhatched eggs and means thereof | |
| US20170223938A1 (en) | Transgenic chickens with an inactivated endogenous gene locus | |
| US20150064149A1 (en) | Materials and methods for correcting recessive mutations in animals | |
| US20240052304A1 (en) | Sterile avian embryos, production and uses thereof | |
| US20200149063A1 (en) | Methods for gender determination and selection of avian embryos in unhatched eggs | |
| CN111073963B (en) | Method for identifying gender of fertilized eggs of chickens in one day | |
| CN114592075B (en) | Detection method of chimeric gonads after rice field eel germ cell xenograft and transplantation | |
| WO2017075270A1 (en) | Engineering of humanized by geneti complementation | |
| WO2021251493A1 (en) | Poultry cell in which target protein-encoding gene is knocked in at egg white protein gene, and method for producing said poultry cell | |
| JP7426120B2 (en) | Method for producing knock-in cells | |
| DK202170116A1 (en) | Genetically modified salmon which produce sterile offspring | |
| Ishikawa et al. | Medaka as a model teleost: characteristics and approaches of genetic modification | |
| CN115029382B (en) | Preparation method of genetically modified mice capable of distinguishing Tbx1 two variable cutters | |
| CN111849977B (en) | Method for preparing transgenic animals by sperm vector, sgRNA for preparing short and small transgenic chickens and preparation method | |
| CN113234758B (en) | Method for constructing traceless engineering animal by using PiggyBac transposase system | |
| US20190183100A1 (en) | Animal models for polycystic kidney disease | |
| CN117487860A (en) | Parent-mediated CRISPR-Cas9 sogatella furcifera next generation gene knockout method | |
| DK202270507A1 (en) | Modified salmion which produce sterile offspring | |
| CN117580955A (en) | Birds for producing female freshly hatched chicks and method for producing same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |